- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Rivier, D. H.
- Articles by Rine, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Rivier, D. H.
- Articles by Rine, J.
HMR-I Is an Origin of Replication and a Silencer in Saccharomyces cerevisiae
David H. Riviera, Joanne L. Ekenaa, and Jasper Rineba Department of Cell and Structural Biology and Department of Microbiology, University of Illinois, Urbana-Champaign, Urbana, Illinois 61801
b Department of Molecular and Cell Biology, Division of Genetics, University of California, Berkeley, California 94720
Corresponding author: David H. Rivier, Department of Cell and Structural Biology, University of Illinois, Urbana-Champaign, 601 S. Goodwin Ave., Urbana, IL 61801., rivier{at}uiuc.edu (E-mail)
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
There appear to be fundamental differences between the properties of the silencers at HML and HMR, with some being origins of replication and others not. Moreover, past studies have suggested that HMR-I's role in silencing may be restricted to plasmid contexts. This study established that HMR-I, like HMR-E and unlike either HML silencer, is an origin of replication. Moreover, both HMR-E and HMR-I contribute to silencing of a chromosomal HMR locus. In addition, we found that Abf1p plays no unique role in silencer function.
REPRESSION of transcription can occur by mechanisms that act locally, blocking the expression of a single gene, or regionally, blocking the expression of a cluster of genes. Transcriptional repression can inactivate genes for a brief period or can persist through many rounds of cell division. Position effects and genomic imprinting are two mechanisms of transcriptional repression that are clonally heritable even in the absence of the event that led to initial repression.
In the case of position effects, particular regions of eukaryotic chromosomes are assembled into heterochromatin, and the genes in those regions are inactivated. Conceptually, the formation of position effects can be thought of as involving an establishment event followed by other processes that allow clonal inheritance of the repressed state. The most dramatic example of a position effect, X-chromosome inactivation in female mammals, illustrates this formalism with the establishment event occurring early in embryogenesis, and inheritance operating at each subsequent cell division for the life of the individual.
Saccharomyces cerevisiae provides the opportunity for genetic analysis of a position effect that is known as silencing. Genes in three regions of the yeast genome, the HML and HMR silent-mating-type loci and the regions adjacent to the telomeres, are silenced (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In addition to the structural components of heterochromatin, silencing at the HML and HMR loci requires flanking regulatory elements known as silencers (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
At least one role of the silencers and their associated proteins is the recruitment of the SIR proteins to the silent regions. Two-hybrid analysis indicates that Rap1p binds Sir3p and Sir4p, suggesting that Rap1p acts to recruit Sir3p and Sir4p to the silencer region (![]()
![]()
![]()
![]()
Other aspects of silencer function are less well understood. For instance, although deletion of the HMR-E silencer abolishes silencing at HMR, none of the individual elements of the HMR-E silencer are required for silencing (![]()
![]()
In addition to its essential role in silencing, the HMR-E silencer is also a chromosomal origin of replication (![]()
![]()
The role of HMR-I in silencing and replication is unclear. Initial studies of HMR on a plasmid indicated that HMR-I contributed to silencing (![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Two-dimensional analysis of chromosomal replication intermediates:
Genomic DNA was isolated from 1010 log-phase cells in an asynchronous culture and digested to completion with EcoRV and XbaI. The HMR-I silencer was located in the center of this 3065-bp XbaI-EcoRV fragment (14511756 bp from the XbaI site). In addition, this fragment contains the a1 gene and part of the a2 gene but lacks the HMR-E silencer. DNA replication intermediates were enriched by chromatography on benzoylated naphthoylated DEAE cellulose (BND; Sigma, St. Louis), which preferentially binds single-stranded DNA, as described previously (![]()
![]()
genotype, this probe was unique to the HMR-I region (see Table 1).
|
Quantitative mating analysis:
Cells were grown to a final OD600 of 0.51.0 in rich media supplemented with adenine. Serial dilutions of test strains were mixed with 2.2 x 107 MAT
cells (JRY2726) and plated onto minimal medium supplemented with adenine. Equivalent dilutions of test strains were plated onto rich medium. Mating efficiencies were calculated as the number of diploids formed per viable cell plated.
Patch mating analysis:
Test strains were patched onto rich medium, grown overnight, and replica plated onto a lawn of MAT
cells (JRY2726) on minimal solid medium supplemented with adenine.
Construction of HMR::ADE2 alleles:
HMR::ADE2 was constructed in two steps. First, a BglII fragment containing the ADE2 gene was inserted into pRS202 (![]()
E) or pDR60 (HMR-SS), respectively. Plasmid pDR279 was created by replacing the BglII-HindIII fragment of pDR162 containing the HMR-I silencer with the BglII-HindIII fragment of pDR55 that contains a 305-bp deletion of HMR-I (described below). The HMR::ADE2 alleles were digested with EcoRI and PstI and integrated into strain DRY724.
Construction of HMR::URA3pr-ADE2 alleles:
A construct for inserting reporter genes at HMR was made in four steps. First, the Bluescript polylinker was cut with XbaI-PstI, filled in, and religated to create pDR546. Second, a HindIII-KpnI fragment of pDR546 was replaced by a NotI site contained in the oligonucleotides, 5' CCCAAGCTTGCGGCCGCGGTACCTAGCCC 3' and 5' GGGCTAGGTACCGCGGCCGCAAGCTTGGG 3', to create pDR570. Third, a partial XbaI-BglII fragment of HMR containing the a1 and a2 genes was replaced by BamHI and SalI sites contained in oligonucleotides 5' GCTCTAGAGGATCCCGGGGTCGACCGAGATCTTC 3' and 5' GAAGATCTCGGTCGACCCCGGGATCCTCTAGAGC 3', to create pDR550. Fourth, the EcoRI-HindIII fragment of pDR570 was inserted into EcoRI-HindIII-cleaved pDR570. The resulting plasmid, pDR576, contained HMR flanked by NotI sites with a polylinker replacing the a-genes. An HMRa
I derivative of pDR576 was made by replacing the BglII-HindIII fragment with the same fragment from pDR62, resulting in pDR606. Construction of HMR::URA3pr-ADE2 was as follows. A BamHI-SalI fragment of pURADE2 (generously provided by Oscar Aparicio) was inserted into a BamHI-SalI digest of either pDR606 (
I) or pDR610 (WT). The URA3pr-ADE2 fragment was oriented with the URA3 promoter proximal to the HMR-I silencer.
Deletion of HMR-I:
The deletion of HMR-I was constructed from two existing linker insertion mutations (![]()
59 and the XhoI-HindIII HMR fragment of
296-39 were inserted into EcoRI-HindIII-cleaved pUC18, resulting in plasmid pJR1270. DNA sequence analysis revealed that pJR1270 contains a deletion of 305 bp. The sequence of this deletion allele has been submitted to GenBank (Table 2).
|
Construction of synthetic silencer alleles:
The identity of each HMR-E allele has been submitted to GenBank and, hence, is only briefly described here. HMR-E alleles were constructed on plasmids (Table 2) and each allele was subsequently integrated into the chromosome. Each of the elements of the synthetic silencer, the ACS, the Rap1p-binding site, and the Abf1p-binding site is separated by unique restriction sites. To construct specific mutations at any site, a plasmid containing the synthetic silencer was restricted with the two enzymes that flank that site, and complementary synthetic oligonucleotides were inserted. The identity of these alleles was confirmed by DNA sequence analysis. Alleles of the synthetic silencer that alter the Abf1p-binding site were constructed in pJR1272. Construction of the HMR-SS abf1-2 allele has been previously described (referred to as ssb in ![]()
![]()
Combinations of mutations at HMR-E and deletion of HMR-I were constructed by inserting the BglII-HindIII fragment of pJR1270 that contained the HMR-I deletion into BglII-HindIII-cleaved plasmids that harbored the appropriate allele of HMR-E (Table 2).
Media and genetic manipulations:
Rich medium (YPD) and minimal medium (YM) were as described previously (![]()
![]()
![]()
| RESULTS |
|---|
HMR-I was a chromosomal origin of replication:
In the earlier studies of silencers on plasmids, all four mating-type silencers had ARS activity, implying that they were origins of replication (![]()
![]()
![]()
![]()
![]()
|
Analysis of a synthetic silencer:
A 138-bp synthetically constructed silencer was previously shown to be sufficient to bring about silencing at HMR when inserted into an 868-bp deletion that removed the wild-type HMR-E silencer (![]()
![]()
To determine whether the Rap1p-binding site of the synthetic silencer was required for silencing, a mutant version of this site was created and a synthetic silencer harboring this mutation was inserted into the chromosome in place of the natural HMR-E. In particular, two bases of the Rap1p-binding site were changed. Previous analysis of the wild-type silencer demonstrated that the C-to-A transversion in the fifth nucleotide of the Rap1p-binding site alone was sufficient to prevent Rap1p binding in vitro and to abolish silencing in vivo in combination with a mutation in the Abf1p-binding site of the natural silencer (![]()
HMRa strains in which HMR is silent display the
-mating phenotype, whereas MAT
HMRa strains in which HMR is not silent display a nonmating phenotype. The 2-bp substitution in the Rap1p-binding site of the synthetic silencer reduced mating efficiency by four orders of magnitude as judged by a quantitative mating assay (Figure 2). Hence, the Rap1p-binding site of the synthetic silencer, like the ACS of the synthetic silencer, provided a nonredundant function that was required for silencing.
|
A similar approach was taken to determine whether the Abf1p-binding site of the synthetic silencer was required for silencing. Initially an A-T insertion mutation was created in the center of this site. In the context of the wild-type silencer, this mutation abolishes Abf1p binding in vitro and abolishes silencing in vivo in combination with a mutation in the Rap1p-binding site of the natural silencer (![]()
![]()
Role of HMR-I in combination with the synthetic silencer:
The results presented above suggested that the synthetic silencer might provide a sensitive context for testing the role of HMR-I in silencing. In particular, if HMR-I does not normally contribute to silencing at HMR, deletion of the HMR-I silencer would not result in a greater silencing defect in the presence of the synthetic HMR-E silencer or any of the mutant alleles described above. In contrast, if HMR-I normally contributes to silencing at HMR, deletion of HMR-I would likely result in a silencing defect in combination with at least some mutant alleles of the synthetic silencer. To test the role of HMR-I in silencing, the 305-bp region containing HMR-I was deleted from strains harboring various alleles of HMR-E. Deletion of HMR-I from a strain harboring the wild-type HMR-E did not result in a significant decrease in mating efficiency, as previously described (![]()
The mutations of the ACS or Rap1p-binding site of the synthetic silencer reduced silencing as judged by mating efficiency to 10-4 of wild type, but did not completely abolish silencing because deletion of HMR-E results in a 10-6-fold reduction of mating ability (Figure 2). The residual silencing ability contributed by the mutant HMR-E alleles depended on a contribution from HMR-I. Specifically, deletion of HMR-I in combination with mutations in the ACS of the synthetic silencer or the Rap1p-binding site of the synthetic silencer reduced mating efficiency by an additional two orders of magnitude (Figure 2). Thus, HMR-I contributed to silencing at HMR.
HMR-I and HMR-E contributed jointly to silencing reporter genes inserted at HMR:
Deletion of HMR-I did not result in a silencing defect in an otherwise wild-type HMR locus as judged by quantitative mating assays. We used a more sensitive assay of silencing at HMR to examine the contribution of HMR-I in wild-type cells more clearly. The ADE2 gene has been used as a sensitive reporter gene for monitoring either telomeric silencing or silencing at HMR (![]()
![]()
|
As a second test of whether the wild-type HMR-E and HMR-I silencers both contribute to complete silencing at HMR, we assessed the role of HMR-I with a different reporter gene inserted at HMR in place of the mating-type genes. Previous analysis revealed that activated transcription and silencing are competitive processes (![]()
![]()
![]()
|
Functional redundancy among elements:
Deletion of either the Rap1p-binding site or the Abf1p-binding site of the wild-type HMR-E silencer has little or no effect on silencing, whereas deletion of both binding sites results in substantial loss of silencing. There are at least two ways to think about this apparent redundancy. One view is that Rap1p and Abf1p each make a unique contribution to silencing. In this case, the apparent redundancy could be explained if, in the absence of either the Rap1p-binding site or the Abf1p-binding site, both Rap1p and Abf1p are retained in the protein complex at the silencer via protein-protein interactions, whereas in the absence of both binding sites either Rap1p, Abf1p, or both are not retained in the complex. The other possibility is that Rap1p and Abf1p each provide a qualitatively similar activity that can contribute to silencing and that either protein alone can provide that activity.
A strain containing the synthetic silencer and lacking HMR-I offered the opportunity to test a prediction of the model that Abf1p and Rap1p provide qualitatively similar activities. In this strain both the Rap1p- and Abf1p-binding sites are required for silencing. If Rap1p and Abf1p provide qualitatively similar functions in silencing, then a synthetic silencer composed of an ACS and two Rap1p-binding sites or an ACS and two Abf1p-binding sites would be expected to function as a silencer. In contrast, if Rap1p and Abf1p provided qualitatively distinct functions that are required for silencing, synthetic silencers composed of an ACS and two Rap1p sites or an ACS and two Abf1p sites would not be expected to function as silencers. To test whether Rap1p and Abf1p may provide similar functions in silencing, two synthetic silencers were created. In the first, the Abf1p-binding site was replaced with a Rap1p-binding site such that the spacing among the silencer elements was maintained [HMR-SS (RAP-RAP)]. This synthetic construct was capable of silencing the mating-type genes at HMR in the absence of the HMR-I silencer (Figure 5). This observation suggested that Abf1p does not provide a unique function that is required for silencing at HMR. Furthermore, the ability of a second Rap1p-binding site to substitute for the Abf1p-binding site suggested that Rap1p provided a silencing function that was qualitatively similar to that of Abf1p. However, an alternate possibility is that the Rap1p-binding site provides a function that is qualitatively distinct from the Abf1p-binding site and that a quantitive increase in that function can bring about efficient silencing. A synthetic silencer in which the Rap1p site was replaced with a second Abf1p site, such that the spacing was maintained among the silencer elements, was not capable of silencing the mating-type genes at HMR in the absence of HMR-I (data not shown).
|
| DISCUSSION |
|---|
This work investigated the role of HMR-I in silencing and DNA replication. Two lines of evidence indicated that HMR-I contributed to silencing. First, deletion of HMR-I resulted in silencing defects of the MATa1 gene at HMR when assayed in combination with mutant alleles of the HMR-E silencer. Second, deletion of HMR-I resulted in silencing defects of two different reporter genes inserted at HMR and flanked by a wild-type copy of HMR-E.
Moreover, the HMR-E and the HMR-I silencers appeared to contribute jointly to complete silencing of HMR. The most striking example of this joint contribution was seen with alleles of the synthetic silencer with a mutated Abf1p-binding site. Cells with this HMR-E allele and wild-type HMR-I silenced HMR to approximately wild-type levels. However, in cells with this HMR-E allele that lacked HMR-I, silencing was reduced by four orders of magnitude as judged by quantitative mating assays. Thus, elements at both HMR-E and at HMR-I contributed to silencing. Analysis of a reporter gene at HML has led to the idea that the HML-E and HML-I silencers contribute jointly to silence HML (![]()
This work also addressed the molecular nature of the "redundancy" of the HMR-E silencer. In the absence of HMR-I, efficient silencing could be brought about by a synthetic silencer that contained an ACS, a Rap1p-binding site, and an Abf1p-binding site, or by a synthetic silencer that contained an ACS and two Rap1p-binding sites. These observations suggest that silencing was not brought about by a single type of protein complex at each of the silencers and telomeres. Rather, these observations suggest that distinct combinations of ORC, Rap1p, and Abf1p proteins can recruit the SIR proteins.
HMR-I was also found to be a chromosomal origin of replication. Thus, both silencers at HMR are chromosomal origins of replication and both function in silencing. Despite this relationship, a variety of evidence suggests that initiation of replication from the silencers is not required for silencing. For instance, essential roles of ORC in silencing and in initiation of replication are genetically separable (![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank M. Bourne and C. Fox for help with plasmid and strain construction, C. Fox for help with mating analysis, P. Laski for sequencing the HMR-I deletion, and Oscar Aparicio for the pURADE2 plasmid. This work was supported by grants from the National Institutes of Health (GM-31105 to J.R. and GM-52103 to D.R.), by Basil O'Connor Starter Scholar Research Award grant no. 5-FY96-0578 (D.R.), and by an NIH predoctoral training award (5T32-GM07283 to J.E.).
Manuscript received August 24, 1998; Accepted for publication November 2, 1998.
| LITERATURE CITED |
|---|
ABRAHAM, J., J. FELDMAN, K. A. NASMYTH, J. N. STRATHERN, and A. J. KLAR et al., 1983 Sites required for position-effect regulation of mating-type information in yeast. Cold Spring Harbor Symp. Quant. Biol. 47:989-998.
ABRAHAM, J., K. A. NASMYTH, J. N. STRATHERN, A. J. KLAR, and J. B. HICKS, 1984 Regulation of mating-type information in yeast. Negative control requiring sequences both 5' and 3' to the regulated region. J. Mol. Biol. 176:307-331[Medline].
APARICIO, O. M. and D. E. GOTTSCHLING, 1994 Overcoming telomeric silencing: a trans-activator competes to establish gene expression in a cell cycle-dependent way. Genes Dev. 8:1133-1146
APARICIO, O. M., B. L. BILLINGTON, and D. E. GOTTSCHLING, 1991 Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae.. Cell 66:1279-1287[Medline].
BOSCHERON, C., L. MAILLET, S. MARCAND, M. TSAI-PFLUGFELDER, and S. M. GASSER et al., 1996 Cooperation at a distance between silencers and proto-silencers at the yeast HML locus. EMBO J. 15:2184-2195[Medline].
BRAND, A. H., L. BREEDEN, J. ABRAHAM, R. STERNGLANZ, and K. NASMYTH, 1985 Characterization of a "silencer" in yeast: a DNA sequence with properties opposite to those of a transcriptional enhancer. Cell 41:41-48[Medline].
BRAND, A. H., G. MICKLEM, and K. NASMYTH, 1987 A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51:709-719[Medline].
BREWER, B. J. and W. L. FANGMAN, 1987 The localization of replication origins on ARS plasmids in S. cerevisiae. Cell 51:463-471[Medline].
BRYK, M., M. BANERJEE, M. MURPHY, K. E. KNUDSEN, and D. J. GARFINKEL et al., 1997 Transcriptional silencing of Ty1 elements in the RDN1 locus of yeast. Genes Dev. 11:255-269
BUCHMAN, A. R., W. J. KIMMERLY, J. RINE, and R. D. KORNBERG, 1988a Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae.. Mol. Cell. Biol. 8:210-225
BUCHMAN, A. R., N. F. LUE, and R. D. KORNBERG, 1988b Connections between transcriptional activators, silencers, and telomeres as revealed by functional analysis of a yeast DNA-binding protein. Mol. Cell. Biol. 8:5086-5099
DILLIN, A. and J. RINE, 1997 Separable functions of ORC5 in replication initiation and silencing in Saccharomyces cerevisiae.. Genetics 147:1053-1062[Abstract].
DUBEY, D. D., L. R. DAVIS, S. A. GREENFEDER, L. Y. ONG, and J. G. ZHU et al., 1991 Evidence suggesting that the ARS elements associated with silencers of the yeast mating-type locus HML do not function as chromosomal DNA replication origins. Mol. Cell. Biol. 11:5346-5355
FELDMAN, J. B., J. B. HICKS, and J. R. BROACH, 1984 Identification of sites required for repression of a silent mating type locus in yeast. J. Mol. Biol. 178:815-834[Medline].
FOSS, M., F. J. MCNALLY, P. LAURENSON, and J. RINE, 1993 Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae.. Science 262:1838-1844
GARDNER, K. A., J. RINE, and C. A. FOX, 1999 A region of the Sir1 protein dedicated to recognition of a silencer and required for interaction with the Orc1 protein in Saccharomyces cerevisiae. Genetics 151:31-44
GIETZ, R. D. and R. H. SCHIESTL, 1991 Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast 7:253-263[Medline].
GOTTSCHLING, D. E., O. M. APARICIO, B. L. BILLINGTON, and V. A. ZAKIAN, 1990 Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63:751-762[Medline].
GRUNSTEIN, M., 1997 Molecular model for telomeric heterochromatin in yeast. Curr. Opin. Cell. Biol. 9:383-387[Medline].
GRUNSTEIN, M., 1998 Yeast heterochromatin: regulation of its assembly and inheritance by histones. Cell 93:325-328[Medline].
GUTHRIE, C., and G. R. FINK, 1991 Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.
HECHT, A., T. LAROCHE, S. STRAHL-BOLSINGER, S. M. GASSER, and M. GRUNSTEIN, 1995 Histone H3 and H4 N-termini interact with SIR3 and SIR4 proteins: a molecular model for the formation of heterochromatin in yeast. Cell 80:583-592[Medline].
HECHT, A., S. STRAHL-BOLSINGER, and M. GRUNSTEIN, 1996 Spreading of transcriptional repressor SIR3 from telomeric heterochromatin. Nature 383:92-96[Medline].
KIMMERLY, W. J. and J. RINE, 1987 Replication and segregation of plasmids containing cis-acting regulatory sites of silent mating-type genes in Saccharomyces cerevisiae are controlled by the SIR genes. Mol. Cell. Biol. 7:4225-4237
KIMMERLY, W., A. BUCHMAN, R. KORNBERG, and J. RINE, 1988 Roles of two DNA-binding factors in replication, segregation and transcriptional repression mediated by a yeast silencer. EMBO J. 7:2241-2253[Medline].
LAURENSON, P. and J. RINE, 1992 Silencers, silencing, and heritable transcriptional states. Microbiol. Rev. 56:543-560
LOO, S. and J. RINE, 1994 Silencers and domains of generalized repression. Science 264:1768-1771
LOO, S., P. LAURENSON, M. FOSS, A. DILLIN, and J. RINE, 1995 Roles of ABF1, NPL3, and YCL54 in silencing in Saccharomyces cerevisiae.. Genetics 141:889-902[Abstract].
LUSTIG, A. J., 1998 Mechanisms of silencing in Saccharomyces cerevisiae.. Curr. Opin. Genet. Dev. 8:233-239[Medline].
MCNALLY, F. J. and J. RINE, 1991 A synthetic silencer mediates SIR-dependent functions in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:5648-5659
MORETTI, P., K. FREEMAN, L. COODLY, and D. SHORE, 1994 Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev. 8:2257-2269
NEWLON, C. S. and J. F. THEIS, 1993 The structure and function of yeast ARS elements. Curr. Opin. Genet. Dev. 3:752-758[Medline].
PILLUS, L. and J. RINE, 1989 Epigenetic inheritance of transcriptional states in S. cerevisiae.. Cell 59:637-647[Medline].
RENAULD, H., O. M. APARICIO, P. D. ZIERATH, B. L. BILLINGTON, and S. K. CHHABLANI et al., 1993 Silent domains are assembled continuously from the telomere and are defined by promoter distance and strength, and by SIR3 dosage. Genes Dev. 7:1133-1145
RINE, J. and I. HERSKOWITZ, 1987 Four genes responsible for a position effect on expression from HML and HMR in Saccharomyces cerevisiae.. Genetics 116:9-22
RIVIER, D. H. and J. RINE, 1992a An origin of DNA replication and a transcription silencer require a common element. Science 256:659-663
RIVIER, D. H. and J. RINE, 1992b Silencing: the establishment and inheritance of stable, repressed transcription states. Curr. Opin. Genet. Dev. 2:286-292[Medline].
ROY, A., F. EXINGER, and R. LOSSON, 1990 cis- and trans-acting regulatory elements of the yeast URA3 promoter. Mol. Cell. Biol. 10:5257-5270
SHERMAN, F., 1991 Getting started with yeast. Methods Enzymol. 194:3-21[Medline].
SHORE, D. and K. NASMYTH, 1987 Purification and cloning of a DNA binding protein from yeast that binds to both silencer and activator elements. Cell 51:721-732[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27
SMITH, J. S. and J. D. BOEKE, 1997 An unusual form of transcriptional silencing in yeast ribosomal DNA. Genes Dev 11:241-254
STRAHL-BOLSINGER, S., A. HECHT, K. LUO, and M. GRUNSTEIN, 1997 SIR2 and SIR4 interactions differ in core and extended telomeric heterochromatin in yeast. Genes Dev. 11:83-93
SUSSEL, L., D. VANNIER, and D. SHORE, 1993 Epigenetic switching of transcriptional states: cis- and trans-acting factors affecting establishment of silencing at the HMR locus in Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:3919-3928
TRIOLO, T. and R. STERNGLANZ, 1996 Role of interactions between the origin recognition complex and SIR1 in transcriptional silencing. Nature 381:251-253[Medline].
This article has been cited by other articles:
![]() |
P. J. Lynch and L. N. Rusche A Silencer Promotes the Assembly of Silenced Chromatin Independently of Recruitment Mol. Cell. Biol., January 1, 2009; 29(1): 43 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Vandre, R. T. Kamakaka, and D. H. Rivier The DNA End-Binding Protein Ku Regulates Silencing at the Internal HML and HMR Loci in Saccharomyces cerevisiae Genetics, November 1, 2008; 180(3): 1407 - 1418. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chang, J. F. Theis, J. Miller, C. A. Nieduszynski, C. S. Newlon, and M. Weinreich Analysis of Chromosome III Replicators Reveals an Unusual Structure for the ARS318 Silencer Origin and a Conserved WTW Sequence within the Origin Recognition Complex Binding Site Mol. Cell. Biol., August 15, 2008; 28(16): 5071 - 5081. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gao and D. S. Gross Sir2 Silences Gene Transcription by Targeting the Transition between RNA Polymerase II Initiation and Elongation Mol. Cell. Biol., June 15, 2008; 28(12): 3979 - 3994. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Valenzuela, N. Dhillon, R. N. Dubey, M. R. Gartenberg, and R. T. Kamakaka Long-Range Communication between the Silencers of HMR Mol. Cell. Biol., March 15, 2008; 28(6): 1924 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Casey, E. E. Patterson, U. Muller, and C. A. Fox Conversion of a Replication Origin to a Silencer through a Pathway Shared by a Forkhead Transcription Factor and an S Phase Cyclin Mol. Biol. Cell, February 1, 2008; 19(2): 608 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Dubey and M. R. Gartenberg A tDNA establishes cohesion of a neighboring silent chromatin domain Genes & Dev., September 1, 2007; 21(17): 2150 - 2160. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Yang and A. L. Kirchmaier Bypassing the Catalytic Activity of SIR2 for SIR Protein Spreading in Saccharomyces cerevisiae Mol. Biol. Cell, December 1, 2006; 17(12): 5287 - 5297. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zou, Q. Yu, and X. Bi Asymmetric Positioning of Nucleosomes and Directional Establishment of Transcriptionally Silent Chromatin by Saccharomyces cerevisiae Silencers Mol. Cell. Biol., October 15, 2006; 26(20): 7806 - 7819. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zou, Q. Yu, Y.-H. Chiu, and X. Bi Position Effect on the Directionality of Silencer Function in Saccharomyces cerevisiae Genetics, September 1, 2006; 174(1): 203 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. McConnell, P. Muller, and C. A. Fox Tolerance of Sir1p/Origin Recognition Complex-Dependent Silencing for Enhanced Origin Firing at HMRa. Mol. Cell. Biol., March 1, 2006; 26(5): 1955 - 1966. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Irlbacher, J. Franke, T. Manke, M. Vingron, and A. E. Ehrenhofer-Murray Control of replication initiation and heterochromatin formation in Saccharomyces cerevisiae by a regulator of meiotic gene expression Genes & Dev., August 1, 2005; 19(15): 1811 - 1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oki, L. Valenzuela, T. Chiba, T. Ito, and R. T. Kamakaka Barrier Proteins Remodel and Modify Chromatin To Restrict Silenced Domains Mol. Cell. Biol., March 1, 2004; 24(5): 1956 - 1967. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grunweller and A. E. Ehrenhofer-Murray A Novel Yeast Silencer: The 2{micro} Origin of Saccharomyces cerevisiae Has HST3-, MIG1- and SIR-Dependent Silencing Activity Genetics, September 1, 2002; 162(1): 59 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Poloumienko, A. Dershowitz, J. De, and C. S. Newlon Completion of Replication Map of Saccharomyces cerevisiae Chromosome III Mol. Biol. Cell, November 1, 2001; 12(11): 3317 - 3327. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sharma, M. Weinberger, and J. A. Huberman Roles for Internal and Flanking Sequences in Regulating the Activity of Mating-Type-Silencer-Associated Replication Origins in Saccharomyces cerevisiae Genetics, September 1, 2001; 159(1): 35 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, M. Vujcic, and D. Kowalski DNA Replication Forks Pause at Silent Origins near the HML Locus in Budding Yeast Mol. Cell. Biol., August 1, 2001; 21(15): 4938 - 4948. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Forsberg and P. O. Ljungdahl Genetic and Biochemical Analysis of the Yeast Plasma Membrane Ssy1p-Ptr3p-Ssy5p Sensor of Extracellular Amino Acids Mol. Cell. Biol., February 1, 2001; 21(3): 814 - 826. [Abstract] [Full Text] |
||||
![]() |
A. L. Kirchmaier and J. Rine DNA Replication-Independent Silencing in S. cerevisiae Science, January 26, 2001; 291(5504): 646 - 650. [Abstract] [Full Text] |
||||
![]() |
P. C. Hollenhorst, M. E. Bose, M. R. Mielke, U. Müller, and C. A. Fox Forkhead Genes in Transcriptional Silencing, Cell Morphology and the Cell Cycle: Overlapping and Distinct Functions for FKH1 and FKH2 in Saccharomyces cerevisiae Genetics, April 1, 2000; 154(4): 1533 - 1548. [Abstract] [Full Text] |
||||
![]() |
T.-H. Cheng and M. R. Gartenberg Yeast heterochromatin is a dynamic structure that requires silencers continuously Genes & Dev., February 15, 2000; 14(4): 452 - 463. [Abstract] [Full Text] |
||||
![]() |
M. Vujcic, C. A. Miller, and D. Kowalski Activation of Silent Replication Origins at Autonomously Replicating Sequence Elements near the HML Locus in Budding Yeast Mol. Cell. Biol., September 1, 1999; 19(9): 6098 - 6109. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Y. Xu, S. Kim, K. Replogle, J. Rine, and D. H. Rivier Identification of SAS4 and SAS5, Two Genes That Regulate Silencing in Saccharomyces cerevisiae Genetics, September 1, 1999; 153(1): 13 - 23. [Abstract] [Full Text] |
||||
![]() |
E. Y. Xu, S. Kim, and D. H. Rivier SAS4 and SAS5 Are Locus-Specific Regulators of Silencing in Saccharomyces cerevisiae Genetics, September 1, 1999; 153(1): 25 - 33. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Rivier, D. H.
- Articles by Rine, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Rivier, D. H.
- Articles by Rine, J.









