Genetics, Vol. 151, 511-519, February 1999, Copyright © 1999

A Mutation of the Yeast Gene Encoding PCNA Destabilizes Both Microsatellite and Minisatellite DNA Sequences

Robert J. Kokoskaa, Lela Stefanovica, Andrew B. Buermeyerb, R. Michael Liskayb, and Thomas D. Petesa
a Department of Biology and Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, North Carolina 27599-3280
b Department of Molecular and Medical Genetics, Oregon Health Sciences University, Portland, Oregon 97201-3098

Corresponding author: Thomas D. Petes, Department of Biology, University of North Carolina, Chapel Hill, NC 27599-3280., tompetes{at}email.unc.edu (E-mail)

Communicating editor: P. L. FOSTER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The POL30 gene of the yeast Saccharomyces cerevisiae encodes the proliferating cell nuclear antigen (PCNA), a protein required for processive DNA synthesis by DNA polymerase {delta} and {epsilon}. We examined the effects of the pol30-52 mutation on the stability of microsatellite (1- to 8-bp repeat units) and minisatellite (20-bp repeat units) DNA sequences. It had previously been shown that this mutation destabilizes dinucleotide repeats 150-fold and that this effect is primarily due to defects in DNA mismatch repair. From our analysis of the effects of pol30-52 on classes of repetitive DNA with longer repeat unit lengths, we conclude that this mutation may also elevate the rate of DNA polymerase slippage. The effect of pol30-52 on tracts of repetitive DNA with large repeat unit lengths was similar, but not identical, to that observed previously for pol3-t, a temperature-sensitive mutation affecting DNA polymerase {delta}. Strains with both pol30-52 and pol3-t mutations grew extremely slowly and had minisatellite mutation rates considerably greater than those observed in either single mutant strain.


ALL eukaryotic genomes contain tracts of simple repetitive DNA, regions in which a small number of bases are tandemly repeated (TAUTZ and SCHLOTTERER 1994 Down). These repetitive regions can be classified as either microsatellites (repeat units from 1–13 bp in arrays of 10–60 bp) or minisatellites (repeat units >15 bp, often in arrays of several hundred base pairs). In Escherichia coli (LEVINSON and GUTMAN 1987 Down), Saccharomyces cerevisiae (HENDERSON and PETES 1992 Down), and mammals (WEBER and WONG 1993 Down), simple repetitive DNA tracts are unstable, altering in length by additions or deletions of small numbers of repeat units.

On the basis of studies of the genetic control of microsatellite stability in bacteria and yeast (reviewed by SIA et al. 1997A Down) and the analysis of mutations generated during DNA replication in vitro (reviewed by KUNKEL 1992 Down), it is likely that small changes in the number of repeats within simple repetitive tracts are a consequence of DNA polymerase slippage. According to this model (Figure 1), during replication of a repetitive tract, a transient dissociation of the primer and template DNA strands allows a misaligned reassociation of the two strands (STREISINGER et al. 1966 Down). This misalignment results in a loop of one or more unpaired repeat units. If this DNA mismatch remains uncorrected, the repetitive tract will contain more repeats (if the DNA loop is on the primer strand) or fewer repeats (if the loop is on the template strand) following a second round of replication. One prediction of this model is that two different classes of mutants leading to destabilized microsatellites should be observed: those deficient in the repair of DNA loops and those affecting DNA polymerase or cofactors resulting in increased rates of DNA polymerase slippage.



View larger version (12K):
In this window
In a new window
Download PPT slide
 
Figure 1. Alterations in the length of simple repetitive DNA sequences by DNA polymerase slippage. Complementary DNA strands are shown with repeat units shown by rectangles. Top and bottom strands represent primer and template strands, respectively; a small arrow represents the 3' end of the template strand and a triangle indicates the 3' end of the primer strand. In step 1, primer and template strands transiently dissociate. In step 2, misalignment upon reannealing of the strands results in loops on either the template strand (right) or primer strand (left). In step 3, DNA synthesis is completed. If the DNA loops are not repaired, a deletion (right) or addition (left) of repeat units would result following the subsequent round of DNA synthesis.

Mutations in genes required for DNA mismatch repair elevate greatly microsatellite instability in E. coli (LEVINSON and GUTMAN 1987 Down; STRAUSS et al. 1997 Down), yeast (STRAND et al. 1993 Down, STRAND et al. 1995 Down; SIA et al. 1997B Down), and mammalian cells (reviewed by KOLODNER 1996 Down; MODRICH and LAHUE 1996 Down). These results suggest that small loops forming as a result of DNA polymerase slippage are efficiently removed by the DNA-mismatch-repair system, and this interpretation is supported by studies of the properties of DNA mismatch repair in vitro (KOLODNER 1996 Down; MODRICH and LAHUE 1996 Down). We previously demonstrated that yeast strains with a mismatch-repair deficiency as a consequence of msh2 or mlh1 null mutations had elevated levels of repeat instability for repetitive tracts with repeat unit lengths between 1 and 13 bp (SIA et al. 1997B Down). No effect of these mutations was observed for repetitive tracts in which the repeat unit length was 16 bp or greater. We defined those tracts with repetitive units of 13 bp or less as microsatellites and those with tracts with repeat units >15 bp as minisatellites.

Although loss of mismatch-repair function does not affect minisatellite instability, mutations in two yeast genes whose products are components of the DNA replication system destabilize both minisatellites and microsatellites. A null mutation of the RAD27 gene, which encodes a nuclease involved in Okazaki fragment maturation, results in an 11-fold enhancement in the rate of minisatellite instability (KOKOSKA et al. 1998 Down) and 20- to 200-fold destabilizing effects on microsatellites containing various repeat unit lengths (JOHNSON et al. 1995 Down; KOKOSKA et al. 1998 Down; SCHWEITZER and LIVINGSTON 1998 Down). In addition, yeast strains bearing a temperature-sensitive allele of the POL3 gene (pol3-t; TRAN et al. 1995 Down, TRAN et al. 1996 Down), an essential gene encoding the catalytic subunit of DNA polymerase {delta}, exhibit a 13-fold increase in the rate of minisatellite instability and small effects on microsatellite instability (KOKOSKA et al. 1998 Down).

The proliferating cell nuclear antigen (PCNA) has a role in both DNA replication and DNA repair. PCNA is a replication processivity factor that binds DNA polymerase {delta} and {epsilon} to DNA during replication (KRISHNA et al. 1994 Down) and is required for SV40 replication in vitro (PRELICH et al. 1987A Down, PRELICH et al. 1987B Down). In yeast, PCNA is encoded by POL30 (BAUER and BURGERS 1990 Down), and mutant pol30 alleles that lead to in vitro and in vivo defects in DNA replication have been characterized (AYYAGARI et al. 1995 Down; AMIN and HOLM 1996 Down). In addition to these replication-defective alleles, some pol30 alleles affecting UV sensitivity (indicating a deficiency in in vivo nucleotide excision repair) or the level of spontaneous mutation (indicating an in vivo deficiency in DNA mismatch repair) have been identified (AYYAGARI et al. 1995 Down; AMIN and HOLM 1996 Down). Because some of these mutant strains do not exhibit a DNA replication defect (AYYAGARI et al. 1995 Down), the role of PCNA in DNA repair is separable from its role as a DNA polymerase processivity factor. As described below, these dual roles of PCNA are also demonstrated by analysis of the pol30-52 allele.

Yeast cells bearing the cold-sensitive pol30-52 allele arrest as large budded cells at the restrictive temperature, consistent with a defect in DNA replication (AYYAGARI et al. 1995 Down). This mutation also causes a 5-fold increase in cycloheximide resistance in a forward mutation assay (AYYAGARI et al. 1995 Down) and an 80- to 150-fold increase in the instability of a poly GT tract (JOHNSON et al. 1996 Down; UMAR et al. 1996 Down). The level of dinucleotide tract instability in a strain with both the pol30-52 and a mlh1 mutation is about the same as that observed in the single-mutant strains (UMAR et al. 1996 Down). This result suggests that the effect of pol30-52 on dinucleotide tracts is primarily on DNA mismatch repair. This conclusion is also supported by the physical interactions between PCNA and both Mlh1p and Msh2p, as well as the requirement for PCNA in an in vitro mismatch-repair assay using human cell extracts (UMAR et al. 1996 Down; GU et al. 1998 Down). One interpretation of these data is that PCNA associates with the DNA-mismatch-repair machinery to ensure the preferential removal of mismatched bases from the newly synthesized strand (UMAR et al. 1996 Down).

To clarify further the role of PCNA in DNA replication and mismatch repair, we examined the effect of the pol30-52 mutation on the stability of microsatellites in which the size of the repeat unit varies from 1 to 8 bp and a minisatellite containing 20-bp repeat units. We found that the pol30-52 mutation destabilized both microsatellites and minisatellites, suggesting that the destabilizing effect of this mutation on simple repetitive DNA is not limited to an effect on DNA mismatch repair.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and plasmids:
All yeast strains were derived from AMY125 ({alpha} ade5-1 leu2-3 trp1-289 ura3-52 his7-2; STRAND et al. 1993 Down). MS71 is a LEU2 derivative of AMY125 (STRAND et al. 1995 Down). MS71-pol3-t was described previously (KOKOSKA et al. 1998 Down). LS1-59 ({alpha} pol30-52 derivative of MS71) was constructed by transformation of MS71 with EcoRI-treated pBL241-52 (AYYAGARI et al. 1995 Down; supplied by P. BURGERS, Washington University); this plasmid contains a 1.1-kb KpnI-SpeI fragment of pol30-52 inserted into the KpnI-SpeI site of the URA3-containing integration vector pRS306. Following selection and purification of Ura+ transformants, we performed the second step of the transplacement using medium containing 5-fluoroorotate (5-FOA; BOEKE et al. 1984 Down). The resulting Ura- isolates were screened for the presence of pol30-52 by screening for the inability to grow at 14°, because strains with this mutation are cold sensitive (AYYAGARI et al. 1995 Down).

To obtain isogenic haploid strains with both the pol30-52 and pol3-t mutations, we sporulated and dissected a diploid (RJK127-4) that was heterozygous for these mutations; in addition, this diploid contained a plasmid (pEAS20) used to assay minisatellite stability. The diploid was constructed by mating LS1-59::pEAS20 and a derivative of MS71-pol3-t (RJK109-3) that had been switched to the opposite mating type.

To determine the effect of pol30-52 on various types of repetitive DNA sequences, we transformed LS1-59 with the TRP1-containing assay plasmids pMD28, pSH44, pBK3, pBK10, and pEAS20 (HENDERSON and PETES 1992 Down; SIA et al. 1997B Down), selecting for Trp+ derivatives. Each of these plasmids contains a microsatellite or minisatellite inserted in-frame within the coding sequence of the URA3 gene. The sequences of the repeats within these plasmids are pMD28, (G)18; pSH44, (GT)16; pBK3, (CAACG)15; pBK10, (CAATCGGT)10; pEAS20, (CAACGCAATGCGTTGGATCT)3.

Analysis of simple repeat instability in pol30-52 strains:
The derivatives of LS1-59 that contained the assay plasmids pMD28, pSH44, pBK3, pBK10, or pEAS20 were phenotypically Ura+, because the repetitive sequences within the plasmids were inserted in-frame within URA3. Alterations in tract length (either additions or deletions) resulting in an out-of-frame insertion can be selected by plating the cells on medium containing 5-FOA (HENDERSON and PETES 1992 Down; SIA et al. 1997B Down). To determine the rate of instability for each of the repetitive tracts, we measured the frequencies of 5-FOAR cells in 12–20 independent cultures. These frequency measurements were converted to rates using the method of the median (LEA and COULSON 1949 Down), as described previously (HENDERSON and PETES 1992 Down). The rate data shown in Table 1 are based on rates calculated for two independently derived transformants; for each pair of transformants, the rate measurements agreed within a factor of two.


 
View this table:
In this window
In a new window

 
Table 1. Rates of microsatellite and minisatellite instability in wild-type, msh2::Tn10LUK, and pol30-52 strains

Additional details of the rate measurements (for example, the composition of the media) have been previously described (WIERDL et al. 1997 Down). For most of the experiments, the pol30-52 strains were grown at 30° before analysis on 5-FOA-containing medium also at 30°. For comparisons of the rate of instability of the single pol30-52 and pol3-t mutants with the double-mutant pol30-52 pol3-t strain, the cells were grown and assayed for 5-FOA resistance at 25°.

The types of alterations generated in independent 5-FOAR isolates were determined by PCR or DNA sequence analysis, as described previously (SIA et al. 1997B Down).

Analysis of minisatellite instability in pol30-52 pol3-t strains:
As described above, pol30-52 pol3-t double-mutant haploid strains were constructed by sporulating and dissecting the doubly heterozygous diploid strain RJK127-4; the diploid was grown, prior to sporulation, in medium lacking tryptophan to force retention of the pEAS20 plasmid. The resulting spores were grown for 5 days at 25°. About one-quarter of the spore colonies were very small. We measured the number of cells in each colony (with a hemocytometer), as well as the number of viable cells (by plating the cells on rich growth medium). We also examined the ability of these strains to grow at 37° and 14°, the restrictive temperatures of strains with pol3-t and pol30-52 mutations, respectively. We found that the very small spore colonies had the double mutation.

With continued subculturing of the double-mutant strains, we found that faster-growing derivatives appeared. To reduce the probability of such secondary mutations, we modified the procedure for monitoring tract stability to eliminate subculturing. We suspended spore colonies in sterile water, plated one aliquot on solid medium lacking tryptophan (to score the number of viable cells that retained the pEAS20 assay plasmid), and a second aliquot to 5-FOA-containing medium (to monitor alterations in the minisatellite in pEAS20). Colonies on these two plates were scored after 7 days at 25°; the ability of the cells to grow at 14° and 37° was also determined. From the frequency of 5-FOAR cells in each spore colony, we calculated a rate of instability using the method of the median as described above; the rate calculation for the double-mutant strain was based on nine spore colonies.

Statistical analyses:
Confidence limits of 95% on rate estimates were assigned by the method described previously (WIERDL et al. 1996 Down). For comparisons of the types of tract alterations in different mutant backgrounds, we used the Fisher exact test [Instat 1.12 (GraphPad Software) for the Macintosh].


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Microsatellite instability in the pol30-52 mutant:
UMAR et al. 1996 Down previously showed that a yeast strain with the pol30-52 mutation has a 150-fold elevation in the frequency of alterations in a dinucleotide microsatellite. As described in the Introduction, several lines of evidence suggested that this mutation causes a defect in DNA mismatch repair. To define more completely the role of PCNA in mismatch repair, we examined the effects of pol30-52 on the stability of microsatellites in which the size of the repeat unit ranged from 1 to 8 bp. We previously showed that each of these microsatellites exhibits enhanced levels of instability in mismatch-repair-deficient msh2 and mlh1 null mutant strains (SIA et al. 1997B Down).

To measure microsatellite instability, we used the plasmid-based frameshift assay described previously (HENDERSON and PETES 1992 Down; SIA et al. 1997A Down). For this assay, a microsatellite sequence is inserted in-frame within the plasmid-borne coding sequence of a fusion protein that has URA3 activity. Strains transformed with this plasmid are phenotypically Ura+ and are sensitive to the drug 5-FOA. Thus, alterations in tract length that result in an out-of-frame insertion can be selected on medium containing 5-FOA. DNA sequence and/or PCR analysis of the plasmid-borne microsatellite tracts in the 5-FOAR strains confirms that most of these strains have tract alterations of the expected types (HENDERSON and PETES 1992 Down).

The rates of microsatellite instability in wild-type, msh2::Tn10LUK, and pol30-52 strains are shown in Table 1; msh2::Tn10LUK is a null mutant allele of MSH2, resulting from an insertion of a transposable element into the coding sequence (REENAN and KOLODNER 1992 Down). All classes of repeats were destabilized by the pol30-52 mutation. The most striking effects were seen with microsatellites bearing 1- or 2-bp repeat units, which were destabilized 1800- and 380-fold, respectively. The rate obtained for the dinucleotide repeats is in agreement with that reported previously by others (JOHNSON et al. 1996 Down; UMAR et al. 1996 Down). The effects of the mutation on the instability of microsatellites containing 5- and 8-bp repeat units were more modest (20-fold effect for the 5-bp repeats and 67-fold effect for the 8-bp repeats).

The rates of tract instability observed in the pol30-52 strains, in general, were similar to those previously seen in an msh2::Tn10LUK strain (Table 1; msh2 data from SIA et al. 1997B Down), consistent with the conclusion that the pol30-52 mutation causes a DNA-mismatch-repair defect. There was an exception to this generalization. The pol30-52 mutation destabilizes the octanucleotide repeat to a significantly greater extent than does the null msh2 mutation. The interpretation of this effect will be discussed in detail below.

Additional support for the role of PCNA in mismatch repair was provided by the observed spectra of alterations within the microsatellites of 5-FOA-resistant isolates from the pol30-52 strain. The numbers of isolates with each type of alteration (+, addition; -, deletion) observed for each class of repeat were mononucleotide (1, +1 repeat; 14, -1 repeat; 3, -2 repeats), dinucleotide (11, +1 repeat; 13, -1 repeat; 1, -10 repeats), pentanucleotide (1, +2 repeats; 3, +1 repeat; 1, no change in number of repeats; 10, -1 repeat; 7, -2 repeats; 1, -4 repeats; 1, > -5 repeats), and octanucleotide (1, +1 repeat; 19, -1 repeat; 1, -2 repeats; 1, -4 repeats). As observed for msh2 strains, most of the alterations represented single-unit additions and deletions. In addition, for most of the microsatellites (with the exception of the dinucleotide), there was a significant excess of deletions compared to additions in the pol30-52 strain. These comparisons are summarized in Figure 2.



View larger version (26K):
In this window
In a new window
Download PPT slide
 
Figure 2. Rates of deletions (A) and additions (B) of microsatellites and a minisatellite in wild-type and mutant strains. Rates are given for isogenic wild-type (unshaded bars), msh2::Tn10LUK (dotted bars), and pol30-52 strains (hatched bars). Rates are calculated by multiplying the overall rate of tract alterations by the fraction of alterations observed as deletions or additions. Data from Table 1 were used for calculating the rates for the pol30-52 strain. Rates for the wild-type and msh2 strains were based on measurements reported previously (SIA et al. 1997B Down; KOKOSKA et al. 1998 Down). No rate measurement could be calculated for the mononucleotide tract in the msh2 strain because the types of alterations were not determined.

One significant difference between msh2::Tn10LUK and pol30-52 strains is the types of microsatellite alterations observed with the octanucleotide microsatellite. For the pol30-52 strain, we found 21 deletions and 1 other type of alteration (an addition); in previous studies of the same microsatellite in an msh2 strain (SIA et al. 1997B Down), we observed 13 deletions and 8 other types of alteration (4 additions and 4 mutational changes elsewhere in the URA3 gene). This difference is statistically significant (P < 0.01 by Fisher exact test) and confirms the conclusion that the phenotype of pol30-52 is not identical to that observed for msh2 for the octomer microsatellite. We conclude that pol30-52 destabilizes certain microsatellites by at least two mechanisms, one involving DNA mismatch repair and one involving a different mechanism.

The effects of pol30-52 on microsatellite stability are different qualitatively and quantitatively from those observed in strains with the rad27 mutation. Although this mutation also destabilizes microsatellite sequences, most of the altered microsatellites in rad27 strains have additions rather than deletions (JOHNSON et al. 1995 Down; TISHKOFF et al. 1997 Down; KOKOSKA et al. 1998 Down).

Minisatellite instability in pol30-52 strain:
To provide additional evidence that the effect of the pol30-52 mutation was not limited to loss of the DNA-mismatch-repair system, we analyzed minisatellite stability in the pol30-52 strain containing the assay plasmid pEAS20 (three 20-bp repeats inserted with the URA3 fusion gene). As shown in Table 1, the pol30-52 mutation destabilized the minisatellite 6-fold. We previously demonstrated that the stability of this repeat is unaffected by mutations in the MSH2 (as shown in Table 1) or MLH1 genes (SIA et al. 1997B Down), but is destabilized by the pol3-t (11-fold) and rad27 (13-fold) mutations (KOKOSKA et al. 1998 Down). This result shows that the effects of the pol30-52 mutation on simple repetitive DNA sequences are not limited to DNA mismatch repair.

We also analyzed the types of minisatellite tract alterations in the pol30-52 strain. Most (20 of 23) of the tract changes were deletions. Of the deletions, 17 involved one repeat and 3 involved two; we also found 3 single-repeat insertions. These numbers are significantly different from those observed in a pol3-t strain (P < 0.02 by Fisher exact test) with the same assay plasmid (9 single-repeat deletions and 11 double-repeat deletions; KOKOSKA et al. 1998 Down). In addition, the numbers of tract additions and deletions in the pol30-52 strain are strikingly different (P < 0.0001 by Fisher exact test) from those observed in a rad27 strain with pEAS20 (27 additions, 13 deletions; KOKOSKA et al. 1998 Down). Thus, although mutations affecting three different components of the DNA replication machinery destabilize minisatellite sequences, the types of alteration observed in these mutants are qualitatively different.

Effects of combined pol30-52 pol3-t mutations on growth rate and minisatellite instability:
Because pol30-52 and pol3-t have different effects on minisatellite instability, we constructed haploid strains with both mutations to analyze further the relationship between these two mutants. The double-mutant strain was constructed by sporulating a diploid that was doubly heterozygous for the two mutations. We found that the spore colonies containing the double mutation grew extremely slowly relative to the wild-type or single-mutant strains. After 5 days of growth at 25°, the average number of cells in each genotype (as determined with the hemocytomer) were 2.6 x 107 ± 0.8 (wild type), 1.6 x 107 ± 0.4 (pol3-t), 6.5 x 106 ± 2.2 (pol30-52), and 1.2 x 105 ± 0.4 (pol30-52 pol3-t); averages were based on at least nine colonies of each genotype and 95% confidence limits are indicated. For the same samples, we also measured the number of viable cells in each colony by plating suspensions of the colonies on rich growth medium, resulting in the following data: 2.0 x 107 ± 0.2 (wild type), 8.7 x 106 ± 2.8 (pol3-t), 3.2 x 106 ± 1.4 (pol30-52), and 9.8 x 103 ± 5.4 (pol30-52 pol3-t).

To reduce the likelihood of acquiring secondary mutations affecting growth rate and minisatellite stability, we examined the frequency of 5-FOAR cells in individual spore colonies without subcloning of the strains. These frequency measurements were converted to a rate by the method of the median. Since we analyzed the rate of instability of the double mutant in cells grown at 25° (a compromise between the restrictive temperatures of pol3-t and pol30-52), we also measured the rates of instability of pEAS20 in the wild-type and single-mutant strains grown at 25°. We found that two single mutants elevated instability of the minisatellite about 3- to 5-fold, whereas the double mutant strain had a 23-fold elevation (Table 2).


 
View this table:
In this window
In a new window

 
Table 2. Rates of minisatellite instability in wild-type, pol3-t, pol30-52 and pol30-52 pol3-t double-mutant haploid strains after growth at 25°

When the phenotype of the double-mutant strain is compared to that of the two single mutants, the interaction may be epistatic (equivalent to the effect of the more severe mutant phenotype), additive (equal to the sum of the effects of the two single mutants), or synergistic (greater than the sum of the effects of the two single mutants) (reviewed by HAYNES and KUNZ 1981 Down). The Table 2 data are most consistent with a synergistic or additive interaction in the double-mutant strain.

We also examined the types of minisatellite alterations in 11 independent 5-FOAR derivatives of the pol30-52 pol3-t strain. We found 6 tracts with one-repeat deletions, 3 with two-repeat deletions, 1 with a one-repeat addition, and 1 with no change. The ratio of single-repeat to two-repeat deletions in the double-mutant strain appears intermediate between the ratios found for pol30-52 strain (17 one-repeat deletions, 3 two-repeat deletions) and pol3-t (9 one-repeat deletions, 11 two-repeat deletions; KOKOSKA et al. 1998 Down).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Our analysis of the stability of various classes of repetitive DNA sequences in pol30-52 strains indicates that this PCNA mutation has two different effects. As expected from previous studies (JOHNSON et al. 1996 Down; UMAR et al. 1996 Down), the mutation destabilized repetitive DNA sequences as a consequence of a DNA-mismatch-repair deficiency. The mutation had an additional destabilizing effect for repetitive sequences with large (>=8 bp) repeat units that (as discussed below) is likely to reflect increased DNA polymerase slippage. The rates and types of alterations observed in simple repetitive DNA tracts in pol30-52 strains were different from those observed in strains with mutations affecting other components of the DNA replication machinery. These conclusions will be discussed in more detail below.

The effect of mutations in yeast DNA-mismatch-repair genes on simple repetitive DNA sequences depends on the length of the repeat unit and the specific repair gene defect (reviewed by SIA et al. 1997A Down). Strains that lack DNA mismatch repair as a consequence of null msh2, mlh1, and pms1 mutations have elevated instability for repetitive sequences with repeat unit lengths of <=13 bp. Mutations in these genes, however, do not affect repetitive DNA sequences with repeat units >15 bp. In the context of the DNA polymerase slippage model (Figure 1), these results indicate that DNA loops >=15 bp cannot be repaired by the DNA-mismatch-repair system, although DNA loops <=13 bp are susceptible to repair by this system (SIA et al. 1997B Down).

As shown in Table 1, the destabilizing effects of the pol30-52 mutation are indistinguishable from those of msh2 for microsatellites with repeat units of 1, 2, or 5 bp. The rate of alterations for the microsatellite with the 8-bp repeat unit, however, is significantly elevated in pol30-52 compared to msh2::Tn10LUK, and the types of changes are significantly different. In pol30-52 strains, there are significantly more deletions than in msh2 strains (Figure 2). In addition, the pol30-52 mutation, unlike msh2, destabilized the 20-bp minisatellite sequence. These results demonstrate that PCNA has two roles in the control of the stability of repetitive DNA sequences, a function in DNA-mismatch repair [as previously demonstrated by UMAR et al. 1996 Down and JOHNSON et al. 1996 Down], and a function that is independent of the known DNA-mismatch-repair mechanism. The function of PCNA in DNA mismatch repair may be related to directing the mismatch-repair complex to correcting errors on the newly synthesized strand (UMAR et al. 1996 Down).

We suggest two models to explain the destabilizing effect of pol30-52 that is independent of its deficiency in DNA mismatch repair. First, PCNA may be required for two different DNA loop repair correction systems. One of these systems is the known DNA-mismatch-repair system (reviewed by KOLODNER 1996 Down). The other (as yet uncharacterized) system only recognizes large DNA loops (>5 bp) and competes for the repair of these loops with the known repair system. Thus, the pol30-52 mutation would be expected to have a stronger effect than msh2::Tn10LUK only for repetitive DNA sequences with a repeat unit length >5 bp. Two points are relevant to the suggestion of an undiscovered DNA-loop-repair system. First, MIRET et al. 1996 Down reported the existence of a DNA-loop-binding activity in yeast strains deficient in Msh2p, Msh3p, and Msh4p. Second, DNA loops are repaired efficiently in meiosis by a mechanism that is different from the classical DNA repair system and that is, at least partly, Msh2p-independent (KIRKPATRICK and PETES 1997 Down).

Second, as expected for a mutation in a protein required for DNA polymerase processivity, the pol30-52 mutation may increase the rate of DNA polymerase slippage. Previously, we found that the rate of instability in msh2::Tn10LUK strains was much higher for mononucleotide microsatellites than for microsatellites with larger repeat units (SIA et al. 1997B Down), suggesting that the primer and template strands might undergo small dissociations much more frequently than large dissociations. We suggest that PCNA has a role in preventing extensive (>8 bp) primer-template dissociations, but not small (<8 bp) dissociations. Consequently, the effects of pol30-52 (in excess of those expected for the DNA-mismatch-repair deficiency) are observed only for larger repeat units (8 and 20 bp). Alternatively, the pol30-52 mutation may elevate DNA polymerase slippage for all microsatellites. If only small (<=5 bp), but not large, DNA loops could be removed by the proofreading exonuclease activities associated with DNA polymerase {delta} or {epsilon}, then results consistent with our observations would be observed. At present, there is no evidence that the proofreading exonuclease has this specificity.

Although the current evidence does not allow an informed choice among the models discussed above, we favor the DNA polymerase slippage models, because they are most consistent with the known properties of PCNA. The protein encoded by pol30-52 has a single amino acid substitution (Ser115 to Pro115) in the region controlling subunit interactions (KRISHNA et al. 1994 Down). In solution, formation of the mutant protein into the active trimer is defective and the mutant protein fails to stimulate synthesis by DNA polymerase {delta} or {epsilon} in vitro (AYYAGARI et al. 1995 Down). Because yeast strains containing the pol30-52 mutation are viable (unlike strains with the null mutation), the mutant protein must not be completely defective in vivo. Thus, the mutant protein may increase the frequency of DNA polymerase dissociation from the template; this dissociation, in turn, could result in an increased frequency of extensive primer-template strand separation events as required by our second model.

Several types of evidence indicate that the effects of pol30-52 on the stability of simple repetitive DNA sequences are distinct from the effects of mutations in other components of the DNA replication machinery. First, the types of changes observed for the minisatellite assay plasmid were significantly different in comparisons of pol30-52 with either pol3-t (temperature-sensitive mutant of DNA polymerase {delta}; TRAN et al. 1995 Down, TRAN et al. 1996 Down) or rad27 (deficient in FEN-1 endonuclease required for Okazaki fragment processing; MURANTE et al. 1996 Down) strains. Most of the altered minisatellite sequences in the pol30-52 strain were single-unit deletions. The pol3-t mutation results in substantially more two-unit deletions (KOKOSKA et al. 1998 Down), whereas rad27 primarily causes single-unit insertions (KOKOSKA et al. 1998 Down). Second, unlike pol30-52, most of the other DNA replication mutants destabilize simple repetitive DNA sequences with short (<=5 bp), as well as long, repeat units by a mechanism that is independent of DNA mismatch repair. These mutants include pol3-t (KOKOSKA et al. 1998 Down), pol3-01 (a mutation in the proofreading exonuclease domain of DNA polymerase {delta}; STRAND et al. 1993 Down), rad27 (JOHNSON et al. 1995 Down; KOKOSKA et al. 1998 Down; SCHWEITZER and LIVINGSTON 1998 Down), and rfc1 (a mutation in the large subunit of DNA replication factor C; P. GREENWELL, R. KOKOSKA and T. D. PETES, unpublished data; Y. XIE et al. 1999 Down). Although these results suggest that mutations in different components of the DNA replication machinery have different effects on the stability of repetitive DNA sequences, we cannot rule out the possibility that some of these effects might reflect allele-specific differences.

Our observation that the types of minisatellite alterations are different in pol3-t and pol30-52, as discussed above, suggests that their destabilizing effects might reflect different mechanisms. This hypothesis is consistent with the observation that the rate of instability in the double-mutant strain is considerably higher than in either single-mutant strain. In addition, the double-mutant strain has a much slower growth rate than either single-mutant strain. Although this lack of epistasis is usually interpreted as demonstrating that the two mutations affect different pathways, because the mutants were not nulls, this argument is suggestive, but not conclusive.

Regardless of the specific mechanisms involved, modest increases in minisatellite instability may be a general feature of yeast strains that have mutations in genes that encode components of the DNA replication machinery. Although in human cells the most dramatic alterations within minisatellites occur in meiosis rather than in mitosis (JEFFREYS et al. 1994 Down), enhanced minisatellite instability has been observed within somatic cells of certain human tumor cell lines (ARMOUR et al. 1989 Down; NAGEL et al. 1995 Down). Our observations suggest the possibility that these human tumor cell lines may have mutations in genes that encode DNA polymerase or accessory factors involved in DNA replication.

In summary, the pol30-52 mutation destabilizes simple repetitive DNA sequences in a unique way. As reported previously (UMAR et al. 1996 Down), the mutation results in a DNA-mismatch-repair deficiency. For repetitive DNA sequences with repeat units of >=8 bp, the mutation has an additional destabilizing effect, possibly related to an increased level of DNA polymerase slippage.


*  ACKNOWLEDGMENTS

We thank P. Burgers for providing a plasmid used in this study and E. Alani for providing unpublished information. Our work was supported by National Institutes of Health (NIH) grants to T.D.P. (NIH grant GM-52319) and R.J.K. (NIH grant GM-17879). A.B.B. was supported by American Cancer Society grant PF-4305. R.M.L. was supported by National Science Foundation grant MCB-9314116 and NIH grant GM-45413.

Manuscript received August 3, 1998; Accepted for publication October 22, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AMIN, N. S. and C. HOLM, 1996  In vivo analysis reveals that the interdomain region of the yeast proliferating cell nuclear antigen is important for DNA replication and DNA repair. Genetics 144:479-493[Abstract].

ARMOUR, J. A. L., I. PATEL, S. L. THEIN, M. F. FEY, and A. J. JEFFREYS, 1989  Analysis of somatic mutations at human minisatellite loci in tumors and cell lines. Genomics 4:328-334[Medline].

AYYAGARI, R., K. J. IMPELLIZZERI, B. L. YODER, S. L. GARY, and P. M. J. BURGERS, 1995  A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair. Mol. Cell. Biol. 15:4420-4429[Abstract].

BAUER, G. A. and P. M. J. BURGERS, 1990  Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene. Nucleic Acids Res. 18:261-265[Abstract/Free Full Text].

BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984  A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoroorotic acid resistance. Mol. Gen. Genet. 167:345-346.

GU, L., Y. HONG, S. MCCULLOCH, H. WATANABE, and G. M. LI, 1998  ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair. Nucleic Acids Res. 26:1173-1178[Abstract/Free Full Text].

HAYNES, R. H., and B. KUNZ, 1981 DNA repair and mutagenesis in yeast, pp. 371–414 in The Molecular Biology of the Yeast Saccharomyces cerevisiae, edited by J. STRATHERN, E. JONES and J. R. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

HENDERSON, S. T. and T. D. PETES, 1992  Instability of simple sequence DNA in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2749-2757[Abstract/Free Full Text].

JEFFREYS, A. J., K. TAMAKI, A. MACLEOD, D. G. MONCTON, and D. L. NEIL et al., 1994  Complex gene conversion events in germline mutation at human minisatellites. Nature Genet. 6:136-145[Medline].

JOHNSON, R. E., G. K. KOVVALI, L. PRAKASH, and S. PRAKASH, 1995  Requirement of the yeast RTH1 5' to 3' exonuclease for the stability of simple repetitive DNA. Science 269:238-240[Abstract/Free Full Text].

JOHNSON, R. E., G. K. KOVVALI, S. N. GUZDER, N. S. AMIN, and C. HOLM et al., 1996  Evidence for involvement of yeast proliferating cell nuclear antigen in DNA mismatch repair. J. Biol. Chem. 271:27987-27990[Abstract/Free Full Text].

KIRKPATRICK, D. and T. D. PETES, 1997  Repair of DNA loops involves DNA-mismatch and nucleotide-excision repair proteins. Nature 387:929-931[Medline].

KOKOSKA, R. J., L. STEFANOVIC, H. T. TRAN, M. A. RESNICK, and D. A. GORDENIN et al., 1998  Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase {delta} (pol3-t). Mol. Cell. Biol. 18:2779-2788[Abstract/Free Full Text].

KOLODNER, R. D., 1996  Biochemistry and genetics of eukaryotic mismatch repair. Genes Dev. 10:1433-1442[Free Full Text].

KRISHNA, T. S. R., X-P. KONG, S. GARY, P. M. BURGERS, and J. KURIYAN, 1994  Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA. Cell 79:1233-1243[Medline].

KUNKEL, T. A., 1992  Biological asymmetries and the fidelity of eukaryotic DNA replication. BioEssays 14:303-308[Medline].

LEA, D. E. and C. A. COULSON, 1949  The distribution of the number of mutants in bacterial populations. J. Genet. 49:264-285.

LEVINSON, G. and G. A. GUTMAN, 1987  Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4:203-221[Abstract].

MIRET, J. J., B. O. PARKER, and R. S. LAHUE, 1996  Recognition of DNA insertion/deletion mismatches by an activity in Saccharomyces cerevisiae.. Nucleic Acids Res. 24:721-729[Abstract/Free Full Text].

MODRICH, P. and R. LAHUE, 1996  Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65:101-133[Medline].

MURANTE, R. S., J. A. RUMBAUGH, C. J. BARNES, J. R. NORTON, and R. A. BAMBARA, 1996  Calf RTH-1 nuclease can remove the initiator RNAs of Okazaki fragments by endonuclease activity. J. Biol. Chem. 271:25888-25897[Abstract/Free Full Text].

NAGEL, S., B. BORISCH, S. L. THEIN, M. OESTREICHER, and F. NOTHINGER et al., 1995  Somatic mutations detected by minisatellite and microsatellite DNA markers reveal clonal intratumor heterogeneity in gastrointestinal cancer. Cancer Res. 55:2866-2870[Abstract/Free Full Text].

PRELICH, G., M. KOSTURA, D. R. MARSHAK, M. B. MATHEWS, and B. STILLMAN, 1987a  The cell cycle regulated proliferating cell nuclear antigen is required for SV40 replication in vitro. Nature 326:471-475[Medline].

PRELICH, G., C.-K. TAN, M. KOSTURA, M. B. MATHEWS, and A. G. SO et al., 1987b  Functional identity of proliferating cell nuclear antigen and a DNA polymerase auxiliary protein. Nature 326:517-520[Medline].

REENAN, R. A. G. and R. D. KOLODNER, 1992  Characterization of insertion mutations in the Saccharomyces cerevisiae MSH1 and MSH2 genes: evidence for separate mitochondrial and nuclear functions. Genetics 132:975-985[Abstract].

SCHWEITZER, J. K. and D. M. LIVINGSTON, 1998  Expansions of CAG repeat tracts are frequent in a yeast mutant defective in Okazaki fragment maturation. Hum. Mol. Genet. 7:69-74[Abstract/Free Full Text].

SIA, E. A., S. JINKS-ROBERTSON, and T. D. PETES, 1997a  Genetic control of microsatellite stability. Mutat. Res. 383:61-70[Medline].

SIA, E. A., R. J. KOKOSKA, M. DOMINSKA, P. GREENWELL, and T. D. PETES, 1997b  Microsatellite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes. Mol. Cell. Biol. 17:2851-2858[Abstract].

STRAND, M., T. A. PROLLA, R. M. LISKAY, and T. D. PETES, 1993  Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274-276[Medline].

STRAND, M., M. C. EARLEY, G. F. CROUSE, and T. D. PETES, 1995  Mutations in the MSH3 gene preferentially lead to deletions within tracts of simple repetitive DNA in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 92:10418-10421[Abstract/Free Full Text].

STRAUSS, B. S., D. SAGHER, and S. ACHARYA, 1997  Role of proofreading and mismatch repair in maintaining the stability of nucleotide repeats in DNA. Nucleic Acids Res. 25:806-813[Abstract/Free Full Text].

STREISINGER, G., Y. OKADA, J. EMRICH, J. NEWTON, and A. TSUGITA et al., 1966  Frameshift mutations and the genetic code. Cold Spring Harbor Symp. Quant. Biol. 31:77-84[Medline].

TAUTZ, D. and C. SCHLOTTERER, 1994  Simple sequences. Curr. Opin. Genet. Dev. 4:832-837[Medline].

TISHKOFF, D. X., N. FILOSI, G. M. GAIDA, and R. D. KOLODNER, 1997  A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263[Medline].

TRAN, H. T., N. P. DEGTYAREVA, N. N. KOLOTEVA, A. SUGINO, and H. MASUMOTO et al., 1995  Replication slippage between distant short repeats in Saccharomyces cerevisiae depends on the direction of replication and the RAD50 and RAD52 genes. Mol. Cell. Biol. 15:5607-5617[Abstract].

TRAN, H. T., D. A. GORDENIN, and M. A. RESNICK, 1996  The prevention of repeat-associated deletions in Saccharomyces cerevisiae by mismatch repair depends on size and origin of deletions. Genetics 143:1579-1587[Abstract].

UMAR, A., A. B. BUERMEYER, J. A. SIMON, D. C. THOMAS, and A. B. CLARK et al., 1996  Requirement for PCNA in DNA mismatch repair at a step preceding DNA synthesis. Cell 87:65-73[Medline].

WEBER, J. L. and C. WONG, 1993  Mutation of human short tandem repeats. Hum. Mol. Genet. 2:1123-1128[Abstract/Free Full Text].

WIERDL, M., C. N. GREENE, A. DATTA, S. JINKS-ROBERTSON, and T. D. PETES, 1996  Destabilization of simple repetitive DNA sequences by transcription in yeast. Genetics 143:713-721[Abstract].

WIERDL, M., M. DOMINSKA, and T. D. PETES, 1997  Microsatellite instability in yeast: dependence on the length of the microsatellite. Genetics 146:769-779[Abstract].

XIE, Y., C. COUNTER, and E. ALANI, 1999  Characterization of the repeat-tract instability and mutator phenotypes conferred by a Tn3 insertion in RFC1, the large subunit of the yeast clamp loader. Genetics 151:499-509[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
GeneticsHome page
J. E. Stone, R. G. Ozbirn, T. D. Petes, and S. Jinks-Robertson
Role of Proliferating Cell Nuclear Antigen Interactions in the Mismatch Repair-Dependent Processing of Mitotic and Meiotic Recombination Intermediates in Yeast
Genetics, March 1, 2008; 178(3): 1221 - 1236.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. J. Lau, H. Flores-Rozas, and R. D. Kolodner
Isolation and Characterization of New Proliferating Cell Nuclear Antigen (POL30) Mutator Mutants That Are Defective in DNA Mismatch Repair
Mol. Cell. Biol., October 1, 2002; 22(19): 6669 - 6680.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. E. Corrette-Bennett, N. L. Mohlman, Z. Rosado, J. J. Miret, P. M. Hess, B. O. Parker, and R. S. Lahue
Efficient repair of large DNA loops in Saccharomyces cerevisiae
Nucleic Acids Res., October 15, 2001; 29(20): 4134 - 4143.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. S. Amin, M.-N. Nguyen, S. Oh, and R. D. Kolodner
exo1-Dependent Mutator Mutations: Model System for Studying Functional Interactions in Mismatch Repair
Mol. Cell. Biol., August 1, 2001; 21(15): 5142 - 5155.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. J. Kokoska, L. Stefanovic, J. DeMai, and T. D. Petes
Increased Rates of Genomic Deletions Generated by Mutations in the Yeast Gene Encoding DNA Polymerase delta or by Decreases in the Cellular Levels of DNA Polymerase delta
Mol. Cell. Biol., October 15, 2000; 20(20): 7490 - 7504.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
J. N. Weitzel, S. Ding, G. P. Larson, R. A. Nelson, A. Goodman, E. C. Grendys, H. G. Ball, and T. G. Krontiris
The HRAS1 Minisatellite Locus and Risk of Ovarian Cancer
Cancer Res., January 1, 2000; 60(2): 259 - 261.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
C. Chen, B. J. Merrill, P. J. Lau, C. Holm, and R. D. Kolodner
Saccharomyces cerevisiae pol30 (Proliferating Cell Nuclear Antigen) Mutations Impair Replication Fidelity and Mismatch Repair
Mol. Cell. Biol., November 1, 1999; 19(11): 7801 - 7815.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. K. Schweitzer and D. M. Livingston
The Effect of DNA Replication Mutations on CAG Tract Stability in Yeast
Genetics, July 1, 1999; 152(3): 953 - 963.
[Abstract] [Full Text]


Home page
GeneticsHome page
Y. Xie, C. Counter, and E. Alani
Characterization of the Repeat-Tract Instability and Mutator Phenotypes Conferred by a Tn3 Insertion in RFC1, the Large Subunit of the Yeast Clamp Loader
Genetics, February 1, 1999; 151(2): 499 - 509.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. B. Clark, F. Valle, K. Drotschmann, R. K. Gary, and T. A. Kunkel
Functional Interaction of Proliferating Cell Nuclear Antigen with MSH2-MSH6 and MSH2-MSH3 Complexes
J. Biol. Chem., November 17, 2000; 275(47): 36498 - 36501.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Frank, J. Qiu, L. Zheng, and B. Shen
Stimulation of Eukaryotic Flap Endonuclease-1 Activities by Proliferating Cell Nuclear Antigen (PCNA) Is Independent of Its in Vitro Interaction via a Consensus PCNA Binding Region
J. Biol. Chem., September 21, 2001; 276(39): 36295 - 36302.
[Abstract] [Full Text] [PDF]