Genetics, Vol. 151, 97-105, January 1999, Copyright © 1999

Extragenic Suppressors of Loss-of-Function Mutations in the Aspergillus FlbA Regulator of G-Protein Signaling Domain Protein

Jae-Hyuk Yu1,a, Stefan Roséna, and Thomas H. Adams1,a
a Department of Biology, Texas A&M University, College Station, Texas 77843

Corresponding author: Thomas H. Adams, Department of Biology, Texas A&M University, College Station, TX 77843-3258., tom{at}bio.tamu.edu (E-mail)

Communicating editor: R. H. DAVIS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We showed previously that two genes, flbA and fadA, have a major role in determining the balance between growth, sporulation, and mycotoxin (sterigmatocystin; ST) production by the filamentous fungus Aspergillus nidulans. fadA encodes the {alpha} subunit for a heterotrimeric G-protein, and continuous activation of FadA blocks sporulation and ST production while stimulating growth. flbA encodes an A. nidulans regulator of G-protein signaling (RGS) domain protein that antagonizes FadA-mediated signaling to allow development. To better understand FlbA function and other aspects of FadA-mediated growth control, we have isolated and characterized mutations in four previously undefined genes designated as sfaA, sfaC, sfaD, and sfaE (suppressors of flbA), and a new allele of fadA (fadAR205H), all of which suppress a flbA loss-of-function mutation (flbA98). These suppressors overcome flbA losses of function in both sporulation and ST biosynthesis. fadAR205H, sfaC67, sfaD82, and sfaE83 mutations are dominant to wild type whereas sfaA1 is semidominant. sfaA1 also differs from other suppressor mutations in that it cannot suppress a flbA deletion mutation (and is therefore allele specific) whereas all the dominant suppressors can bypass complete loss of flbA. Only sfaE83 suppressed dominant activating mutations in fadA, indicating that sfaE may have a unique role in fadA-flbA interactions. Finally, none of these suppressor mutations bypassed fluG loss-of-function mutations in development-specific activation.


THE asexual life cycle of the filamentous ascomycete Aspergillus nidulans can be divided into two distinct phases, growth and reproduction. The growth phase involves formation of an undifferentiated network of interconnected cells, or hyphae, that form the mycelium. Under appropriate growth conditions, some of the hyphal cells can stop normal growth and begin asexual reproduction by forming complex multicellular conidiophores that produce multiple chains of uninuleate spores called conidia (for review, see ADAMS 1994 Down; ADAMS et al. 1998 Down). We showed previously that initiation of A. nidulans asexual reproductive development requires the ability to control proliferative growth in response to an extracellular signal that functions specifically in activating development (LEE and ADAMS 1994B Down; YU et al. 1996 Down). The production of this developmental signal that controls initiating of conidiation requires fluG, which apparently functions in part by activating the regulator of G-protein signaling (RGS) domain protein FlbA (LEE and ADAMS 1994B Down, LEE and ADAMS 1996 Down; YU et al. 1996 Down). Other development-specific regulatory genes required for sporulation in response to the FluG signal include flbB, flbC, flbD, flbE, and brlA (see Figure 1; ADAMS et al. 1988 Down; WIESER et al. 1994 Down; WIESER and ADAMS 1995 Down; LEE and ADAMS 1996 Down).



View larger version (14K):
In this window
In a new window
Download PPT slide
 
Figure 1. flbA and fadA control A. nidulans growth, asexual sporulation, and ST biosynthesis. As described in the Introduction, we propose that two antagonistic signaling pathways control A. nidulans growth, asexual development, and ST production. When FadA (G{alpha}) is active (GTP-bound), it signals to enhance proliferative growth and repress both asexual sporulation and ST production. This FadA-dependent growth signaling pathway is modulated by FlbA and FluG activities. FluG stimulates both development-specific events and activation of FlbA, which in turn inactivates FadA signaling. However, it is important to note that the main role of FluG in ST biosynthesis is apparently indirect, through activation of FlbA (see Introduction). The dotted arrows describe the observation that flbA overexpression in {Delta}fadA mutants has positive effects on asexual sporulation and ST production by an unknown mechanism (YU et al. 1996 Down; HICKS et al. 1997 Down). Because no flbA suppressor mutations bypass fluG loss-of-function mutations for developmental phenotype except ST production, we propose that the major role for the products of sfa genes in activating asexual sporulation is through their effects on FadA-mediated growth signaling (see RESULTS and DISCUSSION).

FlbA (fluffy low BrlA) has a major role in determining the balance between growth and sporulation through its ability to regulate FadA (fluffy autolytic dominant), the {alpha} subunit for a heterotrimeric G-protein (YU et al. 1996 Down). When FadA-dependent signaling is activated in response to some unknown factor it stimulates growth and blocks sporulation. FlbA has the ability to inactivate FadA, as with other RGS domain proteins (BERMAN et al. 1996 Down; WATSON et al. 1996 Down) probably working as a GTPase activating protein (GAP), thus allowing development to proceed. Inactivation of flbA or constitutive activation of fadA (fadAG42R, fadAR178L fadAG183S, fadAR178C, and fadAQ204L) causes uncontrolled growth and leads to proliferation of undifferentiated aerial hyphae ("fluffy") that autolyse as colonies mature (YU et al. 1996 Down; WIESER et al. 1997 Down; this study). By contrast, overexpression of flbA or dominant interfering mutations in fadA (fadAG203R) result in inhibited hyphal growth coupled with conidiophore development, even under growth conditions that normally interfere with sporulation (LEE and ADAMS 1994A Down; YU et al. 1996 Down). Interestingly, in addition to its requirement for development, FlbA-directed inactivation of FadA signaling is required for biosynthesis of the aflatoxin-like mycotoxin called sterigmatocystin (ST; BROWN et al. 1996 Down; HICKS et al. 1997 Down). This has led us to propose that sporulation and production of the secondary metabolite ST share the need to inactivate the FadA-mediated proliferation signaling pathway. However, there is an important difference in the control of asexual development vs. ST biosynthesis. While fluG deletion mutants fail to produce ST and do not sporulate, mutations that inactivate FadA suppress fluG deletion mutant defects in ST production but not sporulation. This implies that the main role of FluG in ST biosynthesis is activation of FlbA, which in turn inactivates FadA (Figure 1; HICKS et al. 1997 Down).

While the most critical functions for FlbA involve inactivation of FadA, it is also clear that FlbA likely has other activities. Overexpression of flbA causes inappropriate sporulation and precocious ST production even in a {Delta}fadA mutant (YU et al. 1996 Down; HICKS et al. 1997 Down). This raises the possibility that FlbA could interfere with the activity of other G{alpha} proteins, Gß{gamma} signaling, or have a different role in activating sporulation and ST-specific genes (see Figure 1). These FlbA activities all appear to require an intact RGS domain (J.-H. YU and T. H. ADAMS, unpublished results) but FlbA is also known to share at least one other conserved region that directly precedes the RGS domain and is ~80 amino acid residues in length (PONTING and BORK 1996 Down). This domain is called DEP (dishevelled, egl-10, pleckstrin) and is predicted to be a globular domain with an {alpha} + ß topology (PONTING and BORK 1996 Down). It is interesting that many other RGS domain proteins, including Sst2, RGS7, Egl-10, and Ya8c, have the DEP domain (PONTING and BORK 1996 Down). Both RGS proteins and pleckstrin are known to function in negatively regulating critical signaling pathways, and it has been postulated that the DEP domains might regulate protein-protein interactions, but no such activity has been functionally demonstrated.

To better understand the complex role of FlbA in controlling growth and development we have isolated and begun to characterize suppressors of flbA loss-of-function mutations. We expect that understanding the roles of these suppressors will allow an unbiased approach toward identifying other elements in this multicomponent signaling pathway. We describe suppressor mutations identifying five distinct loci that can overcome flbA losses of function in both sporulation and ST biosynthesis. Characterization of these mutations and identification of one as a novel dominant inactivating allele of fadA are presented.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Aspergillus strains, growth conditions, genetics, and transformation:
The A. nidulans strains used in this study are listed in Table 1. Standard A. nidulans culture and genetic techniques were used (PONTECORVO et al. 1953 Down; KAFER 1977 Down). When appropriate (e.g., deletion detection), genotypes of strains were confirmed by genomic Southern blot analysis. Standard A. nidulans transformation techniques (YELTON et al. 1984 Down; MILLER et al. 1985 Down) were used with the slight modification of reducing the polyethylene glycol (PEG) treatment time from 20 min to 6 min. Whenever possible, genetic analysis was achieved via meiotic recombination. However, most of the primary isolates with flbA suppressor mutations were affected in their ability to form fertile cleistothecia with PW1 (or FGSC89) in meiotic crosses. In these cases, primary recombinants were produced via parasexual genetics. Dominance of each sfa mutation was tested by generating diploid strains (dJYA1–dJYE83; see Table 1). Each diploid strain was treated with the microtubule destabilizing agent benomyl (2 mg/ml DMSO, 6- to 9-µl/plate) to produce haploid sectors. At least 20 haploid progeny were isolated from each diploid strain and tested for auxotrophic markers and/or the deletion of A. To test whether suppressor mutations can bypass A, suppressor mutant strains with a flbA deletion (RJY8.9, RJY67.2, RJY82.4, and RJY83.6) were isolated from the haploid progeny of appropriate diploids. Suppressor mutant strains with {Delta}fluG;flbA98 (TJY8.G–TJY83.G) were generated by transforming each arginine auxotroph with a fluG deletion plasmid pJYGD4. Suppressor mutant strains with dominant activating alleles of fadA (TJY8.42R–TJY83.204L) were generated by transforming arginine auxotrophs with pJY8P2 (for G42R), pJYPK27 (for R178C), and pJYPK26 (for Q204L), respectively.


 
View this table:
In this window
In a new window

 
Table 1. Aspergillus nidulans strains used in this study

Mutagenesis and isolation of flbA suppressor mutations:
Although flbA loss-of-function mutants autolyze and fail to sporulate when grown on normal minimal medium (70 mM NaNO3, 1% glucose; FER 1997), this defect can be partially remediated by growth on medium containing a high concentration of salt (e.g., 0.8 M NaCl or 0.6 M KCl). Conidiospores isolated from a flbA loss-of-function mutant (MJW98; see Table 1) grown on minimal medium with 0.8 M NaCl were mutagenized with NQO (4-nitroquinolin-1-oxide; 1 mg, 10 mg) as previously described (WIESER et al. 1994 Down). Survival ratios after NQO treatment were from 0.1 to 10% depending on the length of NQO treatment. Survivors were visually screened for sporulation on complete medium (KÄFER 1997) where the flbA98 mutant never sporulated. Among 100,000 survivors, 121 showed at least partial suppression of conidiation defects and 5 (SFA1, 8, 67, 82, and 83) of these mutants sporulated nearly as well as a wild type. These 5 mutants were further analyzed. Because characterization of these five suppressors identified five independent loci (no suppressor mutations were allelic to each other) an attempt was made to isolate additional suppressors to reach the saturation of mutations and/or to isolate possible alleles of the above-mentioned suppressor mutations. In a second set of mutagenesis, spores of a {Delta}flbA strain (RJH046; see Table 1) were mutagenized as mentioned above and among 50,000 survivors, 4 showed near complete suppression of conidiation defects (MSR123, 125, 126, 127). These 4 additional suppressors were also further characterized.

ST production analysis:
ST production was examined by inoculating ~1 x 105 conidia in 3 ml of liquid complete medium (minimal medium with 2% glucose, 0.2% peptone, 0.1% yeast extract, and 0.1% casamino acids; KAFER 1977 Down) in an 8-ml vial and incubated at 30° for 7 days (stationary culture) as previously described (YU and LEONARD 1995 Down). ST was then extracted from 7-day-old cultures by adding 1.5 ml of CHCl3 to the vials and then vortexed for 2 min. Vials were centrifuged at 500 x g for 5 min and the organic phase was collected, dried, resuspended in 50 µl of CHCl3, and 4 µl of each concentrated sample was loaded for thin-layer chromatography (TLC) analysis described previously (YU and LEONARD 1995 Down).

Nucleic acid manipulation:
To determine the sequence of the flbA98 mutant allele the flbA coding region from MJW98 genomic DNA was amplified by the polymerase chain reaction (PCR) using the synthetic oligonucleotides CTGGTTTAGTCTGATTTTCGTC and TCGTCGTAATCTCACCGCA as primers. The resulting flbA98 amplicon (~2.9 kb) was sequenced directly. The fadAR178C and fadAQ204L dominant-activating alleles were generated by site-directed mutagenesis with the synthetic oligonucloetides GTCCTACGCagctGTGTCAAGAAC or GACGTTGGaGGcCtCCGTTCTGAG (lowercase letters represent mismatches), respectively (KUNKEL 1985 Down). These oligonucleotides introduce PvuII or StuI sites that were used for screening convenience. Each 3.15-kb PstI fragment with the fadAR178C and fadAQ204L mutant alleles was then moved into pPK1 (WIESER and ADAMS 1995 Down) to give pJYPK27 and pJYPK26, respectively. Resulting plasmids were used for transformation of suppressor mutant strains. The fadA gene from SFA8 was amplified by PCR with synthetic oligonucleotides ATGACTCTGCAGCGGGGCTATC and TCGCTGCTGCAGAGCGGCGAA. The resulting 3.15-kb amplicon was digested with PstI and cloned into pPK1 (for fadA gene structure, see YU et al. 1996 Down). Four independent clones were isolated and used for transformation of RJY8.22. Two of these clones were sequenced and the mutation was also confirmed by directly sequencing the PCR product. A fluG disruption vector (pJYGD4) containing the wild-type argB gene as a selective marker was constructed by replacing the trpC+ fragment in pTA127 (LEE and ADAMS 1994B Down) with an XhoI-digested argB fragment.

Microscopy:
Photomicrographs presented in this study were taken using an Olympus BH2 compound microscope and differential interference contrast optics. All other microscopy was carried out using an Olympus SZ-11 stereo microscope and transmitted light.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Isolation of flbA extragenic suppressors that identify five distinct loci:
We set out to identify extragenic suppressors of flbA using a mutant strain with the flbA98 allele (strain MJW98). We used this strain because its sporulation defect was less severe than for an flbA deletion mutant, suggesting partial function. By using this partial-function flbA98 allele we expected that we could identify both allele-specific and bypass suppressor mutations. Conidiospores from MJW98 were treated with NQO as described in MATERIALS AND METHODS and 100,000 survivors were screened to identify suppressors. From this approach, 121 at least partially sporulating strains were isolated, and 5 of these mutants (SFA1, 8, 67, 82, and 83) that sporulated nearly as well as wild types (Figure 2) were selected for further studies. Suppressor loci are designated as either sfaS (mutant alleles) or sfaWT (wild-type alleles).



View larger version (66K):
In this window
In a new window
Download PPT slide
 
Figure 2. Phenotypes of flbA suppressors. Photographs of wild-type and suppressor mutant colonies (top) and the close-up views of conidiation are shown (bottom). Panels are wild type (A and B), flbA98 (C and D), flbA98;sfaA1 (E and F), flbA98;fadAR205H (G and H), flbA98;sfaC67 (I and J), flbA98;sfaD82 (K and L), and flbA98;sfaE83 (M and N).

To determine if suppression resulted from mutations within flbA or from mutations in unlinked genes we attempted to cross each primary suppressed mutant strain with a developmentally wild-type strain (PW1) to look for segregation of the flbA98 phenotype. However, only two of these mutants (SFA67 and SFA82) produced fertile cleistothecia when crossed with PW1. For each of these cases, ~25% of the progeny had the flbA98 phenotype, indicating that sfa67 and sfa82 were extragenic flbA suppressors. In both cases, the other 75% of the progeny were developmentally wild type, indicating that neither sfa67 nor sfa82 likely caused phenotypic abnormalities in a flbA+ strain.

After repeated unsuccessful attempts to cross SFA1, SFA8, and SFA83 with different wild-type strains (PW1 or FGSC89), we chose to examine linkage of mutations to flbA via parasexual (mitotic-cross) analysis. Diploids were generated from heterokaryons formed between each sfaS;flbA98 mutant (each SFA) strain and either PW1 or FGSC89. These diploid strains were then treated with the microtubule-destabilizing agent benomyl to generate haploid progeny. In every case A98;sfaS/flbA+;sfaWT diploids produced haploid sectors with the flbA98 phenotype as expected if the suppressor mutations were not linked to flbA. All other haploid progeny appeared wild type and several of these strains were purified and used in meiotic crosses to determine their genotype. Interestingly, several strains of each type that formed fertile crosses with wild-type strains yielded 25% fluffy progeny, indicating that the parent genotype was sfaS;flbA98. Thus, the sexual defect in the primary mutant strains was apparently not linked to the sfa mutation and it is important to note that each suppressor segregated as a single trait. As above, none of the sfa mutations caused phenotypic abnormalities in flbA+ strains and no further attempts to distinguish sfaS; flbA+ from sfaWT;flbA+ were made. Finally, pairwise crosses were made between different sfaS;flbA98 mutant strains to determine how many different suppressor loci had been identified. In every case, ~25% of the progeny had the flbA98 phenotype, indicating that every mutation defined a distinct locus, four of which were designated as sfaA, sfaC, sfaD, sfaE, and the fifth was a new allele of fadA (fadAR205H; see below).

Dominance relationships of sfa mutations:
Because flbA loss-of-function mutations (e.g., flbA98 and {Delta}flbA) are recessive to the wild-type flbA gene, dominance of each suppressor mutation needed to be tested in homozygous flbA- diploid. Such diploids were generated from heterokaryons resulting from fusion between the sfaS;flbA98 strains and a sfaWT;{Delta}flbA (TBN39.5) mutant strain. Resulting heterokaryons were predominantly conidiating and four of the diploid strains isolated (dJYB8, dJYC67, dJYD82, dJYE83; see Table 1) sporulated like wild types when grown at 37°. These diploid strains yielded fluffy haploid sectors when treated with benomyl, confirming that the suppressors had a dominant activity. The sfaA1;flbA98/sfaA+;{Delta}flbA diploid strain (dJYA1; see Table 1) also sporulated but remained somewhat fluffy, so that this suppressor mutation was characterized as semidominant. Interestingly, we found that when these diploid strains were incubated at 25° the phenotype reverted to fluffy, indicating that the dominant suppressor mutant phenotype was cold sensitive (see Table 2). However, haploid sfaS;{Delta}A and sfaS;flbA98 strains remained conidial when grown at 25°.


 
View this table:
In this window
In a new window

 
Table 2. Characteristics of flbA suppressors

Suppression of the flbA deletion mutation:
To test whether these flbA suppressor mutations could bypass a complete lack of flbA function, we substituted the {Delta}flbA mutation for flbA98 by recovering sfaS;{Delta}flbA haploid progeny from the sfaS;flbA98/sfaWT;{Delta}flbA diploid strain (dJYA1–dJYE83). For dJYB8, dJYC67, dJYD82, and dJYE83, conidiating {Delta}flbA haploid progeny were identified, indicating that fadAR205H, sfaC67, sfaD82, and sfaE83 are all able to bypass the complete loss of flbA function and are not allele specific. However, none of the conidial progeny from dJYA1 were {Delta}flbA, indicating that sfaA1 cannot bypass the complete lack of flbA function and thus could be an allele-specific suppressor. Alternatively, the sfaA1 mutation could be on chromosome I, the same chromosome as flbA (very little intrachromosomal recombination occurs in mitotic diploids). However, examination of the segregation pattern for other genes on chromosome I (yA and biA) indicated that this chromosome segregated freely among fluffy progeny.

Identification of a new fadA allele:
Because we knew that some fadA mutations (e.g., {Delta}fadA and fadAG203R; YU et al. 1996 Down) suppress flbA loss-of-function mutations we tested the possibility that one of the suppressors was an allele of fadA by examining linkage to fadAG203R. All but one suppressor (carried by SFA8) locus independently segregated from the fadA locus. The fadA genomic region from SFA8 was amplified by PCR and the sequence was determined to directly test if SFA8 carried an allele of fadA. We found that SFA8 carried a novel fadA mutant allele that resulted from a G-to-A transition causing conversion of Arg205 to His (fadAR205H). This mutant allele was used to transform a flbA98 mutant strain and resulted in conidial transformants, indicating that fadAR205H represents a novel dominant negative fadA allele (see DISCUSSION and Figure 5).



View larger version (83K):
In this window
In a new window
Download PPT slide
 
Figure 3. Suppressors overcome flbA losses of function in ST biosynthesis. All sfaS strains also suppress ST defects caused by flbA losses of function. The wild type (FGSC26; WT), flbA98, flbA98;sfaA1, flbA98;fadAR205H, flbA98;sfaC67, flbA98;sfaD82, and flbA98;sfaE83 strains (shown by relevant genotypes) were inoculated into 3 ml of liquid complete medium in 8-ml vials and incubated at 30° for 7 days (stationary culture). ST was extracted from each culture using chloroform, and samples were analyzed by thin-layer chromatography (YU and LEONARD 1995 Down). ST standard is shown (Std).



View larger version (108K):
In this window
In a new window
Download PPT slide
 
Figure 4. sfaC67 and sfaD82 mutant strains produce conidiophores in submerged culture. Approximately 5 x 105 conidia/ml were inoculated into 100 ml of liquid minimal medium (with supplements and 0.1 g of yeast extract) in 250-ml flasks and incubated at 37° at 300 rpm. Micrographs of flbA98 (A), flbA98;sfaA1 (B), flbA98;fadAR205H (C), flbA98;sfaC67 (D), flbA98;sfaD82 (E), and flbA98;sfaE83 (F) strains were taken at 22 hr after inoculation. Although wild-type A. nidulans strains occasionally formed conidiophores following prolonged incubation, only sfaC67 and sfaD82 strains produced conidiophores by 22 hr after inoculation and these structures were observed in every microscopic field examined.



View larger version (31K):
In this window
In a new window
Download PPT slide
 
Figure 5. fadA mutant alleles. FadA primary protein structure and known dominant activating (a) and interfering (i) mutations are shown. A consensus myristoylation site (MGXXXS) is underlined near the N-terminal end. Dominant activating mutations include G42R (YU et al. 1996 Down), R178C, R178L, (WIESER et al. 1997 Down), G183S (WIESER et al. 1997 Down), and Q204L, and dominant interfering mutations are G203R (YU et al. 1996 Down) and R205H. Switch domains that are important for the proper conformational changes are shown.

sfaE83 can suppress dominant activating fadA mutations:
Because the primary function of the FlbA RGS domain protein antagonizes FadA-directed signaling (YU et al. 1996 Down), and because sfa mutations suppress flbA loss-of-function mutations, it was of interest to know if sfa mutations could also suppress fadA-activating alleles like fadAG42R, which causes a dominant fluffy-autolytic phenotype. To address this question, suppressor mutant strains were transformed with the fadAG42R-activating allele to produce flbA98;fadAG42R/fadA+;sfaS mutant strains. More than 50% of sfaA1, fadAR205H, sfaC67, and sfaD82 transformants were fluffy autolytic as is observed when wild type is transformed with the fadAG42R allele. However, no fluffy autolytic transformants were observed following transformation of the flbA98;sfaE83 strain with the fadAG42R allele. All flbA98;sfaE83 transformants were able to conidiate and genomic DNA Southern blot analysis showed that about 50% of the total transformants had one to five copies of the fadAG42R allele integrated into their genomes. To test whether sfaE83 suppressed other dominant activating fadA alleles an sfaE83;flbA98 strain was transformed with the fadAR178C and fadAQ204L alleles, respectively. Again, all transformants were conidiating and ~50% of them had from one to several copies of each fadA dominant activating mutant allele (see DISCUSSION).

sfa mutants regain the ability to produce a mycotoxin ST:
Because flbA suppressor mutations overcome a complete lack of flbA function for sporulation, it was of interest to test their ability to suppress defects in ST biosynthesis. As shown in Figure 3 and summarized in Table 2, we examined ST production from each suppressor mutant strain as previously described grown under conditions known to favor ST biosynthetic activities in wild type, and all suppressor mutant strains produced ST. Moreover, all suppressor mutants accumulated stc (sterigmatocystin gene cluster; BROWN et al. 1996 Down) transcripts with timing similar to that of the wild-type strain (data not shown).

sfaC67 and sfaD82 mutations cause inappropriate sporulation:
Because all suppressors were dominant we speculated that some of these gain-of-function suppressor mutations might behave like fadAG203R dominant-interfering mutations and cause conidiation even in submerged culture where wild-type A. nidulans strains do not sporulate. In fact, sfaC67 and sfaD82 mutants elaborated complex conidiophores by 22 hr after inoculation in submerged culture (Figure 4). All of the other suppressor mutant strains grew like wild type in submerged culture and did not sporulate. As expected, mRNA corresponding to the developmental regulatory gene brlA accumulated in both sfaC67 and sfaD82 coincident with sporulation (data not shown).

flbA suppressors do not eliminate the need for fluG in sporulation:
The A. nidulans fluG gene is hypothesized to be required for production of a small diffusible extracellular factor that controls initiation of development, possibly by activating FlbA (LEE and ADAMS 1994B Down; LEE and ADAMS 1996 Down). We showed previously that neither a dominant interfering fadA mutation (fadAG203R) nor a deletion of fadA could overcome fluG loss-of-function mutations for asexual sporulation (YU et al. 1996 Down). This led us to propose that developmental activation requires fluG factor-mediated events that are distinct from inhibition of FadA-mediated growth signaling. Because flbA suppressors were identified on the basis of recovery of asexual sporulation, one possibility is that suppression results from hyperactivation of FadA-independent FluG signaling events. We have tested this possibility by examining the ability of flbA suppressor mutations to bypass the loss of fluG functions for sporulation. This was accomplished by transformation of each flbA98;argB2;sfaS strain (except sfaA1 due to the absence of appropriate strains) with pJYGD4 (containing a fluG deletion replaced by argB+) and screening for the {Delta}fluG phenotype. Approximately 20% of transformants from each set of transformation experiment had the {Delta}fluG developmental phenotype, indicating that none of the suppressor mutations could bypass fluG loss-of-function mutations for this sporulation function. However, all {Delta}fluG phenotypic transformants were able to produce ST as expected, if the main role of FluG in ST biosynthesis was indirect, through activating FlbA (see Introduction and Figure 1; HICKS et al. 1997 Down).

Additional suppressors identify alleles of sfaD82:
Because all of the first flbA suppressor mutants identified different loci and most were bypass suppressors, we decided to screen for additional suppressor mutants beginning with a {Delta}flbA strain. Among 50,000 survivors, 2 showed partial suppression of conidiation defects and 4 sporulated nearly as well as wild type (MSR123, 125, 126, 127). Because a {Delta}flbA strain was used to isolate these primary suppressor mutants, these are expected to be extragenic bypass suppressors of flbA function. Meiotic crosses between these primary suppressor mutants and a developmentally wild-type strain (FGSC237) did not generate any distinguishable progeny, indicating that as with other flbA mutant suppressors, these mutations were silent in flbA+ strains. No fluffy progeny arose from sexual crosses between these new suppressor mutant strains, indicating that the suppressor mutations were closely linked to one another. To test whether these suppressor mutations were alleles of previously identified flbA98 suppressor mutations, mutant strains of the new series (MSR123 and MSR127) were crossed with sfaA1, sfaC67, sfaD82, sfaE83, and fadAR205H mutant strains (RJY1.12, 67.3, 82.6, 83.21, and 8.22, respectively). Fluffy progeny were recovered from all crosses except MSR123 x RJY82.6 and MSR127 x RJY82.6 crosses, indicating that these additional suppressor mutations are likely to be alleles of sfaD82 (or represent closely linked loci). We have tentatively called these mutations sfaD123, sfaD125, sfaD126, and sfaD127, respectively. Interestingly, MSR125 (sfaD125, not shown) sporulated in submerged culture like SFA82 (sfaD82; Figure 4), but the other mutants grew like wild types, indicating that all sfaD alleles are not identical for this trait. All of these mutations were dominant at 37° but recessive at 25°, similar to sfaD82, and all mutants regained the ability to produce ST (not shown).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We previously proposed that there are two antagonistic signaling pathways that coordinate A. nidulans growth, conidiation, and ST biosynthesis (see Introduction and Figure 1; YU et al. 1996 Down; HICKS et al. 1997 Down). As a step toward understanding the multiple roles of FlbA in controlling growth, sporulation, and ST biosynthesis we have isolated a collection of mutants that sporulate and produce ST even in the absence of FlbA. These mutant strains carry dominant or semidominant mutations in any of five distinct loci designated sfaA, sfaC, sfaD, sfaE, and a novel fadA allele, fadAR205H. Because sfaA1, sfaC67, and sfaD82 mutations suppressed flbA loss-of-function mutations but could not suppress fadA dominant activating mutant alleles, we propose that the normal products of these genes most likely function prior to FadA activation or are required in some other way for FadA activity.

One of the suppressor mutants (SFA8) turned out to represent a novel allele of fadA (fadAR205H). This mutation has not been described in other G{alpha} proteins but causes a dominant negative phenotype similar to the G203R mutation described earlier (YU et al. 1996 Down). Arg205, like Gly203, is predicted to be a part of alpha helix 2 in the switch II region of G{alpha} proteins and could therefore be required for the conformational change that triggers disengagement of G{alpha} and Gß{gamma} following receptor-mediated GDP-GTP exchange on G{alpha} (NOEL et al. 1993 Down; SONDEK et al. 1996 Down). Although fadAR205H behaves as a dominant loss-of-function mutation, this mutation differs from the fadAG203R mutation in that it failed to stimulate submerged sporulation (see YU et al. 1996 Down).

While we do not yet know what sfaA, sfaC, and sfaD encode, it is interesting to speculate that these could encode other elements of the heterotrimeric G-protein such as Gß or G{gamma}. In many cases the Gß{gamma} heterodimer can function in signaling downstream effectors like those stimulated by G{alpha}-GTP (CLAPHAM and NEER 1993 Down; NEER 1995 Down). If the Gß{gamma} complex associated with FadA is also required to stimulate growth and block sporulation, then loss-of-function or dominant negative mutations in either the Gß or {gamma} subunits could suppress flbA- phenotype. We previously observed that the fadAG203R dominant negative mutation caused submerged asexual sporulation, but {Delta}fadA mutations did not. Given that the expected effect of fadAG203R is to block the conformational change in the switch II region of G{alpha}, preventing dissociation from Gß{gamma}, one possible explanation for the different phenotypes is that inhibition or loss of Gß{gamma} is required for hyperactive sporulation to occur. In keeping with this hypothesis, both sfaC67 and sfaD82 alleles caused hyperactive sporulation (Figure 4) and might therefore identify Gß or {gamma} subunits.

Another possible role for sfaA, sfaC, or sfaD products is in post-translational modification of G-protein subunits. Like many G{alpha} proteins, FadA contains a consensus amino acid sequence for myristoylation at its N terminus (BUSS et al. 1987 Down; YU et al. 1996 Down; see Figure 5). N-Myristoylation is known to be essential for G{alpha} membrane association, proper G{alpha}-Gß{gamma} interaction, and receptor coupling (SONG and DOHLMAN 1996 Down; SONG et al. 1996 Down) so that mutations blocking myristoylation of FadA would be predicted to be like loss of fadA function. Similarly, prenylation of G{gamma} subunits is typically required for membrane localization and for efficient downstream signaling by Gß{gamma} (SIMONDS et al. 1991 Down; CLARKE 1992 Down; MUNTZ et al. 1992 Down). Thus, loss of prenyltransferase activity could have similar effects to loss of Gß or G{gamma} function.

sfaA1 differs from mutations in other suppressor genes in that it is semidominant and is unable to suppress a flbA deletion mutant. Sequence analysis of the flbA98 allele that sfaA1 mutation suppresses showed that a G-to-A transition occurred at the 3' border of the third intron (GT - - - AGG-> AAG). This mutation is predicted to cause incorrect splicing and result in a frameshift affecting the last 50 amino acids at C terminus, including the end (16 amino acids) of the RGS domain. An interesting possibility is that the flbA98 mutation results in a partially functional FlbA protein that lacks RGS-GAP activity and that the sfaA1 mutation can suppress loss of GAP activity but not loss of other unknown FlbA functions. If this turns out to be true, sfaA might identify a unique activity that will help to define FlbA's additional roles.

sfaE83 differs from the other suppressor mutations in its ability to suppress not only flbA loss-of-function, but also dominant activating fadA mutations (G42R, Q204L, R178C). These dominant activating fadA mutations cause a loss of (or a dramatic decrease in) the intrinsic GTPase activity of G{alpha} (FadA), which is essential for inactivating heterotrimeric G-protein signaling. Thus, sfaE mutations could either block activation of FadA by preventing GDP-GTP exchange or prevent transmission of downstream FadA-mediated signaling events. In the first case, it is possible that mutations that interfere with agonist-receptor sensitization (STEFAN and BLUMER 1994 Down) would prevent GDP-GTP exchange and suppress both flbA loss-of-function and fadA dominant activating mutations. For the second case, many downstream effector molecules that are regulated by G-protein subunits have been described, including ion channels, phospholipase A2, protein kinases, adenylyl cyclases, and phospholipase C (for review, see CLAPHAM and NEER 1993 Down; NEER 1995 Down). If any of these activities are essential for FadA-mediated growth activation and inhibition of sporulation, loss-of-function mutations would be predicted to suppress both flbA loss-of-function and fadA dominant activating mutations.

No flbA suppressors bypass the complete lack of fluG function. We proposed previously that fluG is required for: (i) activation of FlbA, which then inactivates FadA, and (ii) activation of development-specific functions that require the products of other genes, including flB, flbC, flbD, flbE, and brlA (see Figure 1; ADAMS et al. 1988 Down; WIESER et al. 1994 Down; WIESER and ADAMS 1995 Down; LEE and ADAMS 1996 Down). Our earlier finding that fadA deletion and fadAG203R dominant interfering mutant alleles did not bypass fluG loss-of-function mutations in asexual sporulation led us to propose that both processes must occur if development is to proceed (YU et al. 1996 Down). Because none of the flbA suppressor mutations can suppress loss-of-fluG function, we propose that like FlbA, the major role for the products of sfa genes in activating asexual sporulation is indirect, through their effects on FadA-mediated growth signaling.

Finally, strategies for isolating the genes identified by these suppressors need to be discussed. The fact that all the suppressor mutations are dominant or semidominant at 37° but recessive at 25° (Table 2) provides two potential strategies for isolating the corresponding genes. In the first approach, the dominant nature of these mutations can be taken advantage of in constructing cosmid libraries from the suppressor mutant strains (sfaS;flbA-) to transform flbA98 or flbA deletion strains followed by screening for transformants that are developmentally wild type at 37° but fluffy at 25°. Alternatively, it may be possible to take advantage of the temperature-sensitive nature of the suppressors by transforming the suppressor strains (sfaS; flbA98 or sfaS;{Delta}flbA) with a wild-type genomic DNA library and screening for transformants that are conidial at 37° but are fluffy at 25°. In any case, identification of each suppressor will lead us to better understand coordinate control of growth, development, and ST biosynthesis in A. nidulans.


*  FOOTNOTES

1 Present address: Cereon Genomics, LLC, Bldg. 300, 1 Kendall Sq., Cambridge, MA 02139. Back


*  ACKNOWLEDGMENTS

We thank our colleagues in the lab for their many helpful suggestions. This work was supported by National Institutes of Health grant GM-45252 to T.H.A. and by Hellmuth Hertz Foundation and the Swedish Institute postdoctoral fellowship to S.R.

Manuscript received March 31, 1998; Accepted for publication September 25, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, T. H., 1994 Asexual sporulation in higher fungi, pp. 367–382 in The Growing Fungus, edited by N. A. R. GOW and G. M. GADD. Chapman & Hall, London.

ADAMS, T. H., M. T. BOYLAN, and W. E. TIMBERLAKE, 1988  brlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans.. Cell 54:353-362[Medline].

ADAMS, T. H., J. K. WIESER, and J.-H. YU, 1998  Asexual sporulation in Aspergillus nidulans. Microbiol. Rev. 62:35-54[Abstract/Free Full Text].

BERMAN, D. M., T. M. WILKIE, and A. G. GILMAN, 1996  GAIP and RGS4 are GTPase activating proteins (GAPs) for the Gi subfamily of G protein {alpha} subunits. Cell 86:445-452[Medline].

BROWN, D. W., J.-H. YU, H. S. KELKAR, M. FERNANDES, and T. C. NESBITT et al., 1996  Twenty-five coregulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans. Proc. Natl. Acad. Sci. USA 93:1418-1422[Abstract/Free Full Text].

BUSS, J. E., S. E. MUMBY, P. J. CASEY, A. G. GILMAN, and B. M. SEFTON, 1987  Myristoylated alpha subunits of guanine nucleotide-binding regulatory proteins. Proc. Natl. Acad. Sci. USA 84:7493-7497[Abstract/Free Full Text].

CLAPHAM, D. E. and E. J. NEER, 1993  New roles for G-protein ß{gamma} dimers in transmembrane signalling. Nature 365:403-406[Medline].

CLARKE, S., 1992  Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochem. 61:355-386[Medline].

HICKS, J. K., J.-H. YU, N. P. KELLER, and T. H. ADAMS, 1997  Aspergillus sporulation and mycotoxin production both require inactivation of the FadA G{alpha} protein-dependent signaling pathway. EMBO J. 16:4916-4923[Medline].

FER, E., 1977  Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19:33-131[Medline].

KUNKEL, T. A., 1985  Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492[Abstract/Free Full Text].

LEE, B.-N. and T. H. ADAMS, 1994a  Overexpression of flbA, an early regulator of Aspergillus asexual sporulation, leads to activation of brlA and premature initiation of development. Mol. Microbiol. 14:323-334[Medline].

LEE, B.-N. and T. H. ADAMS, 1994b  The Aspergillus nidulans fluG gene is required for production of an extracellular developmental signal and is related to prokaryotic glutamine synthetase I. Genes Dev. 8:641-651[Abstract/Free Full Text].

LEE, B.-N. and T. H. ADAMS, 1996  fluG and flbA function interdependently to initiate conidiophore development in Aspergillus nidulans through brlAß activation. EMBO J. 15:299-309[Medline].

MILLER, B., K. MILLER, and W. E. TIMBERLAKE, 1985  Direct and indirect gene replacements in Aspergillus nidulans. Mol. Cell. Biol. 5:1714-1721[Abstract/Free Full Text].

MUNTZ, K. H., P. C. STERNWEIS, A. G. GILMAN, and S. M. MUMBY, 1992  Influence of {gamma} subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes. Mol. Cell. Biol. 3:49-61.

NEER, E. J., 1995  Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249-257[Medline].

NOEL, J. P., H. E. HAMM, and P. B. SIGLER, 1993  The 2.2 Å crystal structure of transducin-{alpha} complexed with GTP{gamma}S. Nature 366:654-663[Medline].

PONTECORVO, G., J. A. ROPER, L. M. HEMMONS, K. D. MACDONALD, and A. W. J. BUFTON, 1953  The genetics of Aspergillus nidulans. Adv. Genet. 5:141-238[Medline].

PONTING, C. P. and P. BORK, 1996  Pleckstrin's repeat performance: a novel domain in G-protein signaling? Trends Biochem. Sci. 21:245-246[Medline].

SIMONDS, W. F., J. E. BUTRYNSKI, N. GAUTAM, C. G. UNSON, and A. M. SPIEGEL, 1991  G protein ß{gamma} dimers: membrane targeting required subunit coexpression and intact {gamma} C-A-A-X domain. J. Biol. Chem. 266:5363-5366[Abstract/Free Full Text].

SONDEK, J., A. BOHM, D. G. LAMBRIGHT, H. E. HAMM, and P. B. SIGLER, 1996  Crystal structure of a GA protein ß{gamma} dimer at 2.1 Å resolution. Nature 379:369-374[Medline].

SONG, J. and H. G. DOHLMAN, 1996  Partial constitutive activation of pheromone responses by a palmitoylation-site mutant of a G protein {alpha} subunit in yeast. Biochemistry 35:14806-14817[Medline].

SONG, J., J. HIRSCHMAN, K. GUNN, and H. G. DOHLMAN, 1996  Regulation of membrane and subunit interactions by N-myristoylation of a G protein {alpha} subunit in yeast. J. Biol. Chem. 271:20273-20283[Abstract/Free Full Text].

STEFAN, C. J. and K. J. BLUMER, 1994  The third cytoplasmic loop of a yeast G-protein-coupled receptor controls pathway activation, ligand discrimination, and receptor internalization. Mol. Cell. Biol. 14:3339-3349[Abstract/Free Full Text].

WATSON, N., M. E. LINDER, K. M. DRUEY, J. H. KEHRL, and K. J. BLUMER, 1996  RGS family members: GTPase-activating proteins for heterotrimeric G-protein {alpha} subunits. Nature 383:172-175[Medline].

WIESER, J. and T. H. ADAMS, 1995  flbD encodes a Myb-like DNA binding protein that regulates initiation of Aspergillus nidulans conidiophore development. Genes Dev. 9:491-502[Abstract/Free Full Text].

WIESER, J., B. N. LEE, J. W. FONDON, and T. H. ADAMS, 1994  Genetic requirements for initiating asexual development in Aspergillus nidulans. Curr. Genet. 27:62-69[Medline].

WIESER, J., J.-H. YU, and T. H. ADAMS, 1997  Dominant mutations affecting both sporulation and sterigmatocystin biosynthesis in Aspergillus nidulans. Curr. Genet. 32:218-224[Medline].

YELTON, M. M., J. E. HAMER, and W. E. TIMBERLAKE, 1984  Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81:1470-1474[Abstract/Free Full Text].

YU, J.-H. and T. J. LEONARD, 1995  Sterigmatocystin biosynthesis in Aspergillus nidulans requires a novel type I polyketide synthase. J. Bacteriol. 177:4792-4800[Abstract/Free Full Text].

YU, J.-H., J. WIESER, and T. H. ADAMS, 1996  The Aspergillus FlbA RGS domain protein antagonizes G protein signaling to block proliferation and allow development. EMBO J. 15:5184-5190[Medline].




This article has been cited by other articles:


Home page
Eukaryot CellHome page
J.-H. Yu, J.-H. Mah, and J.-A. Seo
Growth and developmental control in the model and pathogenic aspergilli.
Eukaryot. Cell, October 1, 2006; 5(10): 1577 - 1584.
[Full Text] [PDF]


Home page
Eukaryot CellHome page
J.-H. Mah and J.-H. Yu
Upstream and Downstream Regulation of Asexual Development in Aspergillus fumigatus.
Eukaryot. Cell, October 1, 2006; 5(10): 1585 - 1595.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J.-A. Seo, Y. Guan, and J.-H. Yu
FluG-Dependent Asexual Development in Aspergillus nidulans Occurs via Derepression
Genetics, March 1, 2006; 172(3): 1535 - 1544.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
J.-A. Seo and J.-H. Yu
The Phosducin-Like Protein PhnA Is Required for G{beta}{gamma}-Mediated Signaling for Vegetative Growth, Developmental Control, and Toxin Biosynthesis in Aspergillus nidulans
Eukaryot. Cell, February 1, 2006; 5(2): 400 - 410.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J.-A. Seo, K.-H. Han, and J.-H. Yu
Multiple Roles of a Heterotrimeric G-Protein {gamma}-Subunit in Governing Growth and Development of Aspergillus nidulans
Genetics, September 1, 2005; 171(1): 81 - 89.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
M. Ni, S. Rierson, J.-A. Seo, and J.-H. Yu
The pkaB Gene Encoding the Secondary Protein Kinase A Catalytic Subunit Has a Synthetic Lethal Interaction with pkaA and Plays Overlapping and Opposite Roles in Aspergillus nidulans
Eukaryot. Cell, August 1, 2005; 4(8): 1465 - 1476.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M.-H. Chang, K.-S. Chae, D.-M. Han, and K.-Y. Jahng
The GanB G{alpha}-Protein Negatively Regulates Asexual Sporulation and Plays a Positive Role in Conidial Germination in Aspergillus nidulans
Genetics, July 1, 2004; 167(3): 1305 - 1315.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
P. K. Mukherjee, J. Latha, R. Hadar, and B. A. Horwitz
Role of Two G-Protein Alpha Subunits, TgaA and TgaB, in the Antagonism of Plant Pathogens by Trichoderma virens
Appl. Envir. Microbiol., January 1, 2004; 70(1): 542 - 549.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J.-A. Seo, Y. Guan, and J.-H. Yu
Suppressor Mutations Bypass the Requirement of fluG for Asexual Sporulation and Sterigmatocystin Production in Aspergillus nidulans
Genetics, November 1, 2003; 165(3): 1083 - 1093.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
A. M. Calvo, R. A. Wilson, J. W. Bok, and N. P. Keller
Relationship between Secondary Metabolism and Fungal Development
Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 447 - 459.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. M. Kellner and T. H. Adams
Mutations in sfdA and sfdB Suppress Multiple Developmental Mutations in Aspergillus nidulans
Genetics, January 1, 2002; 160(1): 159 - 168.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. A. D'Souza, B. N. Lee, and T. H. Adams
Characterization of the Role of the FluG Protein in Asexual Development of Aspergillus nidulans
Genetics, July 1, 2001; 158(3): 1027 - 1036.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. J. Fowler and M. F. Mitton
Scooter, a New Active Transposon in Schizophyllum commune, Has Disrupted Two Genes Regulating Signal Transduction
Genetics, December 1, 2000; 156(4): 1585 - 1594.
[Abstract] [Full Text]