The MSN1 and NHP6A Genes Suppress SWI6 Defects in Saccharomyces cerevisiae

Corresponding author: Linda Breeden, Fred Hutchinson Cancer Research Center, A2-168, 1100 Fairview Ave. N., Seattle, WA 98109., lbreeden{at}fred.fhcrc.org (E-mail)

Communicating editor: M. CARLSON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Ankyrin (ANK) repeats were first found in the Swi6 transcription factor of Saccharomyces cerevisiae and since then were identified in many proteins of eukaryotes and prokaryotes. These repeats are thought to serve as protein association domains. In Swi6, ANK repeats affect DNA binding of both the Swi4/Swi6 and Mbp1/Swi6 complexes. We have previously described generation of random mutations within the ANK repeats of Swi6 that render the protein temperature sensitive in its ability to activate HO transcription. Two of these SWI6 mutants were used in a screen for high copy suppressors of this phenotype. We found that MSN1, which encodes a transcriptional activator, and NHP6A, which encodes an HMG-like protein, are able to suppress defective Swi6 function. Both of these gene products are involved in HO transcription, and Nhp6A may also be involved in CLN1 transcription. Moreover, because overexpression of NHP6A can suppress caffeine sensitivity of one of the SWI6 ANK mutants, swi6-405, other SWI6-dependent genes may also be affected by Nhp6A. We hypothesize that Nhp6A and Msn1 modulate Swi6-dependent gene transcription indirectly, through effects on chromatin structure or other transcription factors, because we have not been able to demonstrate that either Msn1 or Nhp6A interact with the Swi4/Swi6 complex.

THE Swi6 protein of Saccharomyces cerevisiae is involved in the regulation of dozens of genes that are transcribed at the G₁/S transition of the cell cycle. These include the genes encoding the HO endonuclease, G1 cyclins (NASMYTH and DIRICK 1991 ; OGAS et al. 1991 ; DIRICK et al. 1992 ; MEASDAY et al. 1994 ), and many of the genes involved in DNA replication (MCINTOSH et al. 1988 ; LOWNDES et al. 1991 , LOWNDES et al. 1992 ; DIRICK et al. 1992 ). Swi6 associates with at least two DNA-binding factors, Swi4 and Mbp1. These associations are mediated by the C-terminal domains of the proteins (ANDREWS and MOORE 1992B ; PRIMIG et al. 1992 ; KOCH et al. 1993 ; SIDOROVA and BREEDEN 1993 ), and the N termini of Swi4 and Mbp1 confer the DNA-binding specificity to these complexes. The Swi4/Swi6 complex binds to SCB (CACGAAA) elements in CLN2, HO, and PCL1 (PHO85 CycLin) and MCB-like elements of CLN1 (ANDREWS and HERSKOWITZ 1989 ; ANDREWS and MOORE 1992A ; PRIMIG et al. 1992a; PARTRIDGE et al. 1997 ). The Mbp1/Swi6 complex binds to MCB (ACGCGTnA) elements (MCINTOSH et al. 1991 ; LOWNDES et al. 1992 ; KOCH et al. 1993 ).

Swi4, Mbp1, Swi6, and the S. pombe homologues Res1, Res2, and Cdc10 contain four ankyrin (ANK) repeats. These repeats are degenerate 33 amino acid motifs that are found in tandem in many different proteins in both eukaryotes and prokaryotes (BORK 1993 ). In several cases ANK repeats have been shown to be involved in protein-protein association (THOMPSON et al. 1991 ; HENKEL et al. 1992 ; LAMBERT and BENNETT 1993 ; SCHNEIDER et al. 1994 ). The Swi6 ANK repeats are critical for its function, but their role is unclear. Our modeling analysis of Swi6 ANK repeats (EWASKOW et al. 1998 ) suggests that they may represent a new protein fold that supports active conformation of Swi6 complexes and/or properly displays protein association interfaces.

We have generated numerous ANK repeat mutations in Swi6 that render a transcriptionally inactive protein (SIDOROVA and BREEDEN 1993 ; EWASKOW et al. 1998 ). At the biochemical level, these mutations can lead to a reduced DNA binding, but most also cause a significant shift in the mobility of Swi4/Swi6 complexes in band shift gels (EWASKOW et al. 1998 ). The latter suggests the possibility that the DNA-bound Swi4/Swi6 complex can undergo a significant conformational change. Furthermore, it is possible that there are accessory proteins that may modulate this change to affect transcriptional activity of the Swi4/Swi6 complex.

In this work we used two of the temperature-sensitive ANK alleles of SWI6 in a high copy suppressor screen to find proteins needed for the full activity of the Swi4/Swi6 complex. We report the results of this screen and the further analysis of two of these high copy suppressors, NHP6A and MSN1.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and plasmids:
The BY600 MATa swi6::TRP1 ade ho::lacZ ura3 his3 leu2-3,112 trp1-1 can1-100 met2 and BY606 MATa swi4::LEU2 ade ho::lacZ ura3 his3 leu2-3,112 trp1-1 can1-100 met2 strains are described in SIDOROVA and BREEDEN 1993 . The BY1998 strain MATa his3200 ura3-52 lys2-801 ade2-101 msn11::TRP1 trp1 was kindly provided by M. Carlson (ESTRUCH and CARLSON 1990 ). The BY2036 strain MAT ura3-52 trp1-289 his31 leu2-3 gal2 gal10 nhp6a-3::URA3 nhp6b-3::HIS3 was kindly provided by M. Snyder (COSTIGAN et al. 1994 ). BY28 MATa ade2 his3 leu2-3,112 trp1-1 ura3 is W303-1a. The plasmid pSWI6 (pBD1378) was described previously (SIDOROVA et al. 1995 ). pSWI6-406 (pBD2046) and pSWI6-405 (pBD2031) are analogous to pBD1378, but contain mutated alleles of SWI6. Positions of these and other mutations in the SWI6 alleles used in this study are listed in Table 2. Strains BY1954 swi6 LEU2::swi6-405, BY1956 swi6 LEU2::swi6-406, and analogous strains bearing other ANK mutations were constructed by integrative transformation of BY600 strain (SIDOROVA and BREEDEN 1993 ) with linearized pRS305 plasmids carrying SWI6 DNA (HindIII to SmaI fragments). High copy suppressor subclones were generated in pRS426 or pZUC12 2µ vector backgrounds. Subcloned suppressors were sequenced with M13 universal or reverse primers and library clones borne on YEp24 vector were sequenced with primer BL146 5'ACTACGCGATCATGG3'. The plasmid pBD2068 was a gift from M. Snyder and contains an HA-tagged NHP6A on the YEp352 vector (COSTIGAN et al. 1994 ). The plasmids pDK267 and pDK268 were provided by D. Kolodrubetz. pDK267 contains NHP6B sequence flanked by ~700 bp of genomic sequence on either side, cloned into EcoRI-HindIII-digested YEp352. pDK268 carries a 1.6-kb EcoRI-PstI fragment containing the NHP6A gene and flanking sequences cloned into YEp352.

Growth conditions:
All rich (YEPD) and minimal (YC) media and growth conditions were as described previously (BREEDEN and MIKESELL 1991 ). Temperature-sensitive ANK mutant strains were cultivated at 30° and shifted to 37° for 8–12 hr when grown in liquid media. When grown on plates, they were incubated at 37° for the whole period of growth.

DNA, RNA, and protein analysis:
FACS analysis of yeast cells was done as described in (HEICHMAN and ROBERTS 1996 ) and data were analyzed using CellQuest software. Procedures for RNA isolation and S1 protection were performed as described previously (BREEDEN and MIKESELL 1991 ). Protein extract preparation, immunoprecipitation, and Western blotting were done as described before (SIDOROVA and BREEDEN 1993 ; SIDOROVA et al. 1995 ).

In vitro transcription and translation:
The plasmid pBD972 was used for in vitro translation of Swi4 (EWASKOW et al. 1998 ). pBD972 was added to a TNT rabbit reticulocyte lysate coupled transcription translation system (Promega, Madison, WI) along with 20–50 ng of the recombinant Swi6 purified from Escherichia coli (SIDOROVA and BREEDEN 1993 ). Reactions were carried out according to manufacturer's recommendations with cold amino acids. Reaction products were added directly to HO promoter DNA-binding reactions or loaded onto SDS PAGE.

Gst fusion and purification from yeast or bacterial cells:
To construct GST fusions, MSN1 and NHP6A were generated by polymerase chain reaction (PCR) from pM-4 (pBD2050) and pN-5 (pBD2055), respectively, using M13 reverse primer and BL138 5'GGATCCATGGTCACCCCAAGAG3' primer for NHP6A, and M13 reverse and BL137 5'CCGGATCCATGGCAAGTAACC3' primers for MSN1. PCR fragments were cloned into pCRII (Invitrogen, Carlsbad, CA) generating pBD2056 and pBD2059, respectively. For construction of the GST-NHP6A fusion, the 2.3-kb BamHI fragment with the NHP6A open reading frame out of pBD2056 was cloned into BamHI-digested pBD1905, which bears GST under the control of GAL promoter in pRS316 vector, to give rise to pBD2057, or into BamHI-cut pGex2T (Pharmacia, Piscataway, NJ) to make pBD2064. The GAL-GST-NHP6A cassette was also recloned into a 2µ vector pBD2055 by insertion of the 2.9-kb EcoRV fragment of pBD2057, containing a portion of the URA3 gene and GAL-GST-NHP6A, into EcoRV-cut pBD2055; the resulting construct is called pBD2063.

For the GST-MSN1 fusions (pBD2061 and 2062), first the 1.5-kb SacI fragment from pBD2049 was substituted for the SacI fragment in pBD2058. Then the 1.4-kb BamHI fragment of the resulting pBD2060 containing MSN1 was cloned into BamHI-cut pBD1905, to give rise to pBD2061, or into BamHI-cut pGex2T (Pharmacia), to give rise to pBD2062.

To purify Gst fusions from E. coli, pBD2064 and pBD2062 were transformed into DH5 cells and the resulting strains were treated according to Pharmacia Biotech Gene Fusion System protocols. Bacterial cultures were grown to OD 0.6, and fusion protein expression was induced by 0.1 mM isopropyl thiogalactoside for 2 hr. Cells were then harvested, sonicated, centrifuged, and extracts were incubated with glutathione Sepharose 4B beads (Sigma, St. Louis) for 30 min at 4°. To determine if the Gst fusions were capable of interacting with Swi6, these glutathione beads with fusion proteins immobilized on them were incubated with recombinant Swi6 or in vitro-translated Swi4/Swi6 complex, washed, boiled, and loaded onto SDS PAGE.

To obtain Gst fusions from yeast, pBD2057, pBD2063, and pBD2061 were transformed into W303-1a strain. The resulting strains were grown in selective media with raffinose overnight and then expression of the fusions was induced by galactose for 3–4 hr. Cells were harvested, and protein extracts were prepared as described before (SIDOROVA et al. 1995 ) and incubated for 1 hr with glutathione beads in GST buffer containing protease inhibitors (100 mM Tris HCl pH 8.0, 100 mM NaCl, 0.2% NP40 with 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml pepstatin A). Beads were then washed in three or four changes of GST buffer. To elute fusion proteins from the beads, the beads were resuspended in 50 ml of glutathione buffer, prepared according to the Pharmacia Biotech protocol. Fusions were eluted for 15 min at room temperature. To determine if Swi6 copurified with any of the Gst fusions from yeast, glutathione eluates were loaded onto SDS PAGE, and Western blots were performed with Swi6 antibodies. Alternatively, extracts of yeast cells expressing fusion proteins were subjected to immunoprecipitation with Swi6 or Swi4 antibodies. Immunoprecipitates were loaded onto SDS PAGE, Western blotted, and probed with Gst antibodies (Santa Cruz).

Thrombin cleavage of the Nhp6A from the Gst-Nhp6A fusion, bound to glutathione beads, was performed according to Pharmacia Biotech protocols. Glutathione beads were mixed with 38 µl of PBS and 2 µl of thrombin solution (1 unit/µl thrombin in PBS), incubated overnight at room temperature, and centrifuged. Supernatants were used directly for DNA-binding reactions.

Gel retardation:
Gel retardation analysis was performed exactly as described (SIDOROVA and BREEDEN 1993 ; EWASKOW et al. 1998 ). When the in vitro-translated Swi4/Swi6 complex was bound to DNA, little (0.2–0.5 µg) or no nonspecific competitor dI-dC was added. The binding pattern was the same, regardless of whether dI-dC was present in the reaction or not. Thrombin or glutathione eluates of the Gst-Nhp6A fusion were directly added to DNA-binding reactions with HO promoter fragment. No dI-dC competitor was used in these reactions since Nhp6A is a nonspecific DNA binder (PAULL and JOHNSON 1995 ) and can be competed from HO DNA by dI-dC (J. SIDOROVA, unpublished results).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Screen for high copy suppressors of temperature-sensitive ho::lacZ expression phenotype of swi6-405 and swi6-406 mutants:
We have previously carried out random mutagenesis of the ANK repeat-encoding region of the SWI6 gene (EWASKOW et al. 1998 ). Two of these mutants, swi6-405 (N330T, N500Y) and swi6-406 (T326I, T402S), were used in this study. Both mutants express Swi6 protein at the nonpermissive temperature; however, the level of Swi6 is reduced as compared to the wild-type protein level (Figure 2A). There is no ho::lacZ activity detected in swi6 strains expressing Swi6-405 or Swi6-406 from the CEN plasmid pRS316 at 37°, but at 30 and 25°, they confer partial activity as judged by cell morphology and ho::lacZ transcript levels (data not shown and see below). In band shift assays, Swi4/Swi6-405 complex is less active in binding to SCB elements than the wild-type complex, and Swi4/Swi6-406 complex has an altered mobility (EWASKOW et al. 1998 ).

View larger version (19K): [in this window] [in a new window] [Download PPT slide]   Figure 1. MSN1 and NHP6A suppress SWI6 mutants. Shown are the maps of suppressors c4 and c15 and the subclones generated to identify the open reading frames responsible for suppression. Triangles within boxes show direction of transcription of the genes. The names of the subclones generated in this study are listed on the right; M stands for MSN1 and N for NHP6A. The 1-kb segment below designates the scale. The subclones of c4 and c15 were transformed into BY1956 swi6-406 and BY1954 swi6-405, respectively, streaked onto selective media plates, and grown at 37°. Then X-gal filter assays were performed. BY1954 and BY1956 transformed with pRS426 or pZUC12 served as negative controls for these assays. The development of blue color above the negative control level was scored as suppression.

View larger version (36K): [in this window] [in a new window] [Download PPT slide]   Figure 2. NHP6A and MSN1 suppress swi6-405 and swi6-406 ANK mutant ho::lacZ transcription defects. (A) Western blots of Swi6 expressed in the following strains at 37°. BY600 was transformed with pRS316 (vector), pSWI6 pBD1378, pSWI6-405 pBD2031, and pSWI6-406 pBD2046 and BY1954 swi6-405 ho::lacZ strain was transformed with the vector pRS426 or NHP6A-carrying plasmids pN-5, pDK268, HA-NHP6A and with NHP6B-carrying pDK267 (see MATERIALS AND METHODS and Figure 1). An asterisk marks the position of the Swi6 protein. (B) S1 protection was performed on RNAs isolated from the same set of BY1954 swi6-405 strains grown at 25° or 30° for 10 hr. Levels of ho::lacZ mRNA obtained from two to three measurements were quantitated, normalized to the internal control levels (SIR3 mRNA), and plotted. (C) S1 protection was performed on RNAs isolated from the BY1956 swi6-406 strain transformed with vector pRS426 or MSN1-carrying pM-2 and grown for 10 hr at 25° or 30°. ho::lacZ levels were measured and quantitated as in B. (D) S1 protection was performed on BY1954 swi6-405 strain transformed with vector pRS426, pN-5, or c12 (an MSN1-carrying clone) and grown at 25° or 30°. Positions of ho::lacZ and internal control (SIR3) transcripts are marked.

The mutated SWI6 genes were integrated at the LEU2 locus of the swi6 ho::lacZ strain, giving rise to strains BY1954 (swi6-405) and BY1956 (swi6-406). These strains were transformed with a 2µ-based yeast genomic library (CARLSON and BOTSTEIN 1982 ) and about 60,000 transformants were obtained for each. Colonies were grown at 30° for the first 2 days upon transformation and then incubated at 37° overnight. Colonies were transferred to nitrocellulose filters and assayed for ß-galactosidase activity using the X-gal filter assay (BREEDEN and NASMYTH 1985 ). Transformants that developed blue color above the background were selected. Library plasmids were isolated out of these cells, retransformed into BY1954 or BY1956 strains, and reassayed to confirm suppression. They were also transformed into BY600 swi6 ho:lacZ strain to determine if candidate suppressors were able to bypass the Swi6 function.

We recovered a total of 8 suppressor plasmids from swi6-406 and 19 from swi6-405 transformants. Using restriction digestion and PCR, we identified four different suppressors for swi6-406 and six for swi6-405. These are listed in Table 1. The SWI6 gene was isolated five times in the screen with swi6-406 and three times with swi6-405. Two suppressors (c2a and c6) were not pursued further because they activated ho::lacZ expression equally strongly in swi6-405 and swi6 cells and thus were completely independent of Swi6. Most of the suppressors (c2, c4, c5, c9, c12, c19, and c23) suppressed the ho::lacZ expression defect to some extent in the absence of Swi6, but only one (c19) could suppress in the absence of Swi4. This requirement for Swi4 suggests that the majority of suppressors enhance Swi4-mediated activation, rather than cause a general derepression of transcription. c15 showed no suppression of the ho::lacZ transcription defect in swi4 or swi6 deletion strains and thus was the best candidate for an allele-specific suppressor.

Sequence information was obtained for all the Swi4- and Swi6-dependent suppressors. c4, c5, c9, and c12 carry overlapping fragments from chromosome XV, and c23 has a nonoverlapping fragment from the same chromosome. c15 carries a fragment from chromosome XVI. Finally, c2 has a fragment from chromosome XIII. In each case more than one open reading frame was present on the insert. In this article we describe identification and further analysis of the genes responsible for suppression by c15 and c4.

We have subcloned fragments of c4 and c15 into pRS426 and transformed the resulting constructs into swi6-406 or swi6-405 to determine which of the open reading frames encode suppressors. The results of mapping and subcloning are summarized in Figure 1. Previously identified genes, MSN1 and NHP6A, were responsible for the suppression phenotypes of c4 and c15, respectively. MSN1 was originally cloned as a high copy suppressor of a temperature-sensitive SNF1 kinase mutant for its ability to restore SUC2 expression (ESTRUCH and CARLSON 1990 ). It acts as a transcriptional activator when fused to LexA and does not have any specific DNA-binding activity (ESTRUCH and CARLSON 1990 ). NHP6A has also been identified previously (KOLODRUBETZ and BURGUM 1990 ) and encodes an HMG1-like small protein, which binds DNA nonspecifically, and is capable of bending DNA (PAULL and JOHNSON 1995 ).

MSN1 and NHP6A suppress the HO transcription defect of SWI6 ANK mutants:
Since NHP6A (c15) was incapable of bypassing Swi6 function, we sought to determine if NHP6A suppression was specific to the swi6-405 allele of SWI6. The NHP6A gene on pRS426 was transformed into strains with different mutant alleles of SWI6, and X-gal filter assays were performed. All these mutants express Swi6 at nonpermissive temperature (37°; EWASKOW et al. 1998 ; and data not shown). swi6-21 encodes a nonconditional and highly defective Swi6 protein (SIDOROVA and BREEDEN 1993 ). As seen in Table 2, the temperature-sensitive ho::lacZ expression phenotype of many of the ANK mutants, including swi6-406, could be suppressed by elevated levels of NHP6A. The one exception was swi6-401, which is the most defective mutant of the set tested. In addition, NHP6A could not suppress the ho::lacZ expression defect of swi6-21, which carries a deletion of the putative leucine zipper in SWI6. Thus, NHP6A displays allele-specific suppression. It enhances transcription by some temperature-labile Swi6 proteins and has no detectable suppressing activity with others. This could indicate a direct interaction between Nhp6A and Swi6, which is disrupted by only a subset of the Swi6 mutants. However, because Nhp6A suppresses all but the most defective alleles of SWI6, this could also be explained if there is a threshold for detection of suppression and some mutants fall below this threshold.

ß-Galactosidase assays show that suppression by the 2µ plasmid-borne NHP6A or MSN1 of the ho::lacZ expression defect in swi6-405 or swi6-406 cells at 37° is low but well above background. For example, ß-galactosidase activities for swi6-406 transformed with MSN1 (pM-2) or NHP6A (pN-5) are 22 and 15 units, respectively, compared to 5 units for the vector-transformed control. To see if this increased expression occurred at the transcription level, we analyzed levels of ho::lacZ mRNA in these strains by S1 protection. Both at 25 and 30°, the ho::lacZ mRNA level was noticeably higher in the swi6-405 and swi6-406 strains transformed with high copy NHP6A and MSN1 plasmids, respectively, as compared to the same strains carrying the vector alone (Figure 2B and Figure C). At 37°, ho::lacZ mRNA level in these strains was too low to be reproducibly quantitated by S1 protection even in the presence of suppressors (data not shown). A similar result was obtained when MSN1 plasmid was transformed into swi6-405 (Figure 2D). These data show that both MSN1 and NHP6A exert their function at the mRNA level, rather than by affecting ß-galactosidase stability or activity.

Nhp6A has a close homologue, Nhp6B, which has a set of properties indistinguishable from Nhp6A. The two proteins may have overlapping functions, because only deletion of both genes has a discernible phenotype (COSTIGAN et al. 1994 ). However, NHP6B was not among the suppressors that we isolated. Thus, we tested NHP6B directly for suppression of SWI6 ANK mutations. When expressed from a high copy vector (pDK267), NHP6B also suppresses swi6-405. It is a weaker suppressor than NHP6A (pDK268, Figure 2B), but this difference may be due to the lower levels of NHP6B expression, which could also explain why different NHP6A-expressing plasmids suppress the ho::lacZ mRNA transcription defect to slightly different degrees (Figure 2B).

Swi6-405 and Swi6-406 are maintained at lower levels than the wild-type protein, so one indirect mechanism of suppression by NHP6A and NHP6B could be that of increasing expression of swi6-405, swi6-406, or the SWI4 gene. To test this possibility, we looked at SWI4 transcription in the swi6-405 strains with or without the elevated level of Nhp6A and found no difference in SWI4 mRNA levels (data not shown). We were not able to test if the Swi4 protein levels were affected, because available antibodies do not detect endogenous levels of this protein. However, because Nhp6A and Nhp6B are generally considered to be involved in DNA metabolism rather than in protein stability, the fact that SWI4 transcript levels are not affected by Nhp6A overproduction makes it likely that the protein levels are also unaltered. We also measured the levels of Swi6-405 protein at 37° in cells transformed with vector alone or with NHP6A- or NHP6B-expressing plasmids and found that the mutant Swi6 accumulated to the same level in all strains tested (Figure 2A). Thus, the suppression by Nhp6A or Nhp6B proteins cannot be attributed to the increase in SWI4 or SWI6 expression.

MSN1 and NHP6A are involved in HO transcription:
To determine if MSN1 and NHP6A are normally involved in the transcription of the Swi4/Swi6-regulated promoters, we isolated mRNA from exponentially growing cultures of strains with or without MSN1 or NHP6A and NHP6B gene products and compared the levels of HO and CLN1 transcripts in these strains to the wild-type strain by S1 protection (Figure 3). The msn1 strain expresses about three- to fivefold less HO transcript and the nhp6ab strain shows a twofold drop in HO transcript compared to wild type. Interestingly, there is little or no effect of msn1 on another Swi4/Swi6-regulated promoter, CLN1 (data not shown), but the nhp6ab has a similar twofold effect on CLN1 (Figure 3B and Figure C).

View larger version (22K): [in this window] [in a new window] [Download PPT slide]   Figure 3. HO expression is reduced in msn1 and nhp6ab strains. (A) Five or six S1 protection measurements of the steady-state levels of HO mRNA were made, quantitated, and normalized to the internal control message (SIR3 RNA). In each independent experiment, the wild-type W303-1a strain measurement was equaled to 100% and the measurements obtained for msn1 and nhp6ab strains were calculated as the percentage of the wild type, and then averaged. The error bars show the average deviation of these measurements. (B) The msn1 strain was transformed with vector pRS426 (lane 1) or high copy MSN1 (pM-1) (lane 2), and nhp6ab was transformed with pBD2076 [a pSH144 Guarente vector version with a LEU2 marker (EWASKOW et al. 1998 ; lane 3)] or high copy NHP6A (pN-3) (lane 4). The levels of HO or CLN1 in the resulting strains were measured by S1 protection. SIR3 mRNA serves as internal control. (C) Levels of HO or CLN1 were normalized to the levels of the internal control and plotted. The normalized levels of HO in msn1 strains and HO and CLN1 in nhp6ab strains were set equal to 1 unit and the transcript levels found in the same strains transformed with MSN1- or NHP6A-bearing plasmids are expressed in these units. Black bars represent HO message levels and gray bars correspond to CLN1 message levels.

NHP6A and NHP6B genes can suppress the caffeine sensitivity of the swi6-405 allele:
The NHP6A gene has been implicated as a downstream target of the Slt2/Mpk1 MAP kinase pathway that leads from Pkc1 and is involved in growth control and cell morphogenesis (COSTIGAN et al. 1994 ), in part because overexpression of NHP6A or NHP6B suppresses several Slt2 pathway defects, including the caffeine sensitivity of slt2 mutants. Because swi6 mutants are also sensitive to caffeine (IGUAL et al. 1996 ), we examined whether the SWI6 ANK mutant swi6-405 is sensitive to caffeine, and, if so, whether this defect can be suppressed by overexpression of NHP6A or NHP6B. The swi6-405 strain cannot grow at 37° on plates containing 4.5 mM caffeine, whereas the wild-type cells were capable of growing on these plates (data not shown). However, when NHP6A and NHP6B genes expressed from high copy plasmids were transformed into the swi6-405 strain, they restored the ability of these cells to grow on plates containing up to 5.5 mM caffeine (Figure 4A).

View larger version (54K): [in this window] [in a new window] [Download PPT slide]   Figure 4. (A) NHP6A and NHP6B suppress the caffeine sensitivity of the swi6-405 allele. BY1954 swi6-405 strains transformed with the pRS426 vector, pDK267 or pDK268, carrying NHP6B and NHP6A, respectively, were streaked onto YC-ura plates containing 5.0 or 5.5 mM caffeine and allowed to grow for 5–6 days at 37°. (B) Overproduction of Gst-Msn1 or Gst-Nhp6A fusions is toxic to the cells. pBD1905, pBD2061, and pBD2065, expressing Gst, Gst-Msn1, or Gst-Nhp6A from the GAL1-10 promoter, were transformed into a W303-1a strain, grown on selective media plates with glucose and then streaked onto fresh plates with raffinose or galactose as indicated.

Nhp6A probably affects Swi4/Swi6 DNA binding indirectly:
To see whether there is a direct interaction between Nhp6A and Swi6, we immunoprecipitated Swi4 or Swi6 proteins out of wild-type extracts carrying HA-Nhp6A and then immunoblotted with anti-HA antibodies to detect HA-Nhp6A. Despite the fact that this HA-tagged Nhp6A is functional and can suppress the swi6-405 transcription defect (Figure 2B), there was no indication that HA-Nhp6A coprecipitates either with Swi4 or Swi6 under the same conditions that we use to detect Swi4/Swi6 association (SIDOROVA and BREEDEN 1993 ).

We then prepared fusions of Nhp6A and Msn1 proteins with Gst. The GST-NHP6A and GST-MSN1 fusions were put under the control of GAL1-10 promoter and expressed in a wild-type strain. When plated under conditions which select for the plasmid and cause overexpression of the fusion, neither one of these strains was able to form colonies (Figure 4B), indicating that overexpression of either Msn1 or Nhp6A as Gst fusions is lethal. Liquid cultures of the same strains were grown in raffinose and then incubated with galactose for up to 8 hr. FACS profiles of these cultures did not show accumulation of cells in any single compartment of the cell cycle; thus overproduction of Gst-Msn1 or Gst-Nhp6A did not lead to a specific cell cycle arrest (data not shown).

Because of their toxicity, we purified these Gst fusions from cells grown in raffinose and then induced by galactose addition for only 3–4 hr. Though we could purify the fusion proteins from these cells under low-stringency conditions, there was no detectable Swi6 copurifying with either of them, as we judged by probing the fusion protein isolates with Swi6 antibodies on Western blots. We also purified these Gst fusion proteins from E. coli on glutathione beads and then incubated the fusion-bound beads with recombinant Swi6 (SIDOROVA and BREEDEN 1993 ) or in vitro-translated Swi4/Swi6 complex (EWASKOW et al. 1998 ). Even under these conditions, we could not detect interaction between Swi4, Swi6 on one side and the fusion proteins on the other (data not shown).

Nhp6A may not directly associate with Swi6, yet it could facilitate the binding of the Swi4/Swi6 complex to SCBs by inducing a favorable bend in DNA. Thus, we tested the involvement of Nhp6A in the Swi6 complex formation on DNA. Band shift analysis was carried out with Swi4/Swi6 complexes obtained by in vitro translation of Swi4 in the presence of recombinant Swi6. These complexes appeared to be identical to the complex observed in whole cell extracts, in that they migrated with the same mobility, contained both Swi4 and Swi6 proteins, as judged by their supershifting by Swi4 and Swi6 antibodies, and were specific to SCB elements of the HO promoter fragment (Figure 5A and data not shown). The purified Gst-Nhp6A fusion was first tested in gel retardation assays with the HO promoter fragment. The Gst-Nhp6A fusion, but not Gst alone, was able to nonspecifically bind DNA (Figure 5B, lane 8). We also cleaved the Gst moiety off the Gst-Nhp6A fusion with thrombin and tested the released Nhp6A in gel retardation assays. As anticipated, thrombin cleavage of Gst-Nhp6A released a DNA-binding component that forms a much smaller complex on DNA (Figure 5B, lane 15). However, both Gst-Nhp6A and Nhp6A were able to bind DNA and both could form a series of bandshifts indicating that multiple Nhp6A molecules bound simultaneously to one DNA molecule. Next, the in vitro-translated Swi4/Swi6 complex was mixed together with varying amounts of Gst-Nhp6A or Nhp6A and was added to the HO promoter fragment (Figure 5B, lanes 5–7 and 12–14). These reactions were compared to the ones in which Swi4/Swi6 complex was mixed with Gst only (lanes 1–3), thrombin cleavage mixture only (lanes 9–11), and Gst-Nhp6A or Nhp6A mixed with the rabbit reticulocyte lysate (lanes 8 and 15). The amount of the DNA-bound Swi4/Swi6 complex was unaffected by the addition of Gst-Nhp6A (compare lanes 1–3 with 5–7) and slightly reduced upon the addition of Nhp6A (compare lanes 9–11 and 12–14). These results indicate that there is no cooperation between Nhp6A and Swi4/Swi6 in binding to DNA under the conditions of this assay. It is also worth noting that there appeared to be a negative effect on the amount of DNA-bound Gst-Nhp6A and Nhp6A if the Swi4/Swi6 complex was present in the reaction (compare lanes 7 to 8 and 14 to 15). Because the HO DNA was in excess in the reaction, and the Swi4/Swi6 complex was at subsaturating level, this cannot be attributed simply to competition for binding sites.

View larger version (46K): [in this window] [in a new window] [Download PPT slide]   Figure 5. Nhp6A does not cooperate with the Swi4/Swi6 complex in binding to the HO promoter. (A) An in vitro-translated Swi4/Swi6 complex was mixed with the labeled HO promoter DNA, and gel retardation analysis was performed. Lanes 2–4 show the in vitro-generated Swi4/Swi6 complex bound to the DNA (translation in vitro). In lanes 3 and 4, 2 and 5 ml of affinity-purified Swi6 (AP6) and Swi4 (AP4) antibodies, respectively, were added to the DNA-binding reactions. Lane 1 shows the Swi4/Swi6 complex generated on the HO promoter by wild-type yeast extract. (B) A gel retardation experiment performed with mixtures of purified Nhp6A and the in vitro-produced Swi4/Swi6 complex. Two exposures of one gel are shown together to follow both the abundant Nhp6A complexes and the less abundant Swi4/Swi6 complex. The reagents added are listed on the left. Plus indicates additions of either the rabbit reticulocyte lysate-translated Swi4 and recombinant Swi6 (Swi4/Swi6) or the unprogrammed lysate (RR lysate). For this experiment Gst-Nhp6A and Gst were purified from E. coli as indicated in MATERIALS AND METHODS. Nhp6A or a mock preparation of it was obtained by thrombin cleavage of Gst-Nhp6A or Gst immobilized on glutathione beads (see MATERIALS AND METHODS). Numbers designate the microliter amounts of purified Gst-Nhp6A, Gst, Nhp6A, or mock preparation added to the reactions. These proteins were added to the DNA-binding reactions together with reticulocyte lysate mixtures and incubated as described in MATERIALS AND METHODS. Brackets on the right show the positions of the DNA-bound Nhp6A and Gst-Nhp6A complexes and the bracket on the left shows the position of the Swi4/Swi6 complex.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

In this article we describe a screen for genes that are able to suppress ANK defects of Swi6 when expressed at high copy levels. Two of these genes, MSN1 and NHP6A, were further characterized. Both NHP6A and MSN1 are weak suppressors of swi6 ANK mutant alleles. Both of the gene products are required for maximal expression of HO, as mutations in these genes lead to a two- and threefold drop in HO mRNA levels, respectively. However, neither protein appears to directly associate with Swi6.

MSN1 (also named FUP1, PHD2, MSS10) has been isolated multiple times as a gene which, when overproduced, improves iron uptake (EIDE and GUARENTE 1992 ), enhances pseudohyphal growth (GIMENO and FINK 1994 ) at least in part through activation of the MUC1 gene (LAMBRECHTS et al. 1996A ), ectopically activates FUS1 transcription (RAMER et al. 1992 ), and derepresses glucoamylase genes (LAMBRECHTS et al. 1996B ). In all of the screens where they could be measured, including ours, increased levels of MSN1 led to activation of gene expression. It is therefore likely that Msn1 is an activator protein. Consistent with this, ESTRUCH and CARLSON 1990 have shown that, when fused to LexA, Msn1 functions as a transcriptional activator. Msn1 does not have strong DNA-binding activity of its own, suggesting that it may bind to the protein component of transcription complexes. The spectrum of action of MSN1 seems to be rather broad and now includes HO, FUS1, SUC2, MUC1, and STA1-3 genes. The fact that Gst-Msn1 overexpression is toxic to cells suggests that MSN1 may have other targets that are critical for growth and viability, and their deregulation is deleterious for the cells. Alternatively, Gst-Msn1 could titrate out essential components of transcriptional apparatus or interfere with chromosome mechanics.

Interestingly, PHD1, a gene coding for a protein with homology to Swi4, was isolated in the same screen for enhancers of pseudohyphal growth in which MSN1 was identified (as PHD2) (GIMENO and FINK 1994 ). It is plausible that Phd1 and Msn1 may cooperate in activation of genes required for pseudohyphae formation in a manner similar to the way Msn1 and Swi4 cooperate to activate HO. The fact that the Msn1-mediated enhancement of ho::lacZ transcription absolutely requires Swi4 is consistent with this possibility. However, this cooperation is unlikely to be mediated through stable interaction with Swi4/Swi6 complexes because Msn1 suppression of HO transcription can occur in the absence of Swi6 and does not occur at a second Swi4/Swi6-regulated gene, CLN1. In addition, we cannot detect physical association between Msn1 and either Swi4 or Swi6. Perhaps it is more likely that Msn1 activates transcription through other site(s) within the HO promoter, or it may assist the basic transcriptional machinery as a cofactor. Alternatively, it may facilitate formation of an active chromatin configuration within the HO promoter.

A different picture emerges in the case of NHP6A (KOLODRUBETZ and BURGUM 1990 ), which is the other suppressor of SWI6 mutations that we have characterized. Nhp6A and its close homologue Nhp6B bear homology to the higher eukaryotic HMG1 protein family, which has been implicated in DNA replication and transcription (BUTLER et al. 1985 ; TREMETNICK and MOLLOY 1988 ; SINGH and DIXON 1990 ; GE and ROEDER 1994 ; STELZER et al. 1994 ; SHYKIND et al. 1995 ). In vitro, Nhp6A and Nhp6B have been shown to bind DNA nonspecifically but with relatively high affinity. The proteins wrap DNA in a way that introduces negative supercoils (PAULL and JOHNSON 1995 ). Recently Nhp6A and Nhp6B were shown to be required for inducible transcription of several messenger RNAs in vivo, and to facilitate formation of Tbp complexes with the TATA regions of promoters in vitro (PAULL et al. 1996 ). Our results indicate that the two Swi4/Swi6-regulated promoters, HO and CLN1, are also influenced by Nhp6A and Nhp6B proteins. Elevated levels of Nhp6A or Nhp6B increase ho::lacZ transcription in strains carrying defective but not null alleles of SWI6. Moreover, strains deleted for both NHP6A and NHP6B have low HO and CLN1 mRNA levels that can be rescued by transformation of NHP6A on a high copy plasmid into these strains. This suggests that Nhp6A may cooperate with Swi4/Swi6 in transcriptional activation. However, if this is the case, the interaction is probably unstable because we have not been able to demonstrate any association between Nhp6A and Swi6, nor have we been able to detect any positive effect of Nhp6A upon the ability of the Swi4/Swi6 complex to bind DNA in vitro. It is equally plausible that NHP6A and NHP6B affect transcription indirectly by increasing expression of an unidentified protein that enhances Swi4/Swi6 activity or that NHP6A and NHP6B affect the chromatin conformation of the promoters. Such an activity would be undetectable in vitro with bandshift assays, which use naked DNA.

Massive overproduction of Nhp6A is deleterious to the cell (ESPINET et al. 1995 and data not shown), but does not lead to the cell cycle stage-specific arrest. The DNA-binding function of this Gst-Nhp6A fusion is intact, so its toxicity may be attributed to increased binding to genomic DNA, which might cause general inhibition or inappropriate activation of transcription. Recently the NHP6A gene was isolated as a high copy suppressor of slk1(bck1) defects and implicated as a downstream component of the Slt2/Mpk1 MAP kinase pathway that leads from Pkc1 and is involved in growth control and cell morphogenesis (COSTIGAN et al. 1994 ). nhp6AB deletion strains were shown to share many phenotypes with pkc1, slk1(bck1) and slt2(mpk1) deletion strains. The exact function of Nhp6 proteins in the Slt2 pathway has not been elucidated, but it has been proposed that they participate in Slt2-responsive transcription. We have found that Nhp6A and Nhp6B affect expression of HO and CLN1, which are controlled by the Swi4/Swi6 complex. This complex has also been implicated in transcriptional regulation of some of the Slt2-responsive genes (IGUAL et al. 1996 ). Moreover, Swi6 can be phosphorylated by Slt2 in vitro, and its phosphorylation state correlates with Slt2 activity in vivo (MADDEN et al. 1997 ). Consistent with this, swi6 deletion strains have been shown to be more sensitive to caffeine than wild type, and they share this phenotype with slt2 mutants (IGUAL et al. 1996 ). We have found that the swi6-405 mutant is also sensitive to caffeine and that this phenotype can be suppressed by Nhp6A or Nhp6B expressed from a high copy plasmid (Figure 4A). All these findings are consistent with the notion that Nhp6A and Nhp6B proteins may be utilized in a similar fashion both at "classic" Swi4/Swi6-dependent promoters, HO and CLN1, as well as at the promoters that may be both Slt2 dependent and Swi4/Swi6 dependent.

	ACKNOWLEDGMENTS

We thank members of the lab for support and helpful discussions. Special thanks are due to Glen Mikesell for technical assistance, and to Marian Carlson, Michael Snyder, and David Kolodrubetz for providing strains and plasmids, as well as advice and encouragement. This work was supported by grants GM-41073 from the National Institute of General Medical Sciences and DAMND17-94-J-4122 from the Army Breast Cancer Initiative. J.S. was supported by a fellowship from the Leukemia Research Foundation.

Manuscript received June 22, 1998; Accepted for publication September 23, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ANDREWS, B. J. and I. HERSKOWITZ, 1989  The yeast SWI4 protein contains a motif present in developmental regulators and is part of a complex involved in cell-cycle-dependent transcription. Nature 342:830-833[Medline].

ANDREWS, B. J. and L. MOORE, 1992a  Mutational analysis of a DNA sequence involved in linking gene expression to the cell cycle. Biochem Cell Biol. 70:1073-1080[Medline].

ANDREWS, B. J. and L. A. MOORE, 1992b  Interaction of the yeast Swi4 and Swi6 cell cycle regulatory proteins in vitro.. Proc. Natl. Acad. Sci. USA 89:11852-11856[Abstract/Free Full Text].

BORK, P., 1993  Hundreds of ankyrin-like repeats in functionally diverse proteins: mobile modules that cross phyla horizontally. Proteins Struct. Funct. Genet. 17:363-374[Medline].

BREEDEN, L., 1996 Start-specific transcription in yeast, pp. 95–127 in Current Topics in Microbiology and Immunology, Vol. 208, edited by P. J. FARNHAM. Springer-Verlag, Berlin.

BREEDEN, L. and G. MIKESELL, 1991  Cell cycle-specific expression of the SWI4 transcription factor is required for the cell cycle regulation of HO transcription. Genes Dev. 5:1183-1190[Abstract/Free Full Text].

BREEDEN, L. and K. NASMYTH, 1985  Regulation of the yeast HO gene. Cold Spring Harbor Symp. Quant. Biol. 50:643-650[Medline].

BUTLER, A. P., J. K. MARDIAN, and D. E. OLINS, 1985  Nonhistone chromosomal protein HMG 1 interactions with DNA. Fluorescence and thermal denaturation studies. J. Biol. Chem. 260:10613-10620[Abstract/Free Full Text].

CARLSON, M. and G. BOTSTEIN, 1982  Two differentially regulated mRNAs with different 5' ends encode secreted with intracellular forms of yeast invertase. Cell 28:145-154[Medline].

COSTIGAN, C., D. KOLODRUBETZ, and M. SNYDER, 1994  NHP6A and NHP6B, which encode HMG1-like proteins, are candidates for downstream components of the yeast SLT2 mitogen-activated protein kinase pathway. Mol. Cell. Biol. 14:2391-2403[Abstract/Free Full Text].

DIRICK, L., T. MOLL, H. AUER, and K. NASMYTH, 1992  A central role for SWI6 in modulating cell cycle Start-specific transcription in yeast. Nature 357:508-513[Medline].

EIDE, D. and L. GUARENTE, 1992  Increased dosage of a transcriptional activator gene enhances iron-limited growth of Saccharomyces cerevisiae. J. Gen. Microbiol. 138:347-354[Medline].

ESPINET, C., M. A. D. L. TOORE, M. ALDEA, and E. HERRERO, 1995  An efficient method to isolate yeast genes causing overexpression-mediated growth arrest. Yeast 11:25-32[Medline].

ESTRUCH, F. and M. CARLSON, 1990  Increased dosage of the MSN1 gene restores invertase expression in yeast mutants defective in the SNF1 protein kinase. Nucleic Acids Res. 18:6959-6964[Abstract/Free Full Text].

EWASKOW, S. P., J. M. SIDOROVA, J. HENDLE, J. C. EMERY, and D. E. LYCAN et al., 1998  Mutation and modeling analysis of the Saccharomyces cerevisiae Swi6 ankyrin repeats. Biochemistry 37:4437-4450[Medline].

GE, H. and R. G. ROEDER, 1994  The high mobility group protein HMG1 can reversibly inhibit class II gene transcription by interaction with the TATA-binding protein. J. Biol. Chem. 269:17136-17140[Abstract/Free Full Text].

GIMENO, C. J. and G. R. FINK, 1994  Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development. Mol. Cell. Biol. 14:2100-2112[Abstract/Free Full Text].

HEICHMAN, K. A. and J. M. ROBERTS, 1996  The Yeast CDC16 and CDC27 genes restrict DNA replication to once per cell cycle. Cell 85:39-48[Medline].

HENKEL, T., U. ZEBEL, K. VAN ZEE, J. M. MULLER, and E. FANNING et al., 1992  Intramolecular masking of the nuclear location signal and dimerization domain in the precursor for the p50 NF kappa B subunit. Cell 68:1121-1133[Medline].

IGUAL, J. C., A. L. JOHNSON, and L. H. JOHNSTON, 1996  Coordinated regulation of gene expression by the cell cycle transcription factor SWI4 and the protein kinase C MAP kinase pathway for yeast cell integrity. EMBO J. 15:5001-5013[Medline].

KOCH, C., T. MOLL, M. NEUBERG, H. AHORN, and K. NASMYTH, 1993  A role for the transcription factors Mbp1 and Swi4 in progression from G1 to S phase. Science 261:1551-1557[Abstract/Free Full Text].

KOLODRUBETZ, D. and A. BURGUM, 1990  Duplicated NHP6 genes of Saccharomyces cerevisiae encode proteins homologous to bovine high mobility group protein 1. J. Biol. Chem. 265:3234-3239[Abstract/Free Full Text].

LAMBERT, S. and V. BENNETT, 1993  From anemia to cerebellar dysfunction. A review of the ankyrin gene family. Eur. J. Biochem. 211:1-6[Medline].

LAMBRECHTS, M. G., F. F. BAUER, J. MARMUR, and I. S. PRETORIUS, 1996a  Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast. Proc. Natl. Acad. Sci. USA 93:8419-8424[Abstract/Free Full Text].

LAMBRECHTS, M. G., P. SOLLITTI, J. MARMUR, and I. S. PRETORIUS, 1996b  A multicopy suppressor gene, MSS10, restores STA2 expression in Saccharomyces cerevisiae strains containing the STA10 repressor gene. Curr. Genet. 29:523-529[Medline].

LOWNDES, N. F., A. L. JOHNSON, and L. H. JOHNSTON, 1991  Coordination of expression of DNA synthesis genes in budding yeast by a cell cycle regulated trans factor. Nature 350:247-248[Medline].

LOWNDES, N. F., A. L. JOHNSON, L. BREEDEN, and L. H. JOHNSTON, 1992  SWI6 protein is required for transcription of the periodically expressed DNA synthesis genes in budding yeast. Nature 357:505-508[Medline].

MADDEN, K., Y. J. SHEU, K. BAETZ, B. ANDREWS, and M. SNYDER, 1997  SBF cell cycle regulator as a target of the yeast PKC-MAP kinase pathway. Science 275:1781-1784[Abstract/Free Full Text].

MCINTOSH, E. M., R. W. ORD, and R. K. STORMS, 1988  Transcriptional regulation of the cell cycle-dependent thymidylate synthase gene of Saccharomyces cerevisiae.. Mol. Cell. Biol. 8:4616-4624[Abstract/Free Full Text].

MCINTOSH, E. M., T. ATKINSON, R. K. STORMS, and M. SMITH, 1991  Characterization of a short, cis-acting DNA sequence which conveys cell cycle stage-dependent transcription in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:329-337[Abstract/Free Full Text].

MEASDAY, V., L. MOORE, J. OGAS, M. TYERS, and B. ANDREWS, 1994  The PCL2 (ORFD)-PHO85 cyclin-dependent kinase complex: a cell cycle regulator in yeast. Science 266:1391-1395[Abstract/Free Full Text].

NASMYTH, K. and L. DIRICK, 1991  The role of SWI4 and SWI6 in the activity of G1 cyclins in yeast. Cell 66:995-1013[Medline].

OGAS, J., B. J. ANDREWS, and I. HERSKOWITZ, 1991  Transcriptional activation of CLN1, CLN2, and a putative new G1 cyclin (HCS26) by SWI4, a positive regulator of G1-specific transcription. Cell 66:1015-1026[Medline].

PARTRIDGE, J. F., G. E. MIKESELL, and L. L. BREEDEN, 1997  Cell cycle-dependent transcription of CLN1 involves Swi4 binding to MCB-like elements. J. Biol. Chem. 272:9071-9077[Abstract/Free Full Text].

PAULL, T. T. and R. C. JOHNSON, 1995  DNA looping by Saccharomyces cerevisiae high mobility group proteins NHP6A/B. Consequences for nucleoprotein complex assembly and chromatin condensation. J. Biol. Chem. 270:8744-8754[Abstract/Free Full Text].

PAULL, T. T., M. CAREY, and R. C. JOHNSON, 1996  Yeast HMG proteins NHP6A/B potentiate promoter-specific transcriptional activation in vivo and assembly of preinitation complexes in vitro.. Genes Dev. 10:2769-2781[Abstract/Free Full Text].

PRIMIG, M., S. SOCKANATHAN, H. AUER, and K. NASMYTH, 1992  Anatomy of a transcription factor important for the Start of the cell cycle in Saccharomyces cerevisiae.. Nature 358:593-597[Medline].

RAMER, S. W., S. J. ELLEDGE, and R. W. DAVIS, 1992  Dominant genetics using a yeast genomic library under the control of a strong inducible promoter. Proc. Natl. Acad. Sci. USA 89:11589-11593[Abstract/Free Full Text].

SCHNEIDER, K. R., R. L. SMITH, and E. K. O'SHEA, 1994  Phosphate-regulated inactivation of the kinase PH080-PH085 by the CDK inhibitor PH081. Science 266:122-126[Abstract/Free Full Text].

SHYKIND, B. M., J. KIM, and P. A. SHARP, 1995  Activation of the TFIID-TFIIA complex with HMG-2. Genes Dev. 9:1354-1365[Abstract/Free Full Text].

SIDOROVA, J. and L. BREEDEN, 1993  Analysis of the SWI4/SWI6 protein complex, which directs G₁/S-specific transcription in Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:1069-1077[Abstract/Free Full Text].

SIDOROVA, J., G. MIKESELL, and L. BREEDEN, 1995  Cell cycle regulated phosphorylation of Swi6 controls its nuclear localization. Mol. Biol. Cell 6:1641-1658[Abstract].

SINGH, J. and G. H. DIXON, 1990  High mobility group proteins 1 and 2 function as general class II transcription factors. Biochemistry 29:6295-6302[Medline].

STELZER, G., A. GOPPELT, F. LOTTSPEICH, and M. MEISTERERNST, 1994  Repression of basal transcription by HMG2 is counteracted by TFIIH-associated factors in an ATP-dependent process. Mol. Cell. Biol. 17:4712-4721.

THOMPSON, C. C., T. A. BROWN, and S. L. MCKNIGHT, 1991  Convergence of Ets- and Notch-related structural motifs in a heteromeric DNA binding complex. Science 253:762-768[Abstract/Free Full Text].

TREMETNICK, D. J. and P. L. MOLLOY, 1988  Effects of high mobility group proteins 1 and 2 on initiation and elongation of specific transcription by RNA polymerase II in vitro.. Nucleic Acids Res. 16:11107-11127[Abstract/Free Full Text].

This article has been cited by other articles:

				R. R. Barrales, J. Jimenez, and J. I. Ibeas Identification of Novel Activation Mechanisms for FLO11 Regulation in Saccharomyces cerevisiae Genetics, January 1, 2008; 178(1): 145 - 156. [Abstract] [Full Text] [PDF]

				K. Flick and C. Wittenberg Multiple Pathways for Suppression of Mutants Affecting G1-Specific Transcription in Saccharomyces cerevisiae Genetics, January 1, 2005; 169(1): 37 - 49. [Abstract] [Full Text] [PDF]

				D. van Dyk, I. S. Pretorius, and F. F. Bauer Mss11p Is a Central Element of the Regulatory Network That Controls FLO11 Expression and Invasive Growth in Saccharomyces cerevisiae Genetics, January 1, 2005; 169(1): 91 - 106. [Abstract] [Full Text] [PDF]

				N. K. Brewster, G. C. Johnston, and R. A. Singer A Bipartite Yeast SSRP1 Analog Comprised of Pob3 and Nhp6 Proteins Modulates Transcription Mol. Cell. Biol., May 15, 2001; 21(10): 3491 - 3502. [Abstract] [Full Text]

				Y. Yu, P. Eriksson, and D. J. Stillman Architectural Transcription Factors and the SAGA Complex Function in Parallel Pathways To Activate Transcription Mol. Cell. Biol., April 1, 2000; 20(7): 2350 - 2357. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sidorova, J. Articles by Breeden, L.