- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lisch, D.
- Articles by Freeling, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lisch, D.
- Articles by Freeling, M.
Functional Analysis of Deletion Derivatives of the Maize Transposon MuDR Delineates Roles for the MURA and MURB Proteins
Damon Lisch1,a, Lisa Girarda, Maureen Donlin2,a, and Michael Freelingaa Department of Plant Biology, University of California, Berkeley, California 94620
Corresponding author: Damon Lisch, Department of Plant Sciences, 303 Forbes Hall, University of Arizona, Tucson, AZ 85721., dlisch{at}ag.arizona.edu (E-mail)
Communicating editor: J. A. BIRCHLER
| ABSTRACT |
|---|
The regulatory transposon of the Mutator system of transposable elements in maize is MuDR. MuDR elements produce two transcripts, from genes mudrA and mudrB, encoding proteins MURA and MURB, respectively. Like many other transposons, MuDR elements often undergo deletions, usually of internal sequences. Analysis of a deletion that is restricted to the region encoding MURB demonstrates that this gene is not required to cause excisions of a reporter element, although it may be required for transposition or suppression of suppressible alleles. Conversely, a derivative that lacks the region encoding MURA but that produces MURB is nonfunctional for all aspects of Mutator activity. Northern analysis of these derivatives reveals that each of the two transcripts can be independently transcribed, and analysis using an antibody specific for MURB reveals that mudrB transcript can also be successfully translated and its product appropriately localized in the absence of mudrA. A third deletion derivative provides evidence for a source of previously reported antisense transcript.
TRANSPOSABLE elements were first identified because of their propensity to introduce variation into the genomes of their hosts. It has become clear from a large number of studies (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In some cases, the altered structure of transposable elements in turn can lead to new kinds of regulation. In the best-studied example of this kind of regulatory evolution, some of the derivatives of P elements exhibit a negative effect on the activity of full-length P elements (![]()
![]()
![]()
![]()
![]()
![]()
With respect to the generation of diversity, the Mutator system of transposable elements in maize is of particular interest. The Mutator system is a diverse family of transposable elements in maize that was originally identified in a line of maize with an exceptionally high mutation rate (![]()
![]()
![]()
![]()
The regulatory transposon for the entire system is a member of the MuDR class of elements (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The Mutator system is the most mutagenic of the known plant transposable element systems; the high frequency of duplicative transposition of multiple elements in an active Mutator maize stock can result in mutation frequencies 50 times that of background (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Analysis of the structure of a number of deletion derivatives of MuDR elements has revealed that the junctions of these derivatives are consistent with a double-stranded gap repair mechanism (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Here we describe the structure, expression characteristics, and behavior of three deletion derivatives of MuDR-1, the single MuDR element resident in our low copy minimal Mutator line. This line is exceptional in that it carries a single functional MuDR element (MuDR-1) or derivatives of that element, making it possible to examine the expression characteristics and functions of individual deletion derivatives in relative isolation.
| MATERIALS AND METHODS |
|---|
Maize lines:
The a1-mum2 allele was originally isolated by D. S. Robertson and the line containing a1-mum2 in this study was obtained from S. Dellaporta. The a1-mum2 allele, which has a Mu1 insertion in the promoter of the a1 gene, is Mu-suppressible (![]()
Nucleic acid samples:
Maize DNA from leaves of 2-wk-old seedlings was purified according to ![]()
![]()
DNA and RNA gel blot hybridizations:
DNA hybridizations were performed as described in ![]()
Reverse transcriptase-based PCR amplification:
For the RT-PCR experiment, ~10 µg of RNA from various samples was incubated with 1 unit of DNaseI and 5.6 units of RNase inhibitor for 30 min at 37°. Following DNaseI digestion the samples were extracted once with phenol/chloroform, precipitated in 2-propanol, and then resuspended in water to a concentration of ~1 mg/ml. The resulting RNA solution (2 µg) was added to a reaction containing reverse transcriptase buffer, 10 mM DTT, primer 8f at a concentration of 0.5 mg/ml, dTTP, dATP, dCTP, and dGTP each at a concentration of 10 mM, and 2.8 units of RNase inhibitor to a total volume of 20 µl. This mix was incubated for 10 min at 70°, then put on ice for 5 min. Reverse transcriptase (2 units) was then added, and the reaction was incubated for 2 hr at 37°. The volume was then adjusted to 100 µl using water, and 5 µl of this mixture was used in a PCR reaction using primers 7f and 1r.
PCR primers and amplification conditions:
The PCR primers for cDNA synthesis, PCR amplification, and sequencing included the following sequences: 1r = CTCTGCTCCTGTGCGGATGGATTGTCC; 4r = CTGTTTTCTGTGTTGTTGAG; 7f = CACCACAAAAAATTGGATCCC; 8f = CACCAATAGCTAGAAGAGGTC.
PCR reactions were performed using ~50 ng of genomic DNA or cDNA. The final concentrations of reagents in the 50-µl reactions were as follows: 200 mM dNTP, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), and 0.4 mM of each primer. Amplification of genomic and cDNA sequences used the following conditions: melting, 94° for 1 min; annealing, 50° for 1 min; extension, 72° for 2 min. Samples were subjected to 35 cycles of amplification.
DNA sequencing and analysis:
Gel-isolated RT-PCR products were purified using the QIAquick Gel Extraction Kit (QIAGEN Inc., Chatsworth, CA) after gel electrophoresis, and the resulting DNA was used for direct sequencing. DNA samples were sequenced at the DNA sequencing facility at the University of California at Berkeley using the double-stranded dye termination technique on an ABI sequencer (Applied Biosystems, Foster City, CA). Sequencing of the derivative d202 was performed using PCR primers 7f, 1r, and 4r as primers in the sequencing reactions.
Immunoblot and immunolocalizations:
Immunoblot and immunocalizations were performed as described in ![]()
| RESULTS |
|---|
MURB alone is not sufficient to cause excisions or suppression of a suppressible allele:
Restriction mapping revealed that derivative MuDR-d112 (d112) carries only the sequences encoding mudrB (Figure 1). This derivative lacked an internal SacI fragment, consistent with the lack of one terminal inverted repeat. An EcoRI digest probed with a 5' flanking probe (not shown) demonstrated that the EcoRI site is present in this derivative. The derivative lacked the 5' XbaI site as well as both of the BamHI and HindIII sites. On the basis of the position of those sites in the flanking region outside of the element (not shown), we conclude that the deletion extends through one TIR to a point between the second BamHI site (which is missing in the derivative) and the 3' XbaI site (which is present). As expected on the basis of the restriction map, the derivative fails to hybridize to probe H/H (data not shown), consistent with the lack of this internal fragment. On the basis of these results, we conclude that derivative d112 carries a deletion that includes nearly all of the region encoding mudrA as well as one of the two TIRs and ~1.5 kbp of flanking sequence (Figure 1). On the basis of restriction mapping data as well as Northern blot analysis (below) we conclude that this deletion does not extend into the region of MuDR encoding mudrB. Derivative d112 is at the same chromosomal position as the full-length element first cloned on chromosome 2L (![]()
|
Northern analysis reveals that only the mudrB transcript is expressed at detectable levels in individuals carrying this derivative (Figure 2). Immunolocalization also reveals that MURB is successfully translated and localized to the nucleus in the absence of MURA (Figure 3). Further, MURB is most prevalent in actively dividing cells, a pattern of localization that is very similar to that observed previously when this protein was produced from a full-length element (![]()
|
|
Individuals that carry derivative d112 show no signs of Mutator activity. Kernels carrying a1-mum2 and this derivative do not exhibit excisions, and plants grown from these kernels are red, consistent with the lack of suppression of a1-mum2. On the basis of these observations we conclude that although it can be transcribed, translated, and translocated in the absence of MURA, MURB by itself is not associated with these aspects of Mutator activity.
MURA alone is sufficient to cause excision of a reporter element:
Derivative d201 lacks a large portion of the gene encoding MURB. This derivative contains a deletion of 500 bp of the 861 bp between the EcoRI site and the 3' EcoRII site in MuDR (Figure 1). Since the element lacks the 3' XbaI site, we conclude that the deletion must remove nucleotides encoding at least 54 amino acid residues from the carboxy-terminal portion of MURB as well as nearly all of the 3' untranslated portion of the mudrB transcript and, at least potentially, a portion of the intergenic region. Derivative d201 is directly derived from the fully functional element first cloned on chromosome 2L. However, because d201 was derived from a transposed copy of that MuDR element, it is not located at that chromosomal position. Although some kernels display a Mu1 excision frequency comparable to that observed in kernels carrying full-length elements, in most cases, kernels carrying d201 exhibit few or no excisions of a reporter Mu1 element from a1-mum2 (Figure 4). This is also the case for the excision of a Mu7 element from bz-rcy (data not shown).
|
Northern analysis of d201 demonstrates that although the mudrA transcript is present, the mudrB transcript is not detectable, indicating that the deleted region in d201 is required for the production of detectable levels of this transcript (Figure 2). Further, an antibody specific to MURB failed to detect the protein encoded by the small transcript (Figure 5). These data confirm that MURA by itself can cause excisions of a reporter element in the absence of detectable levels of mudrB transcript or MURB protein, demonstrating that MURB is not required for this function. They also demonstrate that production of MURA is not dependent on the presence of MURB.
|
A deletion derivative lacking mudrB is unable to prevent methylation and appears to be unable to transpose:
HinfI sites within the termini of Mu elements are characteristically methylated in the absence of Mutator activity (![]()
|
Despite the sometimes-frequent excisions conditioned by d201, in no case has this element been observed to transpose in the absence of a full-length MuDR-1 element. This was the case even when kernels carrying d201 exhibited a high frequency of excisions of Mu1 from a1-mum2. A total of 45 plants grown from such high excision kernels were test crossed as females to a1-mum2/a1 sh2 testers. In the resulting ears the ratios of highly spotted to weakly spotted kernels were variable and quite similar to like ratios on the ears from which their parents were picked. Further, none of the resulting ears segregated for significantly more than 50% spotted kernels, suggesting that the element had not transposed (data not shown).
Molecular analysis of plants carrying d201 gave a similar result; no transposition of the element was observed. In order to assay for changes in copy number of d201, families segregating for the element were digested with SacI and EcoRI. Duplications of the element were detected as changes in the intensity of the internal 4.2-kbp SacI fragment or in the appearance of unique new EcoRI fragments. In the family portrayed in Figure 7, a family generated from a cross between a plant carrying d201 and an a1-mum2/a1 sh2 tester was subjected to Southern blot analysis. DNA from plants grown from spotted and pale kernels was extracted, digested with SacI, blotted, and probed with Mu*. As expected, all of the plants grown from spotted kernels carried d201. Further, a number of plants grown from nonspotted kernels also carried the element, indicating that d201 is not always able to cause somatic excision of Mu1. DNA from a total of 64 plants carrying d201 was digested with SacI and probed with Mu*. In all cases the 4.2-kbp internal fragment remained at a relative intensity, consistent with the presence of a single copy of the deletion derivative. Further, EcoRI digests of the DNA from 37 of these plants did not reveal the appearance of unique new fragments, consistent with a lack of duplicative transposition of d201. Finally, 84 progeny of individuals carrying d201 and at least one Mu1 element (the one at a1-mum2) that had been crossed to a1-mum2/a1 sh2 testers were examined by Southern blot for the presence of new Mu1 fragments. In no case was Mu1 observed to transpose. In contrast, the full-length MuDR-1 element at position 1 has been observed to duplicate itself and a Mu1 element at a frequency of between 10 and 20%, which was itself an exceptionally low transposition frequency for a MuDR element (![]()
![]()
|
Autonomous transposition of a deletion derivative:
In contrast to all other derivatives examined to date, one deletion derivative, d202, is unique in that it has been observed to transpose autonomously. Like d201, derivative d202, which was initially identified because of its association with very low frequency excisions, can also condition a more typical Mu1 excision frequency (Figure 4). The same was true when this element was combined with bz-mum9, which carries a Mu1 element in the bronze gene (data not shown). Sequence analysis (see below) revealed that this derivative carries a deletion of 174 bp between and including residues 3094 and 3267 (Figure 1).
To determine if d202 could transpose, plants carrying the element were digested with HindIII and SacI. A transposition event would be expected to result in the presence of a new, unique HindIII fragment and an increased intensity of the diagnostic 4.52-kbp SacI fragment. Figure 8 shows a pair of DNA gel blots from individuals carrying d202. The DNA was digested with HindIII (Figure 8A) and with SacI (Figure 8B) and the resulting blot was hybridized to Mu*. The HindIII digests (Figure 8A) revealed the presence of a new MuDR-1-homologous fragment in DNA from one of these plants (indicated). Densitometric analysis of the SacI digests of DNA from that plant revealed that the diagnostic 4.52-kbp fragment exhibited a twofold increase in intensity, consistent with the duplication of d202 in this individual. When this plant was test crossed to an a1 sh2/a1-mum2 tester, ~3/4 (99/120) of the progeny kernels carrying a1-mum2 were spotted, consistent with the independent segregation of two d202 elements.
|
Deletions can result in the production of antisense message:
Northern analysis demonstrated that several transcripts were associated with d202 (Figure 2). Two aberrant transcripts were visible, one 1.2 kbp in length and the other 2.0 kbp. Both aberrant transcripts hybridized to probes from regions encoding each of the two ORFs (Figure 1, probes Mu-Sa and Mu*). Because the two transcripts are produced in opposite directions and from opposite strands, the presence of a 2.0-kbp transcript homologous to regions encoding both genes was consistent with the production of a hybrid transcript containing the sense version of one transcript and the antisense version of the other transcript. To test this hypothesis, reverse transcriptase-based PCR (RT-PCR) was used to specifically amplify the transcript expected to be produced if transcription were initiated from the mudrB promoter and continued through the intergenic region and into sequences normally expected to encode mudrA. This aberrant transcript would be expected to contain sequences identical to the normal mudrB transcript and sequences that are complementary to the 3' end of the normal mudrA transcript.
To specifically amplify antisense product, both RNA and DNA from individuals carrying d202, and from siblings that lacked the derivative, were isolated. RNA and DNA from an individual carrying a full-length copy of MuDR-1 were also isolated. The RNA from each of these samples was digested with DNaseI, and DNA was synthesized from the RNA samples using primer 8f (Figure 1) to direct an initial round of first-strand cDNA synthesis using reverse transcriptase. Because this initial round of DNA synthesis used a primer that was identical to a sequence in the normal mudrA transcript, it would only be expected to result in a product if a transcript complementary to the normal transcript were present. The resulting product was subjected to PCR amplification using a nested primer (primer 7f, Figure 1) identical to a sequence in normal mudrA transcript and a second primer that is complementary to a sequence in the normal mudrB transcript (primer 1r, Figure 1). Controls included individual siblings that lacked the derivative as well as closely related individuals that carried only a full-length MuDR element. Each sample was also amplified either with or without DNaseI digestion.
Given that there are a number of MuDR-homologous sequences in this genetic background, we expected to see some amplification from all DNA samples not subjected to DNaseI digestion. As expected, in those samples a number of fragments resulted from our PCR amplification (Figure 9, lanes 3, 6, 9, and 11). Among these fragments, one was unique to the DNA sample from the individual carrying d202 (lane 3, arrow). This fragment was missing in a sibling lacking the derivative (lane 6) and in a related individual carrying a full-length element (lane 9); its size was that expected for a fragment amplified from the deletion derivative (~1500 bp). The fragment unique to the individual carrying the full-length MuDR-1 element (lane 9, arrow) was of the size (~1700 bp) expected for the amplification of this region from a full-length element.
|
To demonstrate that DNaseI digestion was complete and that our PCR reactions were not simply amplifying residual DNA, we amplified DNA samples that had been subjected to DNaseI digestion but had not undergone a round of cDNA synthesis. No product was amplified from these samples (lanes 2, 5, and 8). Similarly, when the same PCR reactions were performed on independently derived samples of MuDR-1-containing genomic DNA that had also been subjected to DNaseI treatment, no product was amplified (lane 10).
Most importantly, of the RNA samples that had undergone DNaseI digestion, cDNA synthesis, and PCR amplification, only the one from the individual carrying d202 yielded a product (Figure 9, lane 1, arrow). That product was the size predicted if amplification was of the aberrant transcript associated with the deletion derivative.
To more precisely determine the nature of this aberrant transcript, the PCR product produced from the aberrant transcript associated with d202 was partially sequenced. The resulting sequence was identical to that reported for MuDR (![]()
![]()
![]()
This 2.0-kbp aberrant transcript included both the second and the third intron from mudrB, suggesting that neither of these introns is efficiently spliced from the aberrant transcript. In contrast, although the third intron of the normal mudrB transcript is only rarely spliced (<10%) from full-length elements, the second intron is normally spliced with high efficiency (![]()
On the basis of this analysis, it appears that the larger of the two aberrant transcripts associated with d202 contains nucleotide sequences that are identical to the 3' end of mudrA and sequences that are complementary to at least part of mudrB, presumably due to transcription initiating from the promoter associated with mudrB and proceeding past its normal transcriptional stop signals into the region encoding the large transcript. As a consequence of this read-through, d202 produces an antisense mudrA mRNA. This derivative is active by both the excision (Figure 4) and the transposition assays (Figure 8). However, as is apparent in Figure 4, excisions driven by d202 were often less frequent and consistently more variable than those of d202's progenitor, MuDR-1. Finally, in contrast to the results obtained for d201, Mu1 at a1-mum2 is incompletely hypomethylated in the presence of d202, even in DNA from plants grown from heavily spotted kernels (Figure 6). This is most apparent when the plant carrying d202 was homozygous for a1-mum2.
| DISCUSSION |
|---|
Specific deletion derivatives are associated with specific transcripts:
Although a large number of derivatives of MuDR have now been reported (![]()
![]()
![]()
![]()
MURB is not by itself associated with Mutator activity:
Previous work (![]()
![]()
Because d112 is not associated with either excision of Mu1 from a1-mum2 or suppression of this suppressible allele, it does not appear that MURB is sufficient by itself to condition any aspect of Mutator activity. Of course, as we have not sequenced the entire derivative, we cannot say for certain that the small protein associated with d112 is not altered in some subtle way that has destroyed its normal function. However, we note that additional derivatives that carry large deletions in the regions encoding mudrA, but that can produce large quantities of mudrB transcript, are also incapable of causing excisions of reporter elements (D. LISCH, unpublished results; ![]()
![]()
MURA is sufficient to cause excisions of a reporter element:
Deletion derivative d201 is missing a large portion of mudrB. Although it contains a portion of the region encoding mudrB, including the promoter and all of the first exon, at a minimum, it lacks sequences including the third exon, the termination codon, and it may lack sites that are normally polyadenylated (![]()
The observation that d201 is capable of causing excisions of Mu1, sometimes at a frequency approaching that associated with full-length elements (Figure 4), demonstrates that MURB is not required for excision of Mu1 elements. However, although it is capable of conditioning a high frequency of Mu1 excisions, d201 is not associated with a high or even moderate frequency of new insertions. An attractive explanation for this observation is that MURB is required for reinsertion but not excision of Mu elements. Because these data represent a negative result that may reflect only a reduced frequency of these events, it is possible to surmise only that d201 is significantly less efficient than a full-length MuDR-1 element at conditioning new insertions. Further, because d201 is at a new position, we cannot exclude the possibility that position effects are playing a role in the observed variations in the ability of this element to cause excisions of Mu1 (Figure 4).
In connection with our observation that MURA has independent activity, it is interesting to note that although genome database searches using mudrA sequences detect similar sequences in Arabidopsis and rice, there are no known sequences that share significant similarities to mudrB (D. LISCH, unpublished results). As the functional analysis of these sequences has not been performed, it is not known if these represent active elements. However, sequences previously identified as being similar to bacterial transposases are also conserved in the elements from Arabidopsis and rice, as is a conserved zinc finger domain, indicating functional similarities to mudrA (D. LISCH, unpublished results). It may be that mudrA and mudrB evolved independently and that mudrB function is specific in some way to the requirements of the Mutator system in maize. Alternatively, mudrB may have been lost due to internal deletions in these other species, or mudrB sequences simply may have diverged more due to less stringent selection for their preservation. It will be interesting to determine whether or not the elements in these heterologous species have full transpositional activity in the absence of mudrB.
The large variations in Mu1 excision frequency associated with d201 are as yet unexplained. The variation is quite sporadic; it does not segregate in a manner consistent with the presence of a few modifying loci, nor are high-frequency excisions heritable (D. LISCH, unpublished results). Alternatively, it may be that d201 is subject to some degree of epigenetic modification, and that variations in epigenetic modification of the element could explain the observed variations in excision frequency of Mu1. We also cannot exclude the possibility that there are additional factors in our minimal line that modify the activity of d201. We believe this is unlikely, however, given the extremely inbred nature of the line, as well as the absence of evidence for genetic segregation of variations in excision frequency. Regardless of the excision frequency associated with it, d201, like d112, is not associated with suppression of a1-mum2, suggesting that MURB may be necessary but not sufficient for suppression function. Nor is d201 associated with hypomethylation of Mu1 at a1-mum2 (Figure 6), suggesting some role for MURB in that process. Previous work has demonstrated that deletions within mudrA are associated with hypermethylation of Mu1 elements, suggesting that MURB is not sufficient to mediate hypomethylation of nonautonomous elements (![]()
A deletion can result in the production of antisense message:
Our analysis of the transcripts associated with d202 demonstrates one mechanism by which the previously reported MuDR antisense transcript can be produced (![]()
![]()
The region between the translational stop signals in the two normal transcripts is highly repetitive, and has a high potential for secondary structure (![]()
Antisense message has been detected before in Mutator lines (![]()
Because the antisense message is at least potentially capable of interfering with the normal sense message, it has been suggested that the presence of antisense message may be indicative of a negative regulatory pathway (![]()
![]()
Alternatively, variations in excision frequency associated with d202 could be a result of direct changes in MURA. The deletion includes the last 17 predicted amino acids of MURA as well as the normal translational stop codon. Some of the residues that are lost are similar to nuclear localization signals in other plant genes (![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Department of Plant Sciences, University of Arizona, Tucson, AZ 85721. ![]()
2 Present address: Health Communications Research Laboratory, St. Louis University, St. Louis, MO 63108. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Vicki Chandler and David Selinger for critical reading of the manuscript. This work was supported by a National Science Foundation grant (MCB9219587) to M.F. D.L. was supported by a National Institutes of Health (N.I.H.) Training Grant (GM-07127-19). M.J.D. was supported by an N.I.H. postdoctoral fellowship (F32GM15870).
Manuscript received November 15, 1996; Accepted for publication October 5, 1998.
| LITERATURE CITED |
|---|
ALLEMAN, M. and M. FREELING, 1986 The Mu transposable elements of maize: evidence for transposition and copy number regulation during development. Genetics 112:107-119
BENITO, M-I. and V. WALBOT, 1997 Characterization of the maize Mutator transposable element MURA transposase as a DNA-binding protein. Mol. Cell. Biol. 17:5165-5175[Abstract].
BENNETZEN, J. L., 1987 Covalent DNA modification and the regulation of Mutator element transposition in maize. Mol. Gen. Genet. 208:45-51.
BENNETZEN, J. L., 1996 The Mutator transposable element system of maize. Curr. Top. Microbiol. Immunol. 204:195-229[Medline].
BERG, D. E., and M. M. HOWE (Editors), 1989 Mobile DNA. American Society for Microbiology, Washington, D.C.
BLACK, D. M., M. S. JACKSON, M. G. KIDWELL, and G. A. DOVER, 1987 KP elements repress P-induced hybrid dysgenesis in D. melanogaster.. EMBO J. 6:4125-4135[Medline].
CHANDLER, V. L. and K. J. HARDEMAN, 1992 The Mu elements of Zea Mays.. Adv. Genetics 30:77-122[Medline].
CHOMET, P., D. LISCH, K. J. HARDEMAN, V. L. CHANDLER, and M. FREELING, 1991 Identification of a regulatory transposon that controls the Mutator transposable element system in maize. Genetics 129:261-270[Abstract].
COCCIOLONE, S. M. and K. C. CONE, 1993 Pl-Bh, an anthocyanin regulatory gene of maize that leads to variegated pigmentation. Genetics 135:575-588[Abstract].
CUYPERS, H., S. DASH, P. A. PETERSON, H. SAEDLER, and A. GIERL, 1988 The defective En-1102 element encodes a product reducing the mutability of the En/Spm transposable element system of Zea mays.. EMBO J. 7:2953-2960[Medline].
DONLIN, M. J., D. LISCH, and M. FREELING, 1995 Tissue-specific accumulation of MURB, a protein encoded by MuDR, the autonomous regulator of the Mutator transposable element family. Plant Cell 12:1989-2000.
DORING, H. P., M. FREELING, S. HAKE, M. A. JOHNS, and R. I. KUNZE et al., 1984 A Ds-mutation of the Adh1 gene in Zea mays.. Mol. Gen. Genet. 193:199-204.
EISEN, J. A., M.-I. BENITO, and V. WALBOT, 1994 Sequence similarity of putative transposase links the maize Mutator autonomous element and a group of bacterial insertion sequences. Nucleic Acids Res. 22:2634-2636
FEDOROFF, N., 1989 Maize transposable elements, pp. 375411 in Mobile DNA, edited by D. BERG and M. H. HOWE. American Society for Microbiology, Washington, D.C.
FEDOROFF, N., S. WESSLER, and M. SHURE, 1983 Isolation of the transposable maize controlling elements Ac and Ds.. Cell 35:235-242[Medline].
FOWLER, J. E., G. J. MUEHLBAUER, and M. FREELING, 1996 Mosaic analysis of the Liguleless3 mutant phenotype in maize by coordinate suppression of Mutator-insertion alleles. Genetics 143:489-503[Abstract].
GLOOR, G. B., P. R. CHRISTINE, D. M. JOHNSON-SCHLITZ, N. A. NASSIF, and R. W. PHILLIS et al., 1993 Type I repressors of P element mobility. Genetics 135:81-95[Abstract].
GREENE, B., R. WALKO, and S. HAKE, 1994 Mutator insertions in an intron of the maize knotted-1 gene result in dominant suppressible mutations. Genetics 138:1275-1285[Abstract].
HERSHBERGER, R. J., C. A. WARREN, and V. WALBOT, 1991 Mutator activity in maize correlates with the presence and expression of the Mu transposable element Mu9.. Proc. Natl. Acad. Sci. USA 88:10198-10202
HERSHBERGER, R. J., M-I. BENITO, K. HARDEMAN, C. WARREN, and V. L. CHANDLER et al., 1995 Characterization of the major transcripts encoded by the regulatory MuDR transposable element of maize. Genetics 140:1087-1098[Abstract].
HICKS, G. R., H. M. SMITH, M. SHIEH, and N. V. RAIKHEL, 1995 Three classes of nuclear import signals bind to plant nuclei. Plant Physiol. 107:1055-1058[Abstract].
HSIA, A.-P. and P. S. SCHNABLE, 1996 DNA sequence analyses support the role of interrupted gap repair in the origin of internal deletions of the maize transposon MuDR.. Genetics 142:603-618[Abstract].
JAMES, G. M, M. J. SCANLON, M. QIN, D. S. ROBERTSON, and A. M. MYERS, 1993 DNA sequence and transcript analysis of transposon MuA2, a regulator of Mutator transposable element activity in maize. Plant Mol. Bio. 21:1181-1185[Medline].
JOANIN, P., R. J. HERSHBERGER, M. I. BENITO, and V. WALBOT, 1997 Sense and antisense transcripts of the maize MuDR regulatory transposon localized by in situ hybridization. Plant Mol. Biol. 33:23-36[Medline].
KLOECKENER-GRUISSEM, B., J. M. VOGEL, and M. FREELING, 1992 The TATA box promoter region of maize Adh1 affects its organ-specific expression. EMBO J. 11:157-166[Medline].
LISCH, D. and M. FREELING, 1994 Loss of Mutator activity in a minimal line. Maydica 39:289-300.
LISCH, D., P. CHOMET, and M. FREELING, 1995 Genetic characterization of the Mutator system in maize: behavior and regulation of Mu transposons in a minimal line. Genetics 139:1777-1796[Abstract].
MARTIENSSEN, R., A. BARKAN, W. C. TAYLOR, and M. FREELING, 1990 Somatically heritable switches in the DNA modification of Mu transposable elements monitored with a suppressible mutant in maize. Genes Dev. 4:331-343
MCCLINTOCK, B., 1963 Further studies of gene-control systems in maize. Carnegie Inst. Wash. Year Book 62:486-493.
O'HARE, K. and G. M. RUBIN, 1983 Structure of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-34[Medline].
O'HARE, K., A. DRIVER, S. MCGRATH, and D. M. JOHNSON-SCHLITZ, 1992 Distribution and structure of cloned P elements from the Drosophila melanogaster P strain p2. Genet. Res. 60:33-41[Medline].
POHLMAN, R., N. FEDOROFF, and J. MESSING, 1984 The nucleotide sequence of the maize controlling element Activator.. Cell 37:635-643[Medline].
QIN, M. M., D. S. ROBERTSON, and A. H. ELLINGBOE, 1991 Cloning of the Mutator transposable element MuA2, a putative regulator of somatic mutability of the a1-Mum2 allele in maize. Genetics 129:845-854[Abstract].
RASMUSSON, K. E., J. D. RAYMOND, and M. J. SIMMONS, 1993 Repression of hybrid dysgenesis in Drosophila melanogaster by individual naturally occurring P elements. Genetics 133:605-622[Abstract].
ROBERTSON, D. S., 1978 Characterization of a mutator system in maize. Mutat. Res. 51:21-28.
ROBERTSON, H. M. and W. R. ENGELS, 1989 Modified P elements that mimic the P cytotype in Drosophila melanogaster.. Genetics 123:815-823
WALBOT, V., 1991 The Mutator transposable element family of maize. Curr. Top. Genet. Eng. 13:1-37.
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lisch, D.
- Articles by Freeling, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lisch, D.
- Articles by Freeling, M.








