- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Gardner, K. A.
- Articles by Fox, C. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Gardner, K. A.
- Articles by Fox, C. A.
A Region of the Sir1 Protein Dedicated to Recognition of a Silencer and Required for Interaction with the Orc1 Protein in Saccharomyces cerevisiae
Kelly A. Gardnera, Jasper Rineb, and Catherine A. Foxaa Department of Biomolecular Chemistry, University of Wisconsin, Madison, Wisconsin 53706
b Division of Genetics, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720
Corresponding author: Jasper Rine, Department of Biomolecular Chemistry, 587 MSC, University of Wisconsin-Madison, 1300 University Ave., Madison, WI 53706-1532., cfox{at}facstaff.wisc.edu (E-mail)
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
Silencing of the cryptic mating-type loci HMR and HML requires the recognition of DNA sequence elements called silencers by the Sir1p, one of four proteins dedicated to the assembly of silenced chromatin in Saccharomyces cerevisiae. The Sir1p is thought to recognize silencers indirectly through interactions with proteins that bind the silencer DNA directly, such as the origin recognition complex (ORC). Eight recessive alleles of SIR1 were discovered that encode mutant Sir1 proteins specifically defective in their ability to recognize the HMR-E silencer. The eight missense mutations all map within a 17-amino-acid segment of Sir1p, and this segment was also required for Sir1p's interaction with Orc1p. The mutant Sir1 proteins could function in silencing if tethered to a silencer directly through a heterologous DNA-binding domain. Thus the amino acids identified are required for Sir1 protein's recognition of the HMR-E silencer and interaction with Orc1p, but not for its ability to function in silencing per se. The approach used to find these mutations may be applicable to defining interaction surfaces on proteins involved in other processes that require the assembly of macromolecular complexes.
EUKARYOTIC chromosomes are organized into structural domains that can regulate their replication, segregation, and expression (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Transcriptional silencing of the silent mating-type loci, HML and HMR, in the yeast Saccharomyces cerevisiae provides a well-documented example of specialized chromosomal domains that block transcription of genes that reside within them (![]()
allele confers the
-mating phenotype. In most yeast strains, a silenced copy of the MATa allele resides at HMR and a silenced copy of the MAT
allele resides at HML. Transcriptional silencing of HML and HMR requires the combined action of regulatory sites called silencers, several multifunctional nuclear proteins that bind the silencers directly, and silencing-specific proteins that are thought to recognize the silencer-binding proteins and contribute to the assembly of silenced domains of chromatin (![]()
Yeast silencers contain binding sites for the origin recognition complex (ORC), the Rap1p, and/or Abf1p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The silencer-binding proteins probably function in silencing by helping to recruit the four Sir proteins to HML and HMR. The Sir proteins, unlike the silencer-binding proteins, are nonessential for life, yet essential for transcriptional silencing (![]()
The Sir1p is likely to be a key participant in the recruitment of the other Sir proteins because its principal function appears to be in the establishment of the silenced state at HMR and HML (![]()
![]()
![]()
![]()
![]()
![]()
![]()
To begin addressing the mechanism by which Sir1p recognizes a silencer, we performed a genetic screen to identify alleles of SIR1 that produce mutant Sir1 proteins that are defective in the ability to recognize the HMR silencer yet retain their ability to silence per se. The resulting alleles revealed that the ability of Sir1p to recognize the HMR silencer was genetically separable from the ability of Sir1p to function in the assembly of silenced chromatin. A small discrete region of the Sir1p was identified as being necessary for recognizing the HMR silencer and this same region was required for interacting with Orc1p, the largest subunit of ORC. Thus this region of Sir1p may define a Sir1p-ORC interaction motif.
| MATERIALS AND METHODS |
|---|
The genotypes of the yeast strains and the plasmids used in this study are in Table 1 and Table 2. Yeast rich medium (YPD), minimal medium (mM), amino acid and base supplements, and standard yeast genetic methods were as described (![]()
![]()
|
|
Strain construction:
All strains were isogenic to W303 except as noted. The strain used for the
-mating lawn (CFY617, Figure 1 and Figure 4) was constructed by switching the mating type of JRY19 from a to
with a plasmid encoding the HO endonuclease. To construct the strains used for the experiments presented in Table 3 the following crosses were performed: A MAT
HMR-SSa sir1
::LEU2IVY strain (CFY114) was constructed by crossing a MAT
HMR-SSa strain (JRY4492) to a sir1
::LEU2IVY strain (JRY2335) and selecting a MAT
sir1
::LEU2IVY segregant with HMR-SSa. A MAT
HMR-SSa (acs- GAL4 ABF1) strain (CFY238) was constructed by using one-step gene replacement to integrate an HMR-SSa (acs- GAL4 ABF1) DNA fragment at the HMR locus in a MAT
hmr
::URA3 strain (JRY3933). The sir1
::LEU2IVY mutant in these strains was described previously (![]()
::LEU2 deletion mutant described below. Data indicated that the two different SIR1 mutant alleles behaved identically. SS refers to a synthetic version of the HMR-E silencer that consists solely of an autonomously replicating sequence (ARS) consensus sequence (ACS), a binding site for Rap1p (RAP1), and a binding site for Abf1p (ABF1) (![]()
|
|
|
|
|
To construct the diploid strain used to identify the silencer-recognition-defective SIR1 alleles (CFY456, Figure 1) a hmla
p mata
p HMR-SS
sir1
::LEU2IVY strain (CFY444) was mated to a hmla
p mata
p HMR-SSa (acs- GAL4 ABF1) sir1
::LEU2IVY strain (CFY436).
To examine the effect integrated GAL4-SIR1 alleles had on silencing the synthetic silencer, a plasmid for directing integration at the TRP1 locus (pRS304) was used to insert the appropriate GAL4-SIR1 allele at the TRP1 genomic locus of a MAT
HMR-SSa sir1
::LEU2 strain (CFY761) via a unique XbaI site. This procedure allowed the construction of isogenic MAT
HMR-SSa sir1
::LEU2 strains that contained either GAL4-SIR1::TRP1 (CFY792), GAL4-sir1-100::TRP1 (CFY789), or GAL4-sir1-101::TRP1 (CFY788). The sir1
::LEU2 allele in these strains lacked the entire coding region of Sir1p and contained a complete LEU2 gene in its place. To examine the effect the integrated alleles had in silencing a HMR locus flanked by a synthetic silencer containing a Gal4p-binding site in place of the Rap1p-binding site [HMR-SSa (ACS GAL4 ABF1)], the appropriate GAL4-SIR1 allele was integrated at the TRP1 locus of a MAT
HMR-SSa (ACS GAL4 ABF1) sir1
::LEU2 strain (CFY770). This integration produced isogenic MAT
HMR-SSa (ACS GAL4 ABF1) sir1
::LEU2 strains that were GAL4-SIR1::TRP1 (CFY795), GAL4-sir1-100::TRP1 (CFY793), or GAL4-sir1-101::TRP1 (CFY794).
To construct the isogenic MAT
HMR-SSa strains containing different mutant SIR1 alleles (Table 6), the appropriate mutant SIR1 alleles in pRS406 were exchanged with the chromosomal SIR1 gene by two-step gene replacement into a MAT
HMR-SSa strain (JRY4492). Integration was directed to the BglII site of SIR1. Ura+ transformants were transferred to 5-FOA to select for recombinants that regenerated an intact SIR1 gene. Those recombinants that received a mutant SIR1 allele were determined by mating assays with a MATa lawn (JRY19). The weak
-maters contained mutant SIR1 alleles and the integrity of the SIR1 locus in all strains was determined by DNA-blot hybridization.
|
|
|
To construct the diploids used to test whether the mutant SIR1 alleles were recessive (Figure 5), a hmla
p mata
p HMR-SS
strain (ROY1) was mated to a hmla
p mata
p HMR-SS
strain containing either a sir1
::LEU2 (CFY444) allele or a sir1-101 allele (CFY732). Six independent diploids from each cross were examined and all yielded the same results. The analogous diploids were constructed with both sir1-100 and sir1-102 alleles and yielded the same results as those shown in Figure 5 (C. FOX, unpublished results).
|
Plasmid constructions:
To construct HMR-SS
for integration at HMR (pCF51), the Eco0109I-BsaAI fragment containing the a1 gene from HMR was replaced with the Eco0109I-BsaAI fragment containing the
1 gene from HML within an EcoRI-HindIII HMR-SS fragment in pUC18. To place SIR1 under the control of the ADH1 promoter (pCF128), a HindIII site was inserted 10 bp upstream of the initiation codon of SIR1 and a HindIII fragment containing the entire SIR1 coding region was cloned into the HindIII site of a plasmid (pRS316) that contained a 1.5-kb BamHI/HindIII ADH1 promoter-containing fragment (from pMA424). To place GAL4-SIR1 and GAL4-sir1-101 under the control of an ADH1 promoter on a 2-µm plasmid for the overexpression experiment (Figure 6), a NotI/KpnI fragment containing either GAL4-SIR1 under the control of the ADH1 promoter (from pCF117) or an analogous fragment containing mutant GAL4-sir1-101 was cloned into pRS426 (pCF413 and pCF415, respectively). The same strategy was used to engineer the same contructs into a pRS416 CEN plasmid (pCF409 and pCF411).
|
PCR mutagenesis:
The region encoding the C-terminal half of SIR1 was mutagenized using the following pair of primers that annealed to the template plasmid pJR909 (SIR1 in pRS316): CAGCTATGACCATGATTACGC, which annealed to pRS316 vector sequences that flanked the 3' end of SIR1, and GGTTTATTGTCAGGGAAAAGCC, which annealed within the SIR1 coding region 930 bp 3' of the SIR1 initiation codon in the same orientation as the SIR1 reading frame. The N-terminal half of SIR1 was mutagenized using the following pair of primers that annealed to the template plasmid pCF117 (GAL4-SIR1 in pRS316): CCTCGAGAAGACCTTGACATG, which annealed to the Gal4p coding region, and GGAAATTTCGAAATTTGATCTAGG, which annealed within the SIR1 coding region 1130 bp 3' of the SIR1 initiation codon in the opposite orientation of the SIR1 reading frame. A typical PCR reaction contained 30 ng of template plasmid, 30 pmol of each primer, between 5 and 6 mM MgCl2, 0 to 0.15 mM MnCl2, either 200 µM dATP or dGTP, and 1 mM each of the nonlimiting dNTPs. The PCR cycle conditions were as described (![]()
The screen:
To identify mutations within the coding region for the C-terminal half of Sir1p that caused a specific silencer-recognition defect, the detector diploid was cotransformed with a linearized plasmid (pCF117), which contained the GAL4-SIR1 fusion-lacking sequences between the BglII and KpnI sites, and PCR-mutagenized DNA that overlapped the deletion and could recombine with the gapped plasmid. To identify mutations within the coding region for the N-terminal half of Sir1p, the detector diploid was cotransformed with a linearized plasmid (pCF117), which contained the GAL4-SIR1 fusion-lacking sequences between the SmaI and BglII sites, and PCR-mutagenized DNA that overlapped the deletion and could recombine with the gapped plasmid. On average, 100 bp of overlapping homology existed between the ends of the gapped pCF117 plasmid and the ends of the PCR fragments allowing for efficient recombination between the plasmid and the PCR fragments and regeneration of an intact plasmid (![]()
-mating phenotype were recovered from the master plates for further analysis. Two separate pools of PCR-mutagenized fragments were used for screening the C-terminal coding region of SIR1. In separate transformation experiments, 45% of recombinant plasmids failed to complement the sir1
::LEU2 mutation, indicating that the level of mutagenesis was high. However, only eight independent silencer-recognition-defective SIR1 mutant alleles were recovered from an examination of ~18,000 transformants of the detector diploid, suggesting that mutations that caused a specific silencer-recognition defect in Sir1p were relatively rare. Three separate pools of PCR-mutagenized fragments were used for screening the N-terminal coding region of SIR1. On the basis of separate transformation experiments, it was determined that between 25 and 30% of the recombinant plasmids failed to complement a sir1
::LEU2 mutation. However, no silencer-recognition-defective SIR1 mutant alleles were recovered from an examination of ~6000 transformants of the detector diploid. The mutant plasmids were recovered, retested as described in RESULTS, and the mutagenized portion of SIR1 was sequenced.
Quantitative mating assays:
The quantitative mating assays were performed as described except that the mating lawn used was JRY19 (![]()
Immunoblot analysis of wild-type and mutant versions of Gal4-Sir1p:
The level of Gal4-Sir1p in crude yeast extracts was determined as described (![]()
RNA blot analysis of a1 mRNA and SCR1 RNA:
Total yeast RNA was prepared and RNA-blot hybridization was performed with a probe for a1 and, as a loading control, with a probe for SCR1, as described previously (![]()
![]()
| RESULTS |
|---|
Previous studies established that a fusion protein consisting of the DNA-binding domain of Gal4p fused to the complete coding sequence of the Sir1p complements the silencing defect of sir1
strains and silences the HMR locus when tethered directly to the HMR silencer via a Gal4p-binding site (![]()
![]()
![]()
A screen for SIR1 alleles defective in HMR-E silencer recognition:
We used a specialized diploid strain to identify alleles of SIR1 that produced forms of Sir1p that were defective in recognition of the HMR-E silencer yet could still promote silencing of HMR when brought to HMR by other means (Figure 1B). The mutant SIR1 alleles that were silencer-recognition-defective were referred to collectively as sir1srd alleles. The specialized diploid (CFY456), called the detector diploid, was homozygous for a sir1
::LEU2 mutation and thus did not produce Sir1p. In addition, both HML loci and both MAT loci contained a-mating-type genes that harbored a deletion in the promoter for the a genes (a
p). Thus, no mating-type information was expressed from either HML or MAT in this strain. These mutant loci were designated hmla
p and mata
p, respectively. The detector diploid was heterozygous at the HMR locus. One HMR locus contained the
-mating-type genes under the control of the synthetic HMR silencer (HMR-SS
). The synthetic silencer is a simplified version of the natural HMR-E silencer (![]()
genes were expressed from this HMR locus. The second HMR locus contained the a-mating-type genes under the control of a synthetic HMR silencer in which the Rap1p-binding site was replaced with a Gal4-binding site and the ARS consensus sequence was rendered nonfunctional [HMR-SS(GAL4)a; FOX et al. 1997]. In the absence of functional Gal4-Sir1p, the a genes were expressed from this HMR locus (Table 3).
The detector diploid could mate as an a or
cell or exhibit a nonmating phenotype depending upon the SIR1 genotype (Figure 1B). The detector diploid's ability to exhibit all three mating phenotypes of yeast was exploited to isolate silencer-recognition-defective SIR1 alleles (sir1srd). Phenotypically wild-type Gal4-Sir1p, produced by plasmids that harbored no mutations or phenotypically neutral mutations within the SIR1 portion of GAL4-SIR1, would produce a colony with an a-mating phenotype because both HMR loci would be silenced and, in the absence of any mating-type information, yeast cells would exhibit the default a-mating phenotype (reviewed in ![]()
-mating-type information, yeast cells would exhibit the nonmating phenotype. However, mutations that produced Gal4-Sir1p molecules with a specific defect in silencer recognition would cause the
-mating phenotype because the HMR-SS(GAL4)a silencer would mediate repression of the a-mating-type genes, but the HMR-SS
silencer would be unable to silence the
-mating-type genes. Thus,
mating in the detector diploid was the phenotype caused by a GAL4-sir1srd mutant allele that was specifically defective in its ability to recognize the silencer. To isolate sir1srd alleles, a plasmid encoding Gal4-Sir1p was digested with restriction enzymes such that a region encoding the Sir1p portion was deleted. This gapped plasmid was cotransformed into the detector diploid together with linear DNA consisting of the SIR1 gene that had been mutagenized during its PCR amplification. The ends of the PCR fragments were homologous with the ends of the gapped plasmid and recombined with the gapped plasmid to produce full-length Gal4-Sir1p (![]()
cells. Examples of the different mating phenotypes exhibited by the detector diploid are shown (Figure 1C).
To provide a second criterion for testing candidate mutants, two additional haploid strains were transformed with the candidate mutant plasmids isolated from the detector diploid described above. In the first strain (CFY114), the MAT locus contained
genes and the HMR locus contained a genes under the control of the synthetic HMR silencer. This strain also contained a sir1
::LEU2 mutation and had a nonmating phenotype (Figure 1D). A plasmid encoding either SIR1 or GAL4-SIR1 transformed into this strain conferred the
-mating phenotype because both Sir1p and Gal4-Sir1p can promote silencing at HMR (Figure 1D). However, plasmids that encoded mutant versions of Gal4-Sir1p that were defective in silencer recognition would fail to cause this haploid strain to acquire an
-mating phenotype. In contrast, these same plasmids would confer the
-mating phenotype to the second strain (JRY5278) that was MAT
and contained the a genes under the control of a synthetic HMR silencer in which the Rap1p-binding site was replaced with a Gal4p-binding site. The mutant plasmids recovered from the detector diploid failed to complement the sir1
::LEU2 mutation for silencing HMRa (in CFY114), although some of the weaker mutants were capable of supplying some SIR1 function to this strain. However, all the mutant plasmids conferred the
-mating phenotype to the second strain (JRY5278), indicating that the mutant Gal4-Sir1ps were capable of functioning in silencing per se, although they were not capable of recognizing a silencer. Thus all 16 plasmids encoded a silencer-recognition-defective mutant form of the GAL4-SIR1 fusion.
Ten independent plasmids contained missense mutations in the Sir1 protein coding region:
To identify the mutations within the Sir1p coding region responsible for the silencer-recognition defect, the relevant SIR1 portion of the 16 plasmids recovered from the screen was sequenced. Ten of these plasmids, which arose from two independent PCR mutagenesis reactions, contained distinct mutations within the coding region of Sir1p (Table 4). Interestingly, two independent plasmids derived from separate PCR reactions each contained the same nucleotide change responsible for an alanine to threonine amino acid substitution at position 505 of Sir1p (Table 4, mutants 11 and 12). In addition, several independent mutations changed the same amino acids within Sir1p (Table 4). For example, mutants 1 and 3 contained different nucleotide changes but both resulted in substitutions of the tyrosine at codon 489. Similarly, four independent nucleotide changes caused substitutions of alanine at codon 505. Each plasmid contained at least one missense mutation in the SIR1 coding region, several contained nucleotide changes that caused no change at the amino acid level, and no plasmid contained a nonsense mutation. Reengineered plasmids containing any one of the single amino acid changes underlined in Table 4 in an otherwise wild-type GAL4-SIR1 gene conferred a silencer-recognition defect. Thus a missense mutation at any one of the five codon positions 489, 490, 491, 493, or 505 within Sir1p was sufficient to create a silencer-recognition-defective mutant form of GAL4-SIR1.
Mutant Gal4-Sir1p proteins defective in HMR-E silencer recognition were expressed at levels similar to that of wild-type Gal4-Sir1p:
One possible explanation for the silencer-recognition defect of the mutant Gal4-Sir1psrds would be that the steady-state level of the mutant forms was lower than that of wild-type Gal4-Sir1p and that the Gal4p-binding domain provided a higher affinity for the HMR-SS(GAL4) silencer than Sir1p itself had for the HMR-SS silencer. Two observations argued against this possibility. First, silencing mediated by Gal4-Sir1p tethered to a silencer via a Gal4p-binding site was actually more sensitive to reductions in Gal4-Sir1p concentration than was silencing by the normal mechanisms (C. FOX, unpublished results). Therefore, mutations that caused a decrease in Gal4-Sir1p levels should have failed to silence via a Gal4p-binding site in the detector diploid and would not be identified in the screen. Second, we directly compared the levels of two different mutant Gal4-Sir1ps with wild-type Gal4-Sir1p (Figure 2A). The levels of wild-type Gal4-Sir1p were similar to the levels of the mutant Gal4-Sir1ps even though wild-type Gal4-Sir1p could silence HMR-SSa but the mutant forms could not (Figure 2 and Table 5). Thus the silencer-recognition defect was not due to decreased levels of the Gal4-Sir1p mutant proteins.
A mutant GAL4-sir1srd allele was defective in silencing natural HMR:
The preceding data indicated that the mutant GAL4-SIR1 alleles isolated in the screen described above were not capable of recognizing the synthetic HMR-E silencer. If these mutant alleles were defective in a specific protein-protein contact fundamental to Sir1p function, then they should also cause a silencing defect at HMR controlled by the natural, wild-type HMR-E silencer. A sir1
mutation causes only a partial silencing defect at natural HMR (![]()
![]()
sir1
HMRa strain that expressed a plasmid copy of a GAL4-sir1srd allele (GAL4-sir1-101) by RNA-blot hybridization (Figure 3).
Either SIR1 or wild-type GAL4-SIR1 expressed from a plasmid completely silenced natural HMRa as measured by the lack of detectable a1 mRNA (Figure 3, compare lane 1 to lanes 2 and 3). In contrast, the GAL4-sir1-101 allele failed to provide sufficient SIR1 function to silence natural HMRa as measured by the expression of a1 mRNA (Figure 3, lane 4). Notably, GAL4-sir1-101 provided partial SIR1 function at natural HMR as measured by a1 mRNA levels that were slightly reduced compared to the plasmid control (Figure 3, compare lanes 1 and 2), consistent with the hypomorphic behavior of the sir1srd alleles at the synthetic HMR-E silencer (Table 6). Regardless, these data indicated that the amino acids in Sir1p required for the Sir1p's recognition of the synthetic silencer were also required for efficient Sir1p function at the natural HMR-E silencer.
The mutations in SIR1 that caused a silencer-recognition defect in the context of the Gal4-Sir1p fusion protein also blocked the function of Sir1p:
The silencer-recognition defect was defined in the context of Gal4-Sir1p (Figure 1). To determine if the lesions in Sir1p conferring this defect also caused a silencing defect in the absence of the Gal4p DNA-binding domain, individual mutations responsible for the silencer-recognition defect in Gal4-Sir1p were placed within the chromosomal SIR1 gene and silencing in these strains was measured in quantitative mating experiments (Table 6). The most severe mutants exhibited silencing defects that were similar to, although less severe than, those caused by a deletion of the SIR1 gene, supporting the hypothesis that these mutations caused defects in natural Sir1p function (Table 6). It is worth noting that within the context of chromosomal SIR1, the mutations responsible for a silencer-recognition defect did not reduce silencing as severely as they did within the GAL4-SIR1 context, suggesting that the Gal4p domain perturbed or sensitized Sir1p function somewhat (compare Table 5 and Table 6). Nevertheless, the mutations causing the most severe phenotype within the context of Gal4-Sir1p exhibited the most severe silencing defects in the context of chromosomal SIR1. The weaker mutations behaved as hypomorphic sir1 alleles within both contexts. In fact, the weakest allele [sir1-107 (A 505 S)] isolated from the detector diploid actually caused a bimating phenotype in this diploid because the
genes at HMR-SS
were only partially silenced. In the context of chromosomal SIR1, the mutation responsible for this weak silencer-recognition defect caused no observable defect in silencing in a strain that was MAT
HMR-SSa. However, this same mutation in a mata
p HMR-SS
strain caused an
-mating phenotype, indicating that even this extremely weak allele caused a measurable silencing defect in the context of the chromosomal SIR1 gene (C. FOX, unpublished results). These data established that the amino acids identified by the mutations that caused a silencer-recognition defect in the context of Gal4-Sir1p were also required for normal Sir1p function.
The amino acids required for Sir1p's recognition of the HMR-E silencer were also required for Sir1p's interaction with Orc1p:
A previous study reported an interaction between the carboxy-terminal portion of Sir1p and the aminoterminal portion of Orc1p in a two-hybrid interaction assay (![]()
A Gal4p DNA-binding domain fused to the full-length Sir1p (Gal4db-Sir1p) interacted with a fusion protein that consisted of the Gal4p activation domain and the aminoterminal portion (amino acids 5-228 or 5-268) of Orc1p (Gal4ad-Orc1p) as measured by growth on selective media of the two-hybrid tester strain (PJ69-4A) expressing both fusion proteins (Figure 4A). The Gal4db-Sir1p fusion did not interact with the Gal4p activation domain itself (Figure 4A). Thus, the two-hybrid assay reported here detected an interaction between a full-length, functional form of Sir1p and the aminoterminal portion of Orc1p. In striking contrast, a mutant Gal4db-Sir1psrd fusion, encoded by a plasmid copy of GAL4-sir1-101, failed to interact with Gal4ad-Orc1pN (Figure 4A). The tester strain grew well with all relevant plasmids on media that did not demand a two-hybrid interaction (Figure 4B), and the levels of Gal4db-Sir1psrd and wild-type Gal4db-Sir1p were equivalent by protein immunoblot analysis (see Figure 6B). In addition, several other Gal4db-Sir1psrd mutant proteins also failed to interact with Gal4ad-Orc1pN in this assay (K. GARDNER, unpublished results). Therefore, the amino acids required for Sir1p's recognition of the HMR-E silencer were also required for Sir1p's physical interaction with Orc1p.
The sir1srd alleles were recessive:
The mutant SIR1 alleles described above were defective in Sir1p's recognition of the HMR-E silencer and interaction with Orc1p but not in Sir1p's ability to silence once tethered to the silencer. If Sir1p functioned in silencing by recruiting other silencing proteins to the silencer, one might expect that a sir1srd allele would encode a mutant protein that would still associate with other silencing proteins yet be unable to bring them to the silencer. Thus, it was possible that the Sir1psrd mutant proteins would compete with wild-type Sir1p for association with the other silencing proteins and prevent wild-type Sir1p from functioning in silencing. Thus a mutant sir1srd allele might show a dominant silencing defect. Therefore, the mating phenotypes of diploids homozygous for mata
p and HMR-SS
and heterozygous sir1
/SIR1 or sir1-101/SIR1 were determined (Figure 5). The sir1
/SIR1 diploid mated with a strong a mating type, indicating that the single copy of SIR1 in this strain silenced the
genes effectively. The slight amount of
-mating phenotype exhibited in this diploid may be due to limiting amounts of wild-type Sir1p. The sir1-101/SIR1 diploid exhibited a mating phenotype indistinguishable from that of the sir1
/SIR1 diploid, indicating that the sir1srd alleles were recessive. In fact, even expressing relatively high amounts of a Gal4-Sir1psrd mutant protein from a multicopy plasmid did not cause an observable defect in silencing in a wild-type SIR1 strain as measured by mating of a MAT
HMR-SSa strain (Figure 6A, row 3 and Figure 6B). Even in the mata
p HMR-SS
strain, which can detect slight reductions in silencing as an increased number of cells with an
-mating phenotype, high levels of the mutant Gal4p-Sir1psrd caused only a slight increase in this phenotype over that caused by wild-type Gal4-Sir1p (Figure 6A, bottom row). The levels of both wild-type and mutant forms of Gal4-Sir1p expressed in strains carrying the multicopy plasmids were significantly higher than necessary for Gal4-Sir1p to function through either an HMR-SS silencer or a HMR-SS(GAL4) silencer (Figure 6A, rows 1 and 2 compared to Figure 1D; Figure 6B). Therefore the Sir1srd mutant proteins did not interfere significantly with wild-type Sir1p's function in silencing.
| DISCUSSION |
|---|
The work presented here was based on the prediction that Sir1p would have a region that was devoted to recognition of a silencer. This silencer-recognition region would function to bring Sir1p to HMR-E, but not be required to assemble silent chromatin per se. In this article, eight new SIR1 alleles were described, referred to collectively as sir1srd alleles, all of which were defective in silencer-recognition but not in silent chromatin assembly. The alleles were designated sir1-100 through sir1-107 in order of decreasing severity of their silencing defect, and the individual missense mutations responsible for the mutant phenotype clustered within a 17-amino-acid region of Sir1p (Figure 7).
|
A region of Sir1p dedicated to silencer recognition was also required for interaction with Orc1p:
The clustering of missense mutations within a small portion of Sir1p, as well as the number of independent mutations giving rise to changes in the same amino acids, suggested that only a small number of amino acid substitutions were tolerated by the constraints set by the silencer-recognition mutant phenotype. However, it is worth noting that other regions within Sir1p may also be required for silencer recognition. These regions would not have been identified by the screen described here if they also played other roles in Sir1p function, such as recruiting other silencing proteins to HMR.
There are at least two possible explanations for how the region of Sir1p defined by the sir1srd alleles could contribute to Sir1p's recognition of the HMR-E silencer. The simplest view is that the amino acids dedicated to Sir1p's silencer-recognition function may represent sites of direct contacts between Sir1p and a protein, such as ORC, that binds silencer DNA directly. In support of this view, a Sir1p-Orc1p interaction was abolished by a single amino acid substitution in Sir1p that created a mutant Sir1psrd protein incapable of recognizing HMR-E. However, we cannot exclude the possibility that the region of Sir1p identified by the Sir1psrd mutations functioned indirectly, by influencing the proper folding of Sir1p, such that another region of Sir1p was made accessible for the appropriate Orc1p-Sir1p contacts required for Sir1p's recognition of HMR-E. If so, then another region of Sir1p must directly contact Orc1p that was not identified in the silencer-recognition screen described here. Regardless of the exact mechanism, the data presented here argue for an interaction between Sir1p-Orc1p that is dedicated to Sir1p's function in silencer recognition but dispensable for Sir1p's function in the assembly of silent chromatin. The simplest explanation for our data was that Sir1p's recognition of a silencer was mediated by a few specific amino acids in Sir1p that directly contact the Orc1p. The issue of how this Sir1p-Orc1p interaction could be used to uniquely distinguish generic origins of replication from silencers was not addressed by the experiments reported here. Perhaps the region of Orc1p that interacts with Sir1p is accessible only when ORC binds a silencer.
Recessive sir1srd alleles:
The sir1srd alleles were recessive, indicating that the inability of one type of Sir1p to recognize a silencer and interact with ORC did not interfere with the ability of wild-type Sir1p to function in silencing. At one level, it was suprising that the GAL4-sir1srd did not interfere significantly with wild-type Sir1p in silencing HMR. After all, these mutant forms of Gal4-Sir1p must still interact with some silencing-specific components because they can silence HMR when tethered to the silencer via a Gal4p-binding site. Why did the mutant forms of Gal4-Sir1p fail to compete with wild-type Sir1p for these interactions? By immunoblot analysis, the Gal4-Sir1p proteins were reasonably abundant and, even when overproduced beyond the level needed for function, did not interfere significantly with wild-type Sir1p. An appealing model involves an order-of-addition explanation. Perhaps Sir1p's ability to interact with other silencing components, such as the other Sir proteins, requires that it first bind the silencer either through interactions with ORC or through direct interactions with silencer DNA containing a Gal4p-binding site when expressed as a Gal4-Sir1p fusion. The synthetic silencer at which Gal4-Sir1p was functional lacked an ORC or Rap1p-binding site but contained an Abf1p-binding site and the HMR-I element. Perhaps the juxtaposition of Gal4-Sir1p and the Abf1p, for example, is required to form a surface that can efficiently recruit the other Sir proteins. Thus, in the absence of a region required for silencer recognition, the mutant forms of Sir1p would be recessive to wild type. Implicit in this model is the notion that Sir1p, on its own, is insufficient to recruit other silencing proteins to a locus. Indeed, a LexA-Sir1p fusion tethered to a LexA-binding site on a plasmid upstream of a reporter gene was unable to silence the reporter gene (S. OKAMURA, personal communication), although this same fusion could silence HMR in the presence of a LexA-binding site at the silencer (C. FOX, unpublished observations).
The amino acids in Sir1p identified by the silencer-recognition defect of the mutant Sir1psrd proteins play an important role in Sir1p's ability to recognize a silencer and interact with Orc1p without dramatically affecting Sir1p's other role(s) in assembling the silent state. Further systematic analysis of such precisely defined Sir1p defects should help unravel the multitude of specific protein-protein contacts that regulate the assembly of multiprotein complexes at defined chromosomal positions. Moreover, the conceptual approach used to identify the sir1srd alleles should be generally applicable to dissecting individual protein-protein interactions that contribute to the stability and function of other multiprotein complexes.
| ACKNOWLEDGMENTS |
|---|
We thank Rolf Sternglanz for providing the ORC1 plasmids used for the experiment reported in Figure 4 and Melissa R. Mielke for technical assistance with the experiment reported in Figure 3. We are grateful to Elizabeth Craig for comments on the manuscript. C.A.F. thanks Michael Sheets for his patience and support and Andrew Dillin and Sara Okamura for listening to convoluted arguments. This work was supported by postdoctoral fellowships from the Leukemia Society of America and the California Division of the American Cancer Society (to C.A.F.) and by grants from the National Institutes of Health (GM31105 to J.R. and GM56890 to C.A.F.). K.A.G. is supported by a Biotechnology Training Grant to the University of Wisconsin-Madison (NIH 5T32 GM08349). C.A.F. is a recipient of a Burroughs Wellcome Fund Career Award in the Biomedical Sciences. Additional support was provided by a National Institute of Environmental Health Sciences Mutagenesis Center grant.
Manuscript received April 8, 1998; Accepted for publication September 23, 1998.
| LITERATURE CITED |
|---|
APARICIO, O. M., B. L. BILLINGTON, and D. E. GOTTSCHLING, 1991 Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae.. Cell 66:1279-1287[Medline].
BELL, S. P. and B. STILLMAN, 1992 ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357:128-134[Medline].
BELL, S. P., R. KOBAYASHI, and B. STILLMAN, 1993 Yeast origin recognition complex functions in transcription silencing and DNA replication. Science 262:1844-1849
BRAND, A. H., G. MICKLEM, and K. NASMYTH, 1987 A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51:709-719[Medline].
CHIEN, C. T., S. BUCK, R. STERNGLANZ, and D. SHORE, 1993 Targeting of SIR1 protein establishes transcriptional silencing at HM loci and telomeres in yeast. Cell 75:531-541[Medline].
EDMONDSON, D. G. and S. Y. ROTH, 1996 Chromatin and transcription. FASEB J. 10:1173-1182[Abstract].
EHRENHOFER-MURRAY, A. E., M. GOSSEN, D. PAK, M. R. BOTCHAN, and J. RINE, 1995 Separation of origin recognition complex functions by cross-species complementation. Science 270:1671-1674
EHRENHOFER-MURRAY, A. E., M. D. RIVIER, and J. RINE, 1996 The role of Sas2, an acetyltransferase homolog, in silencing and ORC function in Saccharomyces cerevisiae.. Genetics 145:923-934[Abstract].
EKWALL, K., E. R. NIMMO, J. P. JAVERZAT, B. BORGSTROM, and R. EGEL et al., 1996 Mutations in the fission yeast silencing factors clr4+ and rik1+ disrupt the localisation of the chromo domain protein Swi6p and impair centromere function. J. Cell Sci. 109:2637-2648[Abstract].
ELGIN, S. C., 1996 Heterochromatin and gene regulation in Drosophila. Curr. Opin. Genet. Dev. 6:193-202[Medline].
ELGIN, S. C. and S. P. JACKSON, 1997 Chromosomes and expression mechanisms. Curr. Opin. Genet. Dev. 7:149-151[Medline].
FOX, C. A., S. LOO, A. DILLIN, and J. RINE, 1995 The origin recognition complex has essential functions in transcriptional silencing and chromosomal replication. Genes Dev. 9:911-924
FOX, C. A., A. E. EHRENHOFER-MURRAY, S. LOO, and J. RINE, 1997 The origin recognition complex, SIR1, and the S phase requirement for silencing. Science 276:1547-1551
GAILUS-DURNER, V., J. XIE, C. CHINTAMANENI, and A. K. VERSHON, 1996 Participation of the yeast activator Abf1 in meiosis-specific expression of the HOP1 gene. Mol. Cell. Biol. 16:2777-2786
GUTHRIE, C. and G. R. FINK, 1991 Guide to Yeast Genetics and Molecular Biology.. Methods Enzymol. 194:3-37. 281301, 319329.[Medline].
HERMAN, P. K. and J. RINE, 1997 Yeast spore germination: a requirement for RAS protein activity during re-entry into the cell cycle. EMBO J. 16:6171-6181[Medline].
HERSKOWITZ, I., J. RINE and J. STRATHERN, 1992 Mating-type determination and mating-type interconversion in Saccharomyces cerevisiae, pp. 583656 in The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae: Gene Expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HYMAN, A. A. and P. K. SORGER, 1995 Structure and function of kinetochores in budding yeast. Annu. Rev. Cell Dev. Biol. 11:471-495[Medline].
IVY, J. M., A. J. KLAR, and J. B. HICKS, 1986 Cloning and characterization of four SIR genes of Saccharomyces cerevisiae.. Mol. Cell. Biol. 6:688-702
JAMES, P., J. HALLADAY, and E. A. CRAIG, 1996 Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425-1436[Abstract].
KAMAKAKA, R. T. and J. RINE, 1998 Sir- and Silencer-Independent disruption of silencing in Saccharomyces by Sas10p. Genetics 149:903-914
KANG, J. J., T. J. YOKOI, and M. J. HOLLAND, 1995 Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.. J. Biol. Chem. 270:28723-28732
KIMMERLY, W., A. BUCHMAN, R. KORNBERG, and J. RINE, 1988 Roles of two DNA-binding factors in replication, segregation and transcriptional repression mediated by a yeast silencer. EMBO J. 7:2241-2253[Medline].
LIANG, C., M. WEINRICH, and B. STILLMAN, 1995 ORC and Cdc6p interact and determine the frequency of initiation of DNA replication in the genome. Cell 81:667-676[Medline].
LOO, S. and J. RINE, 1994 Silencers and domains of generalized repression. Science 264:1768-1771
LOO, S. and J. RINE, 1995 Silencing and domains of heritable gene expression. Annu. Rev. Cell Dev. Biol. 11:519-548[Medline].
MARAHRENS, Y. and B. STILLMAN, 1992 A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science 255:817-823
MCNALLY, F. J. and J. RINE, 1991 A synthetic silencer mediates SIR-dependent functions in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:5648-5659
MUHLRAD, D., R. HUNTER, and R. PARKER, 1992 A rapid method for localized mutagenesis of yeast genes. Yeast 8:79-82[Medline].
PILLUS, L. and J. RINE, 1989 Epigenetic inheritance of transcriptional states in S. cerevisiae.. Cell 59:637-647[Medline].
RINE, J. and I. HERSKOWITZ, 1987 Four genes responsible for a position effect on expression from HML and HMR in Saccharomyces cerevisiae. Genetics 116:9-22
ROLFES, R. J., F. ZHANG, and A. G. HINNEBUSCH, 1997 The transcriptional activators BAS1, BAS2, and ABF1 bind positive regulatory sites as the critical elements for adenine regulation of ADE5,7.. J. Biol. Chem. 272:13343-13354
SAITOH, S., K. TAKAHASHI, and M. YANAGIDA, 1997 Mis6, a fission yeast inner centromere protein, acts during G1/S and forms specialized chromatin required for equal segregation. Cell 90:131-143[Medline].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHORE, D., 1994 RAP1: a protean regulator in yeast. Trends Genet. 10:408-412[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27
THOMAS, B. J. and R. ROTHSTEIN, 1989 Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630[Medline].
TRIOLO, T. and R. STERNGLANZ, 1996 Role of interactions between the origin recognition complex and SIR1 in transcriptional silencing. Nature 381:251-253[Medline].
WOLFFE, A. P. and D. PRUSS, 1996 Deviant nucleosomes: the functional specialization of chromatin. Trends Genet. 12:58-62[Medline].
This article has been cited by other articles:
![]() |
J. E. G. Gallagher, J. E. Babiarz, L. Teytelman, K. H. Wolfe, and J. Rine Elaboration, Diversification and Regulation of the Sir1 Family of Silencing Proteins in Saccharomyces Genetics, April 1, 2009; 181(4): 1477 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou, J. R. Danzer, L. Mendoza, M. E. Bose, U. Muller, B. Williams, and C. A. Fox Phylogenetic Conservation and Homology Modeling Help Reveal a Novel Domain within the Budding Yeast Heterochromatin Protein Sir1 Mol. Cell. Biol., February 1, 2009; 29(3): 687 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Patterson and C. A. Fox The Ku Complex in Silencing the Cryptic Mating-Type Loci of Saccharomyces cerevisiae Genetics, October 1, 2008; 180(2): 771 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Casey, E. E. Patterson, U. Muller, and C. A. Fox Conversion of a Replication Origin to a Silencer through a Pathway Shared by a Forkhead Transcription Factor and an S Phase Cyclin Mol. Biol. Cell, February 1, 2008; 19(2): 608 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Connelly, P. Yuan, H.-C. Hsu, Z. Li, R.-M. Xu, and R. Sternglanz Structure and Function of the Saccharomyces cerevisiae Sir3 BAH Domain Mol. Cell. Biol., April 15, 2006; 26(8): 3256 - 3265. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Kirchmaier and J. Rine Cell Cycle Requirements in Assembling Silent Chromatin in Saccharomyces cerevisiae Mol. Cell. Biol., February 1, 2006; 26(3): 852 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Camacho, A. Serna, C. Madrid, S. Marques, R. Fernandez, F. de la Cruz, A. Juarez, and J. Casadesus Regulation of finP Transcription by DNA Adenine Methylation in the Virulence Plasmid of Salmonella enterica J. Bacteriol., August 15, 2005; 187(16): 5691 - 5699. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Lynch, H. B. Fraser, E. Sevastopoulos, J. Rine, and L. N. Rusche Sum1p, the Origin Recognition Complex, and the Spreading of a Promoter-Specific Repressor in Saccharomyces cerevisiae Mol. Cell. Biol., July 15, 2005; 25(14): 5920 - 5932. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou, D. A. Bernstein, C. A. Fox, and J. L. Keck Structural basis of the Sir1-origin recognition complex interaction in transcriptional silencing PNAS, June 14, 2005; 102(24): 8489 - 8494. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Hsu, B. Stillman, and R.-M. Xu Structural basis for origin recognition complex 1 protein-silence information regulator 1 protein interaction in epigenetic silencing PNAS, June 14, 2005; 102(24): 8519 - 8524. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Fox and K. H. McConnell Toward Biochemical Understanding of a Transcriptionally Silenced Chromosomal Domain in Saccharomyces cerevisiae J. Biol. Chem., March 11, 2005; 280(10): 8629 - 8632. [Full Text] [PDF] |
||||
![]() |
A. Geissenhoner, C. Weise, and A. E. Ehrenhofer-Murray Dependence of ORC Silencing Function on NatA-Mediated N{alpha} Acetylation in Saccharomyces cerevisiae Mol. Cell. Biol., December 1, 2004; 24(23): 10300 - 10312. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, J. J. Connelly, C.-L. Wang, and R. Sternglanz Importance of the Sir3 N Terminus and Its Acetylation for Yeast Transcriptional Silencing Genetics, September 1, 2004; 168(1): 547 - 551. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Pappas Jr., R. Frisch, and M. Weinreich The NAD+-dependent Sir2p histone deacetylase is a negative regulator of chromosomal DNA replication Genes & Dev., April 1, 2004; 18(7): 769 - 781. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Bose, K. H. McConnell, K. A. Gardner-Aukema, U. Muller, M. Weinreich, J. L. Keck, and C. A. Fox The Origin Recognition Complex and Sir4 Protein Recruit Sir1p to Yeast Silent Chromatin through Independent Interactions Requiring a Common Sir1p Domain Mol. Cell. Biol., January 15, 2004; 24(2): 774 - 786. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. PILLUS and J. RINE SIR1 and the Origin of Epigenetic States in Saccharomyces cerevisiae Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 259 - 266. [Abstract] [PDF] |
||||
![]() |
R. J. P. van Berlo, E. P. van Someren, and M. J. T. Reinders Studying the Conditions for Learning Dynamic Bayesian Networks to Discover Genetic Regulatory Networks SIMULATION, December 1, 2003; 79(12): 689 - 702. [Abstract] [PDF] |
||||
![]() |
J. A. Sharp, D. C. Krawitz, K. A. Gardner, C. A. Fox, and P. D. Kaufman The budding yeast silencing protein Sir1 is a functional component of centromeric chromatin Genes & Dev., October 1, 2003; 17(19): 2356 - 2361. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Cano, G. Dominguez-Bernal, A. Tierrez, F. G.-d. Portillo, and J. Casadesus Regulation of Capsule Synthesis and Cell Motility in Salmonella enterica by the Essential Gene igaA Genetics, December 1, 2002; 162(4): 1513 - 1523. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lau, H. Blitzblau, and S. P. Bell Cell-cycle control of the establishment of mating-type silencing in S. cerevisiae Genes & Dev., November 15, 2002; 16(22): 2935 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Garcia and L. Pillus A Unique Class of Conditional sir2 Mutants Displays Distinct Silencing Defects in Saccharomyces cerevisiae Genetics, October 1, 2002; 162(2): 721 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grunweller and A. E. Ehrenhofer-Murray A Novel Yeast Silencer: The 2{micro} Origin of Saccharomyces cerevisiae Has HST3-, MIG1- and SIR-Dependent Silencing Activity Genetics, September 1, 2002; 162(1): 59 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kasulke, S. Seitz, and A. E. Ehrenhofer-Murray A Role for the Saccharomyces cerevisiae RENT Complex Protein Net1 in HMR Silencing Genetics, August 1, 2002; 161(4): 1411 - 1423. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Rusche, A. L. Kirchmaier, and J. Rine Ordered Nucleation and Spreading of Silenced Chromatin in Saccharomyces cerevisiae Mol. Biol. Cell, July 1, 2002; 13(7): 2207 - 2222. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang Transcriptional silencing in Saccharomyces cerevisiae and Schizosaccharomyces pombe Nucleic Acids Res., April 1, 2002; 30(7): 1465 - 1482. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. R. a. J. Rine Conversion of a gene-specific repressor to a regional silencer Genes & Dev., April 15, 2001; 15(8): 955 - 967. [Abstract] [Full Text] |
||||
![]() |
A. L. Kirchmaier and J. Rine DNA Replication-Independent Silencing in S. cerevisiae Science, January 26, 2001; 291(5504): 646 - 650. [Abstract] [Full Text] |
||||
![]() |
K. A. Gardner and C. A. Fox The Sir1 protein's association with a silenced chromosome domain Genes & Dev., January 15, 2001; 15(2): 147 - 157. [Abstract] [Full Text] |
||||
![]() |
E. M. Stone, C. Reifsnyder, M. McVey, B. Gazo, and L. Pillus Two Classes of sir3 Mutants Enhance the sir1 Mutant Mating Defect and Abolish Telomeric Silencing in Saccharomyces cerevisiae Genetics, June 1, 2000; 155(2): 509 - 522. [Abstract] [Full Text] |
||||
![]() |
P. C. Hollenhorst, M. E. Bose, M. R. Mielke, U. Müller, and C. A. Fox Forkhead Genes in Transcriptional Silencing, Cell Morphology and the Cell Cycle: Overlapping and Distinct Functions for FKH1 and FKH2 in Saccharomyces cerevisiae Genetics, April 1, 2000; 154(4): 1533 - 1548. [Abstract] [Full Text] |
||||
![]() |
M. M. Cockell, S. Perrod, and S. M. Gasser Analysis of Sir2p Domains Required for rDNA and Telomeric Silencing in Saccharomyces cerevisiae Genetics, March 1, 2000; 154(3): 1069 - 1083. [Abstract] [Full Text] |
||||
![]() |
A. E. Ehrenhofer-Murray, R. T. Kamakaka, and J. Rine A Role for the Replication Proteins PCNA, RF-C, Polymerase {epsilon} and Cdc45 in Transcriptional Silencing in Saccharomyces cerevisiae Genetics, November 1, 1999; 153(3): 1171 - 1182. [Abstract] [Full Text] |
||||
![]() |
E. Y. Xu, S. Kim, and D. H. Rivier SAS4 and SAS5 Are Locus-Specific Regulators of Silencing in Saccharomyces cerevisiae Genetics, September 1, 1999; 153(1): 25 - 33. [Abstract] [Full Text] |
||||
![]() |
D. H. Rivier, J. L. Ekena, and J. Rine HMR-I Is an Origin of Replication and a Silencer in Saccharomyces cerevisiae Genetics, February 1, 1999; 151(2): 521 - 529. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Gardner, K. A.
- Articles by Fox, C. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Gardner, K. A.
- Articles by Fox, C. A.






















