- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hodges, D.
- Articles by Bernstein, S. I.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hodges, D.
- Articles by Bernstein, S. I.
The Role of Evolutionarily Conserved Sequences in Alternative Splicing at the 3' End of Drosophila melanogaster Myosin Heavy Chain RNA
Dianne Hodges1,a, Richard M. Cripps2,a, Martin E. O'Connor3,a, and Sanford I. Bernsteinaa Biology Department and Molecular Biology Institute, San Diego State University, San Diego, California 92182-4614
Corresponding author: Sanford I. Bernstein, Biology Department and Molecular Biology Institute, San Diego State University, San Diego, CA 92182-4614., sbernst{at}sunstroke.sdsu.edu (E-mail)
Communicating editor: V. G. FINNERTY
| ABSTRACT |
|---|
Exon 18 of the muscle myosin heavy chain gene (Mhc) of Drosophila melanogaster is excluded from larval transcripts but included in most adult transcripts. To identify cis-acting elements regulating this alternative RNA splicing, we sequenced the 3' end of Mhc from the distantly related species D. virilis. Three noncoding regions are conserved: (1) the nonconsensus splice junctions at either end of exon 18; (2) exon 18 itself; and (3) a 30-nucleotide, pyrimidine-rich sequence located about 40 nt upstream of the 3' splice site of exon 18. We generated transgenic flies expressing Mhc mini-genes designed to test the function of these regions. Improvement of both splice sites of adult-specific exon 18 toward the consensus sequence switches the splicing pattern to include exon 18 in all larval transcripts. Thus nonconsensus splice junctions are critical to stage-specific exclusion of this exon. Deletion of nearly all of exon 18 does not affect stage-specific utilization. However, splicing of transcripts lacking the conserved pyrimidine sequence is severely disrupted in adults. Disruption is not rescued by insertion of a different polypyrimidine tract, suggesting that the conserved pyrimidine-rich sequence interacts with tissue-specific splicing factors to activate utilization of the poor splice sites of exon 18 in adult muscle.
THE insect Drosophila melanogaster exhibits a diversity of morphologically, physiologically, and functionally distinct muscle types in its various tissues and at different stages of its life cycle (for review, see ![]()
![]()
![]()
Myosin serves as the molecular motor of muscle and the major constituent of thick filaments. The tissue specificity of myosin heavy chain (MHC) isoform expression is important in regulating muscle functional diversity in vertebrates (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Stringent regulation of Mhc RNA alternative splicing is critical to proper functioning of the musculature, because alternative exons are not functionally equivalent (![]()
![]()
![]()
![]()
We are studying the cis-acting signals required for alternative inclusion or exclusion of exon 18 in Mhc transcripts. We previously used an in vitro system to examine the sequences important in exclusion of exon 18 and showed that weak splice junctions play a key role in this process (![]()
![]()
![]()
![]()
In this study, we cloned and sequenced the 3' end of the distantly related D. virilis Mhc gene and used the sequence conservation to identify potential cis-acting elements important for alternative splicing of exon 18. Comparison to the D. melanogaster Mhc sequence revealed that there are nonconsensus splice junctions flanking exon 18 in both species. Furthermore, a polypyrimidine tract in intron 17 and much of the noncoding region of exon 18 are conserved between the two species. To examine the function of these conserved regions in vivo, we constructed Mhc mini-genes containing deletions or substitutions of the areas under study and produced transgenic organisms by P-element-mediated germline transformation. We then determined how the mutations affect the RNA splicing patterns in larvae and adults. Our results demonstrate that the conserved sequences within exon 18 are not essential for proper stage-specific splicing of Mhc transcripts. However, the nonconsensus splice junctions flanking exon 18 prevent its inclusion in larval muscle mRNAs, consistent with the in vitro results. Further, the conserved polypyrimidine tract upstream of exon 18 is required for exon 18 inclusion in adult Mhc mRNAs. This suggests that the polypyrimidine tract interacts with adult-specific trans-acting factors to mediate recognition of the nonconsensus splice sites of exon 18.
| MATERIALS AND METHODS |
|---|
Preparation and screening of a D. virilis genomic DNA library:
DNA was isolated from young D. virilis adults as described in ![]()
Transgene construction:
p
MHC 5'3' (![]()
![]()
MHC 5'3'. In brief, the Mhc SfiI-PflMI fragment from the p
MHC 5'3' plasmid (beginning near the end of exon 17 and ending near the end of intron 18) was replaced with the SfiI-PflMI fragment from MHC E17-18-19 CAG, MHC E17-18-19 +Int 5, or MHC E17-18-19 +Int 5 CAG plasmids described in ![]()
MHC 5'3' neomycin selection vector into the pCaSpeR vector (![]()
MHC 5'3' construct by digestion with XbaI or XbaI and KpnI and inserted into the pCaSpeR or pCaSpeR K vector (kindly provided by Dr. J. Posakony), which was cut with the same enzymes (these two vectors differ by the presence of an EcoRI site in pCaSpeR that is replaced with a KpnI site in pCaSpeR K).
We constructed a plasmid to study the effects of deleting most of exon 18; deletions were prepared by cutting exon 18 with AvaIII and then performing Bal 31 exonuclease digestion (![]()
450 E18.
To study the polypyrimidine tract in intron 17, we deleted the 22-nt pyrimidine-rich element (5' TATATTCTTCCCTTTCATATTG 3') and replaced it with a KpnI site by PCR cloning. A PCR fragment, beginning at the HindIII site in exon 17 and ending just 5' to the pyrimidine tract was generated using the following primers: 5' GAAGCTTGAGCAGCGCGTCC 3' (which contains a HindIII site at its 5' end) and 5' AGGTACCACACATTATTCAATAAC 3' (which has a KpnI site at its 5' end). A second PCR fragment, beginning 3' of the pyrimidine tract and extending into exon 18 past the PstI site, was prepared using the following primers: 5' TGGTACCTCGCGTATGCTCTGCT 3' (containing a KpnI site at its 5' end) and 5' TCTACTGCTCCAGCAGCGCG 3'. The PCR fragments were digested with HindIII, KpnI, and PstI. They were gel isolated and ligated into pBS/MHC HIII-RI (![]()
Py), one in intron 17 and one in the flanking vector sequence, made it cumbersome to insert oligonucleotides into the KpnI site in the intron. To destroy the site in the vector, two 10-base, complementary oligonucleotides were synthesized and the phosphorylated double-stranded DNA was ligated into pCaSpeR
Py plasmid that had been partially digested with KpnI and dephosphorylated. We isolated a clone in which insertion of the annealed oligonucleotide abolished the KpnI site within the vector, leaving the site in intron 17 intact. Subsequently, we experienced difficulty inserting oligonucleotides within the intron because of degradation of the plasmid during KpnI digestion. We therefore designed oligonucleotide inserts to be compatible with a neoschizomer of KpnI, Acc 65I. This enzyme produces protruding 5' ends and did not cause degradation. Oligonucleotides were annealed, phosphorylated, and ligated into the Acc65I site. When 5' GTACTATATTCTTCCCTTTCATATT 3' was annealed with 5' GTACAATATGAAAGGGAAGAATATA 3' and inserted in the sense orientation, it restored the polypyrimidine tract (construct pCaSpeR
PyWt+). The antisense orientation yielded pCaSpeR
PyWt-, with a purine-rich tract. Another construct, pCaSpeR
PyMt+, was prepared from the following oligonucleotides: 5' GTACCACACCTCCTTTCCCTACACC 3' and 5' GTACGGTGTAGGGAAAGGAGGTGTG 3'. This construct contains a pyrimidine tract with the C's and T's, compared to those of wild type, reversed.
Probe preparation and transcript analysis:
Constructs used as probes were prepared as follows: (1) Genomic E2/17-18-19 was made by isolation of the BamHI-EcoRI fragment from p
MHC 5'3' and ligation into the pKS vector cut with the same enzymes, (2) E2/17-Int 17 was prepared by deletion of the BglII-EcoRI fragment from genomic E2/17-18-19 followed by treatment with the Klenow fragment (Promega, Madison, WI) and blunt end ligation, (3) E2/17-18-19 cDNA was obtained by replacement of the SfiI-EcoRI fragment of genomic E2/17-18-19 with the SfiI-EcoRI fragment from the adult cDNA (pKS/AcDNA), (4) E2/17-18 was prepared by deletion of the 3' half of exon 18 and all of exon 19 by digestion of E2/17-18-19 cDNA with NsiI and EcoRI, followed by T4 DNA polymerase (Promega) treatment and religation, and (5) the 1.5-kb 3' end construct was prepared by isolation of the MHC 1.5-kb EcoRI fragment from IID1 (![]()
Antisense RNA probes complementary to exon 18 or to exons 17, 18, and 19 were used for Northern and Southern blots and for screening the D. virilis library. The exon 18 antisense RNA probe was prepared from pBS/MHC HIII-Pst truncated at the BglII site in exon 18 and transcribed using T7 RNA polymerase (Stratagene). This probe begins at the 3' splice site of exon 18 and extends to the PstI site, thus covering 436 nt of this 500-nt exon. The 3' end cDNA antisense RNA probe containing exons 17, 18, and 19 was generated from pKS/AcDNA by HindIII digestion and transcription with T3 RNA polymerase (Stratagene). Probes prepared for RNase protection studies were obtained as follows: (1) Plasmids E2/17-Int 17, E2/17-18, and 1.5 3' end were digested with BamHI and transcribed using T3 RNA polymerase and (2) Int 18-E19 was prepared from pBS/MHC HIII-RI that was cut with SnaBI and transcribed with T7 RNA polymerase.
Transcriptions were performed in 30-µl reactions containing 0.5 µg DNA template, 40 mM Tris-HCl (pH 8.0), 8 mM MgCl2, 50 mM NaCl, 2 mM spermidine, 10 mM dithiothreitol, 1 unit Inhibit-ACE (5'-3', Inc.), 400 µM each of ATP and CTP, 80 µM each of GTP and UTP, 2 µM [32P]UTP and [32P]GTP (20 µCi, 800 Ci/mmol), and 50 units of T3 or T7 RNA polymerase (Stratagene). Reactions were performed for 75 min at room temperature followed by DNase digestion, two phenol-chloroform extractions, one chloroform extraction, and two ethanol precipitations.
Drosophila RNA was prepared from first, second, and early third instar larvae and 1- to 2-day-old adults using a modified version of the procedure of ![]()
![]()
![]()
![]()
cDNA synthesis of total RNA purified from transformed D. melanogaster larvae or adults and amplification by the polymerase chain reaction was performed as described in ![]()
![]()
![]()
P-element transformation:
P-element-mediated germline transformation was performed using a helper P-element plasmid as described by ![]()
2-3 helper plasmid (50 µg/ml) were coinjected into embryos homozygous for the white-eyed mutation, w1118. Adults from surviving embryos were mated to w1118 flies and transformants with pigmented eyes were identified in the next generation. Each transformant was crossed to a balancer line: w; SM1, al2 Cy cn2 sp2/ Sco; TM2, emc2 UbxP130 ry es/ MKRS, M(3)76A kar ry2 Sb (kindly provided by Greg Harris) containing dominant markers for Curly (Cy), Ultrabithorax (Ubx), and Stubble (Sb). Chromosomal linkage and stable balanced insert lines were obtained by appropriate sibling crosses.
| RESULTS |
|---|
Identification of Mhc sequence elements conserved between distantly related Drosophila species:
To discern potential cis-acting elements important to exon 18 alternative splicing in Drosophila melanogaster, we identified evolutionarily conserved Mhc sequences in distantly related Drosophila species. Conserved nucleotide sequences frequently encode functional motifs or contain cis-acting regulatory elements (![]()
![]()
![]()
![]()
![]()
![]()
|
To ensure that the multiple transcripts are produced from alternative splicing (as in D. melanogaster) rather than from multiple genes, we performed a Southern blot on genomic DNA from the most distantly related species, D. virilis. We hybridized a blot of D. virilis genomic DNA, digested with the restriction enzymes EcoRI or HindIII to an RNA probe containing D. melanogaster exons 17, 18, and 19; single 2.5-kb EcoRI and 3.25-kb HindIII fragments were detected (data not shown). A D. melanogaster probe, specific to constitutive exons 4, 5, and 6, hybridized to single 4.5-kb EcoRI, 5.8-kb HindIII, and 7.8-kb BamHI fragments. Detection of single DNA fragments generated by digestion with each of these enzymes strongly suggests that, as in D. melanogaster, a single muscle Mhc gene exists in D. virilis.
On the basis of the evidence for conserved alternative splicing of a single Mhc transcript in the most distantly related species, we isolated the 3' end of the D. virilis Mhc gene from a genomic DNA library using low-stringency hybridization. We obtained several size classes of D. virilis inserts containing various contiguous EcoRI fragments. All clones included a 2.5-kb EcoRI fragment, the size fragment detected on the genomic Southern blot when hybridized to the D. melanogaster Mhc exon 17-18-19 antisense RNA probe. Sequence analysis showed that the 2.5-kb EcoRI fragment and flanking fragments of 1.4 kb and 0.4 kb correspond to the 3' end of the D. melanogaster Mhc gene.
We compared the sequence of D. virilis Mhc DNA to D. melanogaster (![]()
![]()
![]()
![]()
|
There is strong identity between exon 18 of D. melanogaster and D. virilis in the noncoding regions. Because this exon encodes only a single amino acid, the degree of sequence conservation at the DNA level is surprising. There are two areas of striking identity (Figure 2). A 117-nt region, beginning 69 nt downstream of the D. melanogaster 3' splice site, is 84% identical to D. virilis. The 88 nt at the 3' end of exon 18 are also almost totally conserved between the two species. This includes the exon portion of the 5' splice site, which is unusual in that this sequence is TTT, rather than the consensus C/AAG. There are smaller regions of identity scattered throughout exon 18 as well. Exon 18 differs in size between the two species (D. melanogaster is 500 nt whereas D. virilis is 663 nt). The extra D. virilis sequence maintains the A/T-richness of D. melanogaster exon 18 (>66% A/T).
We found little sequence identity within introns, with the exception of the 5' and 3' splice sites and a pyrimidine-rich sequence in intron 17 (Figure 2). Intron 18 of D. melanogaster is 246 nt smaller than D. virilis, whereas the size of intron 17 is about the same in the two organisms. The purine-rich nature of the 3' splice site of exon 18 and the absence of a good consensus branchpoint sequence within 40 nt of the 3' splice site are unusual features in D. melanogaster and they are observed also in D. virilis. A polypyrimidine tract (TATATTCTTCCCTTTCATATTGC), beginning at position -56 from the 3' splice site of exon 18 of D. melanogaster, is present in the D. virilis sequence at a similar position (overlined in Figure 2). Both species contain a consensus branchpoint sequence just 5' to this polypyrimidine tract (underlined in Figure 2, with asterisks indicating the adenosine residue that would form the 2'5' linkage).
In summary, coding sequences at the 3' end of the D. melanogaster and D. virilis Mhc genes are highly conserved, as are large portions of exon 18 and its nonconsensus splice junctions. A pyrimidine-rich sequence upstream of exon 18 is also remarkably conserved. Because the actual sequence, and not just the pyrimidine character of this sequence, is conserved, this might be an element involved in regulation of the alternative splicing of exon 18. The nonconsensus splice junctions of exon 18 and the long stretches of conserved sequences within this exon are also candidates for alternative splicing regulatory sequences.
Alternative splicing of Mhc mini-gene transcripts in vivo:
To test whether conserved elements at the 3' end of the Mhc genes are important to alternative splicing of exon 18 in vivo, we made modifications predicted to improve the splice sites, remove competing splice junctions, or inhibit exon 18 inclusion, using our previously developed Mhc mini-gene (![]()
![]()
|
Improvement of both splice sites of exon 18 is required for efficient removal of both introns from larval transcripts:
The splice sites of exon 18 in D. melanogaster and D. virilis do not match the consensus sequences derived for D. melanogaster (![]()
![]()
![]()
|
To determine if the skip splicing that generates wild-type larval Mhc transcripts is due to the weak 3' splice site of exon 18 we inserted a 29-nt sequence containing a consensus branchpoint and 3' splice site from constitutively spliced intron 5 of the Mhc gene into the intron 17/exon 18 junction (Figure 4A, +Int 5). If this junction is the key element in exon 18 exclusion, this change would result in exon 18 inclusion in larval mini-gene transcripts. However, the predominant larval RNA species from this MHC +Int 5 mini-gene lacks exon 18 and contains exon 17 spliced to exon 19, as is observed in wild-type transcripts (Figure 4C, 0.9- and 1.45-kb bands). Only small amounts of exon 18-containing transcripts accumulate in transformed larvae (Figure 4B).
To test whether the nonconsensus terminal 3 nucleotides of exon 18 are important to exon 18 alternative splicing we replaced the TTT sequence of the mini-gene with CAG, thus creating a perfect 5' splice site consensus (Figure 4A, CAG). If the weak 5' splice site of exon 18 prevents efficient removal of intron 17 and intron 18 from larval mini-gene transcripts, this change should promote exon 18 inclusion. Our results indicate that conversion of the 5' splice site of exon 18 to the consensus sequence does not promote production of larval transcripts that include exon 18 (Figure 4B, CAG). Larval transcripts contain exons 17 and 19 and lack exon 18 as in wild-type larvae (Figure 4C, CAG). These larval transcripts are about 50 nt longer than those generated from the wild-type mini-gene, apparently from activation of a cryptic splice site. We conclude that a consensus 5' splice site for exon 18 is not sufficient to permit correct and efficient inclusion of this exon in larval tissue.
Because improvement of either 5' or 3' splice site of exon 18 alone did not promote efficient and correct inclusion of exon 18 in larval transcripts, we prepared and tested a construct containing both improvements (Figure 4A, +Int 5 CAG). Transformed larvae expressing MHC +Int 5 CAG generate large amounts of mini-gene mRNAs containing exon 18, as shown by the Northern blot hybridized to the exon 18-specific probe (Figure 4B, +Int 5 CAG). Transcripts containing all three exons are the only mini-gene transcripts detected in both larvae and adults; the skip splicing products (exon 17 spliced to exon 19), typically present in larvae, are eliminated (Figure 4C, +Int 5 CAG). We took several steps to confirm the Northern blotting results (data not shown). RNase protection analysis with a cDNA probe containing MHC exons 2, 17, and 18 yielded full protection by RNA from +Int 5 CAG larvae, whereas smaller protected fragments (expected from hybridization to transcripts in which exon 17 was skip spliced to exon 19) were absent; these smaller protected fragments were the major species detected in RNA purified from WT, CAG, or Int 5 larvae. Further, RT/PCR of the transformed mini-gene transcripts with an exon 2/17 and exon 18 primer set generated DNA of the expected size for splicing of exon 17 to exon 18 in adults expressing the WT, CAG, +Int 5, and +Int 5 CAG mini-genes. The same size PCR product was generated from +Int 5 CAG larval RNA but PCR products were not detected with larval RNA from the other transgene lines when electrophoretic gels were stained with ethidium bromide. We used an exon 18-specific probe against a Southern blot of these PCR products and demonstrated that exon 17 was efficiently spliced to exon 18 in MHC +Int 5 CAG larval mRNAs, whereas larval mini-gene transcripts from MHC +Int 5 and MHC CAG lines generated less than 10% as much of this PCR product. We conclude that precise and efficient inclusion of exon 18 into Mhc mini-gene transcripts in larvae occurs when both flanking splice sites are converted to match splice site consensus sequences.
Most of exon 18 can be deleted without affecting tissue-specific regulation of Mhc transcript splicing:
Having determined a possible mechanism whereby exon 18 is excluded from larval Mhc transcripts (nonconsensus splice sites), we turned our attention to studying sequences that might promote exon 18 inclusion in adults. The evolutionary conservation of much of the noncoding sequence within exon 18 suggests that regulatory elements reside within this exon. A number of sequences conforming to known cis-acting regulatory sites for splicing are present in exon 18 (see DISCUSSION for details). We therefore analyzed the in vivo expression of a D. melanogaster Mhc mini-gene with a deletion of 450 of the 500 nt of exon 18 (Figure 5A,
450 E18). Approximately 25 nt at each splice junction of exon 18 remain in this construct. While there is only a 50-nt difference in the size of transcripts that include vs. exclude this shortened exon, they can be differentiated using an exon 18 probe. As in wild-type transgenic flies, exon 18-containing mini-gene transcripts are present in
450 E18 adults but absent in larvae (Figure 5B); normal skip splicing occurs in
450 E18 larvae (Figure 5C). RNase protection studies, RT/PCR amplification using an exon 17-exon 19 primer set, and DNA sequencing of PCR products confirmed that the 450-nt deletion did not alter proper stage-specific splicing (data not shown). RT/PCR yielded a single band in larval transformants, of the size expected when exon 17 is spliced to exon 19. RNA of
450 E18 adults produced a RT/PCR band ~50 nt larger than the larval product, which is the size expected for inclusion of the shortened exon 18 in mini-gene mRNA. Sequencing of this product confirmed that the correct 5' and 3' splice sites of shortened exon 18 are utilized for splicing to the flanking exons in adult mini-gene transcripts from the
450 E18 lines. Our results demonstrate that few, if any, of the exon 18 sequences conserved between the two Drosophila species are required for exon 18 inclusion in adult transcripts or for exclusion in larval mRNA.
|
The distant and conserved polypyrimidine tract within intron 17 is essential for inclusion of exon 18 in adult transcripts:
The polypyrimidine tract and branchpoint consensus sequences that are conserved between D. virilis and D. melanogaster may serve as critical elements for splicing of exon 17 to exon 18 in adults. Polypyrimidine tracts are typically found within 40 nt of the 3' splice site and are often contiguous with branchpoint consensus sequences (![]()
![]()
Py). We were careful to maintain the integrity of the putative branchpoint that is located 5' to the conserved pyrimidine tract. In the
Py mini-gene this branchpoint consensus sequence is positioned 43 nt upstream of the 3' splice site of exon 18 instead of 61 nt in the wild-type gene. The pyrimidine deletion did not affect the normal skip splicing of mini-gene transcripts in
Py larvae (Figure 6C,
Py). Hybridization of an exon 18-specific probe to a Northern blot of RNA from transformants expressing the
Py mini-gene shows that the deletion dramatically reduces exon 18 inclusion in adult mRNA (Figure 6B,
Py). Comparison of the
Py adult lane with the w1118 adult lane shows that background hybridization to ribosomal RNAs produces much of the observed signal, and comparison to the wild-type Mhc construct indicates that the remaining signals are not the appropriate sizes to correspond to the normal inclusion of exon 18, suggesting cryptic splice site activation. RNase protection studies, using a hybrid exon 2/17-exon 18 RNA probe, verified that adult
Py mini-gene transcripts containing exon 18 were greatly decreased relative to wild-type levels (>10-fold); we confirmed this by RT/PCR using the exon 2/17-exon 18 primer set (data not shown).
Py adults generate mini-gene transcripts slightly larger than the 0.9- and 1.4-kb mRNAs produced in larvae. We did not determine the precise nature of the cryptic splicing, but it is clear that exon 18 is excluded from the majority of these transcripts. To ensure that the failure to include exon 18 in adult mini-gene transcripts containing the pyrimidine tract deletion was not due to the introduction of the KpnI site into this construct, we reinserted the polypyrimidine tract into the engineered KpnI site (Figure 6A,
PyWt+). This restored the adult-specific inclusion of exon 18 (Figure 6B,
PyWt+), verifying that the pyrimidine tract is critical to this process.
|
We next sought to determine whether altering the spacing of the intron elements might have disrupted exon 18 inclusion in adult mini-gene transcripts that lack the polypyrimidine tract. We inserted the wild-type polypyrimidine stretch in the opposite orientation at the KpnI site of the
Py construct to yield construct
PyWt-, which now contains a purine-rich, rather than a pyrimidine-rich, sequence (Figure 6A). This maintains the appropriate spacing between the putative branchpoint and 3' splice sites. Rather than rescue exon 18 inclusion, this alteration was more effective than the pyrimidine deletion at eliminating exon 18 from adult transcripts (Figure 6B,
PyWt-).
Finally, we tested whether the actual sequence of the conserved polypyrimidine tract is important for exon 18 inclusion or if the pyrimidine-rich nature is sufficient. We inserted an oligonucleotide at the KpnI site of the
Py mini-gene that is the same length and pyrimidine content as the wild-type polypyrimidine tract. However, every C was replaced by a T and vice versa (Figure 6A,
PyMt+). This construct yielded extremely low levels of exon 18 inclusion in adults (well below 10% of wild type; Figure 6B,
PyMt+), indicating that the specific conserved sequence, rather than the pyrimidine content, is critical to exon 18 inclusion. In vivo data thus identify the conserved polypyrimidine tract as an element essential for inclusion of exon 18, and a potential candidate for the site of interaction of adult-specific trans-acting splicing factors.
| DISCUSSION |
|---|
Alternative RNA splicing is a common mechanism used for generating muscle-specific isoforms of myofibrillar components (for review, see ![]()
![]()
![]()
Most of exon 18 is dispensable for correct stage- and muscle-specific splicing of Mhc mini-gene transcripts:
The conserved elements within exon 18 are candidates for splicing activation "enhancer" sequences similar to those that occur within exons of a number of alternatively spliced transcripts (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
A number of GAR-like and ACE-like elements occur in the exon 18 sequences that are conserved between D. melanogaster and D. virilis. For instance, a long ACE flanked by three GAR repeats is found at the 5' end of exon 18 (D. melanogaster nucleotides 2037020416). Purine-rich elements, as well as a sequence nearly identical to a binding site for the SR protein SC35 (![]()
![]()
The correct and efficient inclusion of exon 18 in mRNA from transgenic adults carrying the MHC
450 E18 construct suggests that no activating sequences reside in the 450 nt of exon 18 that were deleted. The existence of positive-acting elements within exon 18 could not be assessed in our previous in vitro studies, because this exon was excluded in spliced transcripts (![]()
450 E18 are brought into closer proximity by the large deletion. This change, along with the smaller size of the deleted exon (Figure 5), might alleviate the requirement for other enhancer elements. Our previous in vivo splicing results, however, suggest that the very 5' end of exon 18 is not essential, because Mhc mini-gene transcripts with a deletion of 10 nt beginning 3 nt downstream of the 3' splice site of exon 18 were spliced in the correct stage-specific manner (![]()
Negative-acting elements located in exons also play a role in alternative splicing (![]()
![]()
![]()
450 E18 mini-gene in vivo further shows that inhibitory sequences important for larval muscle cell exclusion of this exon do not reside in the deleted region.
An emerging theme in alternative splicing regulation is the involvement of both inhibitory and activating elements within exons and introns; splice site selection in a particular environment would thus depend upon the relative abundance or activity of both constitutive and cell/tissue-specific factors that interact with these elements (see ![]()
![]()
![]()
450 E18 could have removed some of these, leaving behind elements that permit appropriate stage-specific splicing regulation.
Based on our current study, the extensive conservation of the noncoding region of exon 18 between D. virilis and D. melanogaster is not critical for proper regulation of alternative splicing, because regulation is retained in the MHC
450 E18 transcripts. This is the case for at least one other set of alternative exons in Drosophila Mhc. ![]()
Nonconsensus splice junctions are required for exon 18 exclusion in larvae:
Comparison of results from the single and double splice site mutants (CAG, +Int 5, and +Int 5 CAG) suggests that simultaneous recognition of both splice sites is required for exon 18 inclusion. This is consistent with the exon definition model of splicing proposed by Berget and colleagues (![]()
![]()
![]()
![]()
While our results for construct CAG show that improvement of only the 5' splice site of exon 18 is not sufficient to allow exon 18 inclusion, similar experiments with pre-protachykinin RNA (![]()
![]()
![]()
![]()
In an extensive series of in vitro experiments, we demonstrated that the failure to recognize either splice junction of exon 18 in Kc cells is not a result of splice junction competition, i.e., that the failure to include exon 18 is not simply because the 5' splice site of exon 17 and the 3' splice site of exon 19 outcompete the 5' and 3' splice sites of exon 18 (![]()
Replacing both of the nonconsensus splice junctions of exon 18 with consensus sequences is sufficient to completely switch the splicing pattern of larval Mhc RNA to that seen in adults, i.e., exon 18 inclusion. The requirement that both splice sites be switched for efficient inclusion indicates that this process is dependent on recognition of signals at both ends of exon 18. This confirms and extends our in vitro analyses, where Kc cell extracts only included exon 18 when both splice junctions agreed with the consensus splicing signals (![]()
The distant polypyrimidine tract in intron 17 is essential for inclusion of exon 18 in adult mini-gene mRNAs:
In vertebrates a functional polypyrimidine tract is located between the branchpoint and the 3' splice site and contains at least five consecutive uridines or nine consecutive pyrimidines (![]()
![]()
![]()
Py and
PyWt- mini-gene pre-mRNA splicing shows that the distant intron 17 polypyrimidine tract is required for adult-specific inclusion of exon 18 in mature mRNAs. In contrast, however, we find that a sequence with pyrimidine content (
PyMt+) identical to that of the wild-type polypyrimidine tract cannot rescue exon 18 inclusion, indicating that the sequence itself, not simply the pyrimidine content, is critical. The conserved polypyrimidine tract in intron 17 therefore appears to serve a unique role in regulating exon 18 inclusion. We propose that adult-specific factors bind to the wild-type polypyrimidine tract in adult muscles and assist in the simultaneous identification of both nonconsensus splice sites of exon 18 by the splicing machinery. This would result in recognition of exon 18 as a bona fide exon and the subsequent removal of both introns.
Several proteins are known to bind polypyrimidine tracts in introns and positively or negatively influence intron removal. U2AF65 is a constitutive splicing factor that binds the pyrimidine tract of introns at the early (E) step of spliceosome assembly before catalytic step I of splicing occurs (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Our identification of a conserved polypyrimidine tract in intron 17 and its requirement for exon 18 inclusion suggest that recognition and incorporation of exon 18 into mRNA is positively regulated in adult muscle. A unique factor might bind the conserved polypyrimidine tract and promote recognition of the nonconsensus splice sites of exon 18 by the splicing apparatus. Future work will be aimed at identifying trans-acting factors that interact with this important cis-acting element.
| FOOTNOTES |
|---|
1 Present address: CoCensys Inc., 201 Technology Dr., Irvine, CA 92618. ![]()
2 Present address: Department of Biology, University of New Mexico, Albuquerque, NM 87131-1049. ![]()
3 Present address: BIO 101 Inc., Vista, CA 92083. ![]()
| ACKNOWLEDGMENTS |
|---|
We are particularly grateful to Massoud Nikkhoy for providing excellent technical assistance. We thank Kelleen Aguinaga and Jennifer Suggs for their high-quality technical help as well. We greatly appreciate William Kronert's aid in preparing Figure 2. We thank David Futch for providing stocks of various Drosophila species and William Stumph for helpful comments on the manuscript. This project was supported by National Institutes of Health research grant GM-32443, postdoctoral fellowships to R.M.C. from the Muscular Dystrophy Association and the California Affiliate of the American Heart Association, and an Established Investigator Award to S.I.B. from the American Heart Association.
Manuscript received June 24, 1998; Accepted for publication October 9, 1998.
| LITERATURE CITED |
|---|
ASHIYA, M. and P. J. GRABOWSKI, 1997 A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart. RNA 3:966-1015.
BERGET, S. M., 1995 Exon recognition in vertebrate splicing. J. Biol. Chem. 270:2411-2414
BERNSTEIN, S. I., K. MOGAMI, J. J. DONADY, and C. P. EMERSON, JR., 1983 Drosophila muscle myosin heavy chain encoded by a single gene in a cluster of muscle mutations. Nature 302:393-397[Medline].
BERNSTEIN, S. I., C. J. HANSEN, K. D. BECKER, D. R. WASSENBERG, II, and





