| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Luis A. Rokeach, Département de Biochimie, Université de Montréal, C.P. 6128, Succursale Centre-ville, Montréal, Québec H3C 3J7, Canada., luis.rokeach{at}umontreal.ca (E-mail)
Communicating editor: R. K. HERMAN
| ABSTRACT |
|---|
The Ro ribonucleoproteins (RoRNP) consist of at least one major protein of 60 kD, Ro60, and one small associated RNA, designated Y RNA. Although RoRNP have been found in all vertebrate species examined so far, their function remains unknown. The Caenorhabditis elegans rop-1 gene previously has been identified as encoding a Ro60 homologue. We report here the phenotypic characterization of a C. elegans strain in which rop-1 has been disrupted. This is the first report regarding the inactivation of a major RoRNP constituent in any organism. The rop-1 mutant worms display no visible defects. However, at the molecular level, the disruption of rop-1 results in a dramatic decrease in the levels of the ROP-1-associated RNA (CeY RNA). Moreover, transgenic expression of wild-type rop-1 partially rescues the levels of CeY RNA. Considering that transgenes are poorly expressed in the germline, the fact that the rescue is only partial is most likely related to the high abundance of the CeY RNA in the adult germline and in embryos. The developmental expression pattern and localization of CeY RNA suggest a role for this molecule during embryogenesis. We conclude that, under laboratory culture conditions, ROP-1 does not play a crucial role in C. elegans.
THE Ro ribonucleoproteins (RoRNP) have been initially identified as the primary target of autoantibodies in patients with autoimmune diseases such as systemic lupus erythematosus and Sjögren's syndrome (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
RoRNP consists of at least one protein of ~60 kD, Ro60, which associates with one small RNA polymerase III transcript, designated Y RNA (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Previous studies in Xenopus oocytes have demonstrated that Ro60 binds misfolded 5S rRNA molecules (![]()
![]()
![]()
![]()
We and others have previously reported the identification of a Ro60 homologue in the nematode Caenorhabditis elegans (![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
General methods and strains:
C. elegans strains were cultured as described by ![]()
![]()
Generation of transgenic nematodes:
Animals were transformed using two previously described methods. In the first one, plasmid pCeRo4146, containing the wild-type rop-1 gene, was coinjected with the transformation marker pRF4 [containing a dominant mutation in the collagen gene rol-6(su1006)] in rop-1(pk93) animals, both at a concentration of 50 µg/ml (![]()
-ray-induced integration technique (![]()
![]()
For lacZ expression, the rop-1 promoter was cloned in vector pPD22.11 so that it would drive the expression of a nuclear localization signal (NLS)-containing ß-galactosidase gene product, with the 3' UTR of unc-54 (![]()
-ray-induced integration method (![]()
![]()
RNA procedures:
Staged and mixed-staged worms were grown and collected as described previously (![]()
![]()
For ribosomal RNA extraction, worm pellets were ground in liquid nitrogen and resuspended in NET-2 buffer (40 mM Tris-HCl, pH 7.4; 150 mM NaCl; 0.05% NP-40). The extracts were spun at 5,000 rpm for 15 min at 4° in order to eliminate the collagen cuticles. The supernatants were then ultracentrifuged at 35,000 rpm for 2 hr at 4° in a Beckman (Fullerton, CA) SW50.1 rotor. The resulting pellets were resuspended in 100 µl of RNAse-free water and subjected to two rounds of phenol/chloroform extractions, followed by a precipitation with Na acetate. RNA was collected by centrifugation for 15 min at 4°.
For individual 5S rRNA cloning, 2.5 µg of total or ribosomal RNA were precipitated and resuspended in 10 µl of poly(A) polymerase buffer [50 mM Tris-HCl, pH 7.9; 250 mM NaCl; 10 mM MgCl2; 2.5 mM MnCl2; 250 µM ATP; 20 units of RNAsin RNAse inhibitor (Stratagene); 0.5 µg/ml of bovine serum albumin]. One unit of poly(A) polymerase (BRL) was then added to the mixture. The reaction was incubated 15 min at 37° to allow polymerization, followed by 15 min at 65° to inactivate the polymerase. RT was performed on 2 µl of polyadenylated RNA sample in a total reaction volume of 25 µl, using primer XBpoly(T). PCR was then performed on 5 µl of RT product using primers XBpoly(T) and S1CE5S. Vent polymerase (New England Biolabs, Beverly, MA) was used to minimize the misincorporation events. The PCR products were ligated in the pBlueScript vector (Stratagene) and sequenced individually by the dideoxy chain termination technique using a T7 sequencing methodology (Pharmacia, Piscataway, NJ). To rule out the possibility of selecting for a particular mutation, the whole procedure was repeated three times for each cellular 5S rRNA pool.
Immunoblotting:
Western blots were carried out as previously described (![]()
PCR reaction primers:
The following primers were used in PCR and RT-PCR reactions: SL1, TTTAATTACCCAAGTTTGAG;SL2, TTTTAACCCAGTTACTCAAG; XBpoly(T), CGCTCTAGAGGATCC(T)15; S1CE5S, AATGTCGACGCTTACGACCATATCACG; CL1, GAACCAATCATGGCTGATGAGTTG; CL2, CTCGTCAAATGGAGAAAGTCAAGG; CL3, TGTCGAGCATACCAGCATCAGATG; CL4, TTGGAAGGCCACAATCTGTTCTGC; RI, TCACAAGCTGATCGACTCGATGCCACGTCG; RII, TTCTGAACACTGTGGTGAAG.
| RESULTS |
|---|
The allele pk93 is null for the expression of rop-1:
The strain NL733 rop-1(pk93), carrying an insertion of the transposon Tc1 in the rop-1 gene, was obtained from Ronald Plasterk (The Netherlands Cancer Institute, Amsterdam). The original strain was outcrossed 10 times with the wild-type strain N2 to ensure a wild-type genetic background as far as possible. The presence of the transposon within the rop-1 gene was confirmed by PCR after each outcross, using primer pairs CL1/RI and CL2/RII. The exact position of the Tc1 insertion was determined by sequencing the PCR product obtained following the second round of amplification. Tc1 disrupted rop-1 in the third exon, 23 nucleotides after the 3' splice site of the second intron (Figure 1). Northern blot analysis on total RNA, with the rop-1 coding sequence used as a probe, shows that the allele pk93 has a greatly reduced expression of rop-1 mRNA when compared to wild-type levels (Figure 2A). Moreover, the residual signal is most likely nonspecific hybridization since RT-PCR analysis failed to amplify any specific band from the rop-1 mutant strain (Figure 2B). Furthermore, Western blot analysis on total protein extracts, using ROP-1 specific antibodies, did not detect the presence of ROP-1 in the rop-1 mutant when compared to wild type (Figure 2C). No ROP-1 protein was detected, even when the primary antibody concentration and exposure times were greatly increased (data not shown). These results clearly demonstrate that the allele pk93 is null for the expression of rop-1.
|
|
rop-1 mutants do not show any visible phenotype:
rop-1 mutant worms do not show any obvious phenotype. The morphology and behavior of the mutants are wild type. Since Ro60 is present in virtually every vertebrate cell, it is likely to play a ubiquitous role in cellular physiology. Its absence is expected to affect basic cellular processes that could result in phenotypes that generally affect the whole organism. Thus, we scored the brood size and the life span of rop-1 mutants, but observed no difference between wild-type and rop-1 mutant worms at either 15°, 20°, or 25° (data not shown). Therefore, under the growth conditions tested, ROP-1 does not seem to play a crucial role in C. elegans physiology.
5S rRNA processing in the absence of ROP-1:
Ro60 has been shown to bind defective 5S rRNA copies in Xenopus oocytes (![]()
We first analyzed the levels of 5S rRNA by Northern blotting on total RNA extracts from mixed-stage worms. Using this method, we could not observe any difference between the levels of 5S rRNA in wild-type and rop-1 mutant strains (data not shown). As a control, we also analyzed the levels of five different tRNAs, which are transcribed by RNA polymerase III via a different set of transcription factors from those used for 5S rRNA. Yet the levels of tRNA in wild type and the rop-1 mutant strain appeared the same (data not shown). Thus, the amounts of 5S rRNA seem unaffected by the absence of ROP-1.
Next we verified the quality of individual 5S rRNA molecules transcribed in wild-type and rop-1 mutant strains. To this end, both total and ribosomal RNA was extracted from each strain and 5S rRNA molecules were selectively amplified by RT-PCR using primers XB-poly(T) and S1CE5S. Since the primer S1CE5S anneals to the first 18 nucleotides of the 5S molecule, no mutation could be detected from this region. In order to minimize nucleotide misincorporation events during the PCR reactions, a thermostable DNA polymerase containing a proofreading activity was used for DNA amplification (Vent DNA polymerase, New England Biolabs). As shown in Table 1, sequencing of the individual 5S rRNA copies from total RNA extracts revealed no substantial difference between wild-type and rop-1 mutant strains, with ~8% of the 5S RNA molecules containing a single mutation. However, sequencing of 5S rRNAs extracted from ribosomes of wild type displayed only 1.6% of mutation frequency, whereas those extracted from ribosomes of rop-1 mutants showed 8% of mutation frequency. The mutations observed maintained in general the ratio of purine:pyrimidine in the 5S molecule and were principally located in the regions defined as loop B-stem III-loop C and stem V-loop E (data not shown; ![]()
|
The levels of ROP-1-associated Y RNA are severely decreased in rop-1 mutants:
It has previously been shown that the C. elegans ROP-1 protein associates with the CeY RNA (![]()
|
To show that the decrease in CeY RNA is due to the absence of ROP-1, we set out to rescue its expression by reintroducing the wild-type rop-1 gene in the rop-1 mutant. We generated three strains in which each transgenic array expresses ROP-1 at a different level. In C. elegans, transgenic arrays are maintained extrachromosomally and display some mitotic instability (![]()
-ray treatment. Western blot analysis showed that the transgenic worms were indeed producing ROP-1 in all four strains (Figure 3A). Under these conditions, the transgenic expression of wild-type rop-1 was able to partially rescue the levels of CeY RNA (Figure 3B). The quantity of CeY RNA present in each rescuing strain increased proportionally with the level of ROP-1 synthesis (compare individual lanes in Figure 3A with Figure 3B). The fact that the levels of both molecules are proportional upon reexpression of ROP-1 indicates that the CeY RNA's presence is linked to ROP-1.
To improve the rescue of the phenotypes associated with rop-1 disruption, we generated transgenic strains carrying the wild-type rop-1 gene along with a 50-fold excess of wild-type genomic DNA (![]()
CeY RNA is present at higher levels in the adult germline and in embryos:
Since the rescue of CeY RNA is partial, we further investigated this phenomenon. Even though transgenic arrays are usually well expressed in most somatic lineages, they are poorly expressed in the germline of C. elegans (![]()
![]()
![]()
|
The rop-1 promoter is not active in the germline when expressed from a transgene:
To characterize the expression pattern of rop-1 from a transgene, we fused the rop-1 promoter to lacZ, with the 3' UTR of unc-54. The resulting strains express the enzyme ß-galactosidase in the cellular types where the rop-1 transgenic promoter is active. As shown in Figure 5, the expression of rop-1::lacZ is mosaic and differs from animal to animal. This irregular pattern of expression cannot be explained only by the instability of transgenic arrays, because this pattern was still observed after one of the transgenic arrays was integrated in the genome of C. elegans. Nevertheless, by comparing the expression pattern of numerous worms and strains, we observed some ß-galactosidase staining in every cell type of the nematode, except in the germline. The same results were obtained with a rop-1::gfp reporter construct (data not shown). This ubiquitous expression further supports the notion of a basic cellular role for ROP-1, compatible with its involvement in 5S rRNA quality control. Furthermore, because CeY RNA is transcribed at higher levels in the germline and in embryos, the fact that the transgenic rop-1 is not expressed in the C. elegans germline provides an explanation for the partial rescue of CeY RNA levels we observed.
|
| DISCUSSION |
|---|
We report here the first phenotypic characterization of an organism devoid of Ro60 protein. The C. elegans rop-1 gene was disrupted by Tc1 transposon insertion at the 5' end of its third exon. The absence of ROP-1 synthesis was confirmed by Western blot analysis on total protein extracts from the rop-1 mutant strain. There was no visible phenotype observed in association with the disruption. However, in the rop-1 mutant strain, we observed a dramatic decrease in CeY RNA levels. The CeY RNA levels were partially rescued when the wild-type rop-1 gene was reintroduced in the rop-1 mutant worms. The partial rescue is probably related to the fact that the CeY RNA is transcribed at higher levels in the adult germline and in the embryo.
rop-1 mutant worms display no visible phenotype:
The absence of a visible phenotype in rop-1 mutants is surprising considering the level of conservation of Ro60 proteins between human, mouse, frog, and nematode (![]()
![]()
![]()
RoRNP components are present at higher levels during embryogenesis:
RoRNP particles previously have been immunoprecipitated from C. elegans embryos (![]()
![]()
A link between ROP-1 and 5S rRNA processing in C. elegans:
In Xenopus oocytes, Ro60 has been shown to interact with misfolded 5S rRNA molecules that contain mutations, as well as a ~10-nucleotide extension at their 3' end (![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We express our gratitude to Ronald Plasterk (The Netherlands Cancer Institute, Amsterdam) for providing the rop-1(pk93) strain, Barry Honda (Simon Fraser University, Vancouver, B.C., Canada) for providing a 5S rDNA clone, Marc Perry (University of Toronto) for sending us the plasmid pCeA103 containing the actin probe, and Andy Fire (Carnegie Institution of Washington, Baltimore) for the generous gift of lacZ expression vectors. We also thank Sandra Wolin (Yale University, New Haven) for sharing unpublished data and all the members of the Rokeach and Hekimi laboratories for technical advice and insightful comments on the manuscript. Some strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the National Center for Research Resources of the National Institutes of Health. J.-C.L. was supported by a studentship from the Fonds pour la Formation de Chercheurs et l'Aide à la Recherche. L.A.R. was a scholar of The Medical Research Council of Canada. This work was supported by a Canadian Arthritis Society grant to L.A.R. and a Medical Research Council of Canada grant to S.H.
Manuscript received July 15, 1998; Accepted for publication October 5, 1998.
| LITERATURE CITED |
|---|
ALI, N. and A. SIDDIQUI, 1997 The La antigen binds 5' noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation. Proc. Natl. Acad. Sci. USA 94:2249-2254
AUSTIN, J. and J. KIMBLE, 1987 glp-1 is required in the germ line for regulation of the decision between mitosis and meiosis in C. elegans.. Cell 51:589-599[Medline].
BAI, C., Z. LI, and P. P. TOLIAS, 1994 Developmental characterization of a Drosophila RNA-binding protein homologous to the human systemic lupus erythematosus-associated La/SS-B autoantigen. Mol. Cell. Biol. 14:5123-5129
BARTON, M. K., T. B. SCHEDL, and J. KIMBLE, 1987 Gain-of-function mutations of fem-3, a sex-determination gene in Caenorhabditis elegans.. Genetics 115:107-119
BELSHAM, G. J., N. SONENBERG, and Y. V. SVITKIN, 1995 The role of the La autoantigen in internal initiation. Curr. Top. Microbiol. Immunol. 203:85-98[Medline].
BOIRE, G. and J. CRAFT, 1989 Biochemical and immunological heterogeneity of the Ro ribonucleoprotein particles. Analysis with sera specific for the RohY5 particle. J. Clin. Invest. 84:270-279.
BOIRE, G., M. GENDRON, N. MONAST, B. BASTIN, and H. A. MÉNARD, 1995 Purification of antigenically intact Ro ribonucleoproteins: biochemical and immunological evidence that the 52-kD protein is not a Ro protein. Clin. Exp. Immunol. 100:489-498[Medline].
BRENNER, S., 1974 The genetics of Caenorhabditis elegans.. Genetics 77:71-94
CHAN, E. K. L., J. C. HAMEL, J. P. BUYON, and E. M. TAN, 1991 Molecular definition and sequence motifs of the 52-kD component of human SS-A/Ro autoantigen. J. Clin. Invest. 87:68-76.
DEUTSCHER, S. L., J. B. HARLEY, and J. D. KEENE, 1988 Molecular analysis of the 60-kDa human Ro ribonucleoprotein. Proc. Natl. Acad. Sci. USA 85:9479-9483
EWBANK, J. J., T. M. BARNES, B. LAKOWSKI, M. LUSSIER, and H. BUSSEY et al., 1997 Structural and functional conservation of the Caenorhabditis elegans timing gene clk-1.. Science 275:980-983
FAN, H., A. L. SAKULICH, J. L. GOODIER, X. L. ZHANG, and J. QIN et al., 1997 Phosphorylation of the human La antigen on serine 366 can regulate recycling of RNA polymerase III transcription complexes. Cell 88:707-715[Medline].
FAN, H., J. L. GOODIER, J. R. CHAMBERLAIN, D. B. ENGELKE, and R. J. MARAIA, 1998 5' processing of tRNA precursors can be modulated by the human La antigen phosphoprotein. Mol. Cell. Biol. 18:3201-3211
FARRIS, A. D., C. A. O'BRIEN, and J. B. HARLEY, 1995 Y3 is the most conserved small RNA component of Ro ribonucleoprotein complexes in vertebrate species. Gene 154:193-198[Medline].
FARRIS, A. D., F. PUVION-DUTILLEUL, E. PUVION, J. B. HARLEY, and L. A. LEE, 1997 The ultrastructural localization of 60-kDa Ro protein and human cytoplasmic RNAs: association with novel electron-dense bodies. Proc. Natl. Acad. Sci. USA 94:3040-3045
FERGUSON, K. C., P. J. HEID, and J. H. ROTHMAN, 1996 The SL1 trans-spliced leader RNA performs an essential embryonic function in Caenorhabditis elegans that can also be supplied by SL2 RNA. Genes Dev. 10:1543-1556
FIRE, A., 1992 Histochemical techniques for locating Escherichia coli beta-galactosidase activity in transgenic organisms. Genet. Anal. Tech. Appl. 9:151-158[Medline].
FIRE, A., S. W. HARRISON, and D. DIXON, 1990 A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans.. Gene 93:189-198[Medline].
GOTTLIEB, E. and J. A. STEITZ, 1989a The RNA binding protein La influences both the accuracy and the efficiency of RNA polymerase III transcription in vitro.. EMBO J. 8:841-850[Medline].
GOTTLIEB, E. and J. A. STEITZ, 1989b Function of the mammalian La protein: evidence for its action in transcription termination by RNA polymerase III. EMBO J. 8:851-861[Medline].
GREEN, C. D., K. S. LONG, H. SHI, and S. L. WOLIN, 1998 Binding of the 60-kDa Ro autoantigen to Y RNAs: evidence for the recognition in the major groove of a conserved helix. RNA 4:750-765[Abstract].
HUHN, P., G. J. M. PRUIJN, W. J. VAN VENROOIJ, and M. BACHMANN, 1997 Characterization of the autoantigen La (SS-B) as an dsRNA unwinding enzyme. Nucleic Acids Res. 25:410-416
ITOH, K., Y. ITOH, and M. B. FRANK, 1991 Protein heterogeneity in the human Ro/SSA ribonucleoproteins. The 52- and 60-kD Ro/SSA autoantigens are encoded by separate genes. J. Clin. Invest. 87:177-186.
KELEKAR, A., M. R. SAITTA, and J. D. KEENE, 1994 Molecular composition of Ro small ribonucleoprotein complexes in human cells. Intracellular localization of the 60-(and 52-kD proteins. J. Clin. Invest. 93):1637-1644.
KELLY, W. G., S. Q. XU, M. K. MONTGOMERY, and A. FIRE, 1997 Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics 146:227-238[Abstract].
KRAUSE, M., M. WILD, B. ROSENZWEIG, and D. HIRSH, 1989 Wild-type and mutant actin genes in Caenorhabditis elegans.. J. Mol. Biol. 208:381-392[Medline].
LABBÉ, J.-C., M. JANNATIPOUR, and L. A. ROKEACH, 1995 The Caenorhabditis elegans rop-1 gene encodes the homologue of the human 60-kDa Ro autoantigen. Gene 167:227-231[Medline].
LEWIS, J. A. and J. T. FLEMING, 1995 Basic culture methods. Methods Cell Biol. 48:4-29.
LINMARQ, N. and S. G. CLARKSON, 1998 Efficient synthesis, termination and release of RNA polymerase III transcripts in Xenopus extracts depleted of La protein. EMBO J. 17:2033-2041[Medline].
MAMULA, M. J., E. D. SILVERMAN, R. M. LAXER, L. BENTUR, and B. ISACOVICS et al., 1989 Human monoclonal anti-La antibodies. The La protein resides on a subset of Ro particles. J. Immunol. 143:2923-2928[Abstract].
MARAIA, R. J., 1996 Transcription termination factor La is also an initiation factor for RNA polymerase III. Proc. Natl. Acad. Sci. USA 93:3383-3387
MELLO, C. C. and A. FIRE, 1995 DNA transformation. Methods Cell Biol. 48:451-482[Medline].
O'BRIEN, C. A. and S. L. WOLIN, 1994 A possible role for the 60-kD Ro autoantigen in a discard pathway for defective 5S rRNA precursors. Genes Dev. 8:2891-2903
O'BRIEN, C. A., K. MARGELOT, and S. L. WOLIN, 1993 Xenopus Ro ribonucleoproteins: members of an evolutionarily conserved class of cytoplasmic ribonucleoproteins. Proc. Natl. Acad. Sci. USA 90:7250-7254
PRUIJN, G. J. M., R. L. SLOBBE, and W. J. VAN VENROOIJ, 1991 Analysis of protein-RNA interaction within Ro ribonucleoprotein complexes. Nucleic Acids Res. 19:5173-5180
PRUIJN, G. J. M., P. A. E. T. M. WINGENS, S. L. M. PETERS, J. P. H. THIJSSEN, and W. J. VAN VENROOIJ, 1993 Ro RNP associated Y RNAs are highly conserved among mammals. Biochim. Biophys. Acta Gene Struct. Expression 1216:395-401[Medline].
ROKEACH, L. A., J. A. HASELBY, and S. O. HOCH, 1991 High-level bacterial expression, purification and characterization of human calreticulin. Protein Eng. 4:981-987
SHI, H., C. A. O'BRIEN, D. J. VAN HORN, and S. L. WOLIN, 1996 A misfolded form of 5S rRNA is complexed with the Ro and La autoantigens. RNA 2:769-784[Abstract].
SLOBBE, R. L., W. PLUK, W. J. VAN VENROOIJ, and G. J. PRUIJN, 1992 Ro ribonucleoprotein assembly in vitro. Identification of RNA-protein and protein-protein interactions. J. Mol. Biol. 227:361-366[Medline].
STEFANO, J. E., 1984 Purified lupus antigen La recognizes an oligouridylate stretch common to the 3' termini of RNA polymerase III transcripts. Cell 36:145-154[Medline].
TAN, E. M., 1993 Molecular biology of nuclear autoantigens. Adv. Nephrol. 22:213-236.
TSENG, C. E., E. K. L. CHAN, E. MIRANDA, M. GROSS, and F. DIDONATO et al., 1997 The 52-kD protein as a target of intermolecular spreading of the immune response to components of the SS-A/Ro-SS-B/La complex. Arthritis Rheum. 40:936-944[Medline].
VAN GELDER, C. W. G., J. P. H. M. THIJSSEN, E. C. J. KLAASSEN, C. STURCHLER, and A. KROL et al., 1994 Common structural features of the Ro RNP associated hY1 and hY5 RNAs. Nucleic Acids Res. 22:2498-2506
VAN HORN, D. J., D. EISENBERG, C. A. O'BRIEN, and S. L. WOLIN, 1995 Caenorhabditis elegans embryos contain only one major species of Ro RNP. RNA 1:293-303[Abstract].
VAN HORN, D. J., C. J. YOO, D. H. XUE, H. SHI, and S. L. WOLIN, 1997 The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. RNA 3:1434-1443[Abstract].
VAN VENROOIJ, W. J., R. L. SLOBBE, and G. J. M. PRUIJN, 1993 Structure and function of La and Ro RNPs. Mol. Biol. Rep. 18:113-119[Medline].
WANG, D. R., J. P. BUYON, and E. K. L. CHAN, 1996 Cloning and expression of mouse 60 kDa ribonucleoprotein SS-A/Ro. Mol. Biol. Rep. 23:205-210[Medline].
WOLFFE, A. P. and D. D. BROWN, 1988 Developmental regulation of two 5S ribosomal RNA genes. Science 241:1626-1632
WOLIN, S. L. and J. A. STEITZ, 1983 Genes for two small cytoplasmic Ro RNAs are adjacent and appear to be single-copy in the human genome. Cell 32:735-744[Medline].
WOLIN, S. L. and J. A. STEITZ, 1984 The Ro small cytoplasmic ribonucleoproteins: identification of the antigenic protein and its binding site on the Ro RNAs. Proc. Natl. Acad. Sci. USA 81:1996-2000
YOO, C. J. and S. L. WOLIN, 1997 The yeast La protein is required for the 3' endonucleolytic cleavage that matures tRNA precursors. Cell 89:393-402[Medline].
YOUINOU, P., Y. ADLER, S. MULLER, A. LAMOUR, and D. BARON et al., 1994 Anti-Ro(SSA) and anti-La(SSB) antibodies in autoimmune rheumatic diseases. Clin. Rev. Allergy 12:253-274[Medline].
ZWAAL, R. R., A. BROEKS, J. VAN MEURS, J. T. M. GROENEN, and R. H. A. PLASTERK, 1993 Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435
This article has been cited by other articles:
![]() |
J. R. Hogg and K. Collins Human Y5 RNA specializes a Ro ribonucleoprotein for 5S ribosomal RNA quality control Genes & Dev., December 1, 2007; 21(23): 3067 - 3072. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chen, E. J. Wurtmann, J. Van Batavia, B. Zybailov, M. P. Washburn, and S. L. Wolin An ortholog of the Ro autoantigen functions in 23S rRNA maturation in D. radiodurans Genes & Dev., June 1, 2007; 21(11): 1328 - 1339. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Christov, T. J. Gardiner, D. Szuts, and T. Krude Functional Requirement of Noncoding Y RNAs for Human Chromosomal DNA Replication. Mol. Cell. Biol., September 1, 2006; 26(18): 6993 - 7004. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. BELISOVA, K. SEMRAD, O. MAYER, G. KOCIAN, E. WAIGMANN, R. SCHROEDER, and G. STEINER RNA chaperone activity of protein components of human Ro RNPs RNA, July 1, 2005; 11(7): 1084 - 1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xue, H. Shi, J. D. Smith, X. Chen, D. A. Noe, T. Cedervall, D. D. Yang, E. Eynon, D. E. Brash, M. Kashgarian, et al. A lupus-like syndrome develops in mice lacking the Ro 60-kDa protein, a major lupus autoantigen PNAS, June 24, 2003; 100(13): 7503 - 7508. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Kickhoefer, Y. Liu, L. B. Kong, B. E. Snow, P. L. Stewart, L. Harrington, and L. H. Rome The Telomerase/Vault-associated Protein TEP1 Is Required for Vault RNA Stability and Its Association with the Vault Particle J. Cell Biol., January 8, 2001; 152(1): 157 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Labbé, J. Burgess, L. A. Rokeach, and S. Hekimi ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation PNAS, November 2, 2000; (2000) 230284297. [Abstract] [Full Text] |
||||
![]() |
X. Chen, A. M. Quinn, and S. L. Wolin Ro ribonucleoproteins contribute to the resistance of Deinococcus radiodurans to ultraviolet irradiation Genes & Dev., April 1, 2000; 14(7): 777 - 782. [Abstract] [Full Text] |
||||
![]() |
J.-C. Labbe, J. Burgess, L. A. Rokeach, and S. Hekimi ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation PNAS, November 21, 2000; 97(24): 13233 - 13238. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||