| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Signaling Interaction
Corresponding author: Simon J. Dowell, Gene Function Unit, Cellular Sciences, Glaxo Wellcome Medicines Research Centre, Gunnels Wood Rd., Stevenage, Hertfordshire, SG1 2NY, United Kingdom., sd14041{at}glaxowellcome.co.uk (E-mail).
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
The mating pathway of Saccharomyces cerevisiae is widely used as a model system for G protein-coupled receptor-mediated signal transduction. Following receptor activation by the binding of mating pheromones, G protein ß
subunits transmit the signal to a MAP kinase cascade, which involves interaction of Gß (Ste4p) with the MAP kinase scaffold protein Ste5p. Here, we identify residues in Ste4p required for the interaction with Ste5p. These residues define a new signaling interface close to the Ste20p binding site within the Gß
coiled-coil. Ste4p mutants defective in the Ste5p interaction interact efficiently with Gpa1p (G
) and Ste18p (G
) but cannot function in signal transduction because cells expressing these mutants are sterile. Ste4 L65S is temperature-sensitive for its interaction with Ste5p, and also for signaling. We have identified a Ste5p mutant (L196A) that displays a synthetic interaction defect with Ste4 L65S, providing strong evidence that Ste4p and Ste5p interact directly in vivo through an interface that involves hydrophobic residues. The correlation between disruption of the Ste4p-Ste5p interaction and sterility confirms the importance of this interaction in signal transduction. Identification of the Gß
coiled-coil in Ste5p binding may set a precedent for Gß
-effector interactions in more complex organisms.
IN the pheromone response of the yeast Saccharomyces cerevisiae, binding of the pheromones a-factor and
-factor to the receptors Ste3p and Ste2p, respectively, activates a heterotrimeric G protein composed of Gpa1p (G
), Ste4p (Gß), and Ste18p (G
) subunits (reviewed in ![]()
element communicates the signal to a MAP kinase cascade comprising Ste11p (MAPKKK), Ste7p (MAPKK), and Fus3p (MAPK). Fus3p then activates the cyclin-dependent kinase inhibitor Far1p and the transcription factor Ste12p to bring about cell-cycle arrest and new gene expression required for the mating process. Activation of the MAPK cascade by Gß
requires Ste20p, a member of the PAK family of kinases, which acts upstream of Ste11p in the pathway (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In mammalian cells, multiple roles have been identified for Gß
subunits (for reviews see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
subunits have been shown to activate MAP kinase pathways through Ras- and Rac-dependent mechanisms (![]()
![]()
![]()
![]()
subunits interact with and activate their effectors.
The crystal structure of the free Gß
heterodimer of the G protein transducin reveals a distinctive propeller structure constructed of seven blades that derive from WD repeats in the Gß primary sequence (![]()
that packs against one side of the propeller, contacting blades 4 and 5. This structure is little altered when Gß
is complexed with G
(![]()
![]()
![]()
element complexed with an effector.
Yeast Ste4p and Ste18p share a high degree of homology with mammalian Gß and G
subunits, except that Ste4p contains a 41-amino-acid insertion within the sixth WD repeat (![]()
subunits. The Ste4p interaction with Gpa1p and Ste18p can be modeled on mammalian G
ß
heterotrimers. Ste4p appears to interact with many proteins within the yeast cell; the investigation of these targets may provide insight into the mechanism of Gß
signaling in more complex organisms. In two-hybrid assays, Ste4p has been shown to interact with the amino terminus of Ste5p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Because the association between Ste4p and Ste5p appears to be critical in directing the pheromone signal to the appropriate effector, we have investigated this contact. The Ste4p-Ste5p interaction is dependent on the presence of Ste18p, and the amino-terminal 214 amino acids of Ste5p are sufficient for interaction with Ste4p (![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Plasmids and strains:
Yeast strains are described in Table 1. For regulated expression of GPA1, we devised a system whereby the promoter of any gene at its chromosomal locus could be replaced by the MET3 promoter. A MET3 promoter fragment was obtained by polymerase chain reaction (PCR; ![]()
![]()
![]()
![]()
ste4. The resulting diploid was sporulated to obtain SDY109. To create SDY110, STE5 promoter and terminator regions were amplified from genomic DNA by PCR using the oligonucleotide pairs AGAGCTCGAGCGGCCGCAAGCTTAGGGTTACCGGCCT / ATGCCCGAATTCCGCTGTATCCTGTATC and GCCTAGATGCGGCCGCTATATATAATCCATATGGAG/CCCGGGATCCGAGTATACACTAAATTTTATGC and cloned as XhoI/EcoRI and NotI/BamHI fragments, respectively, into the polylinker of pBB creating pBB-STE5#5'3'. The ADE2 gene was derived as a BglII fragment from pASZ10 (![]()
ste4.
|
The GAD control plasmid was pGAD2F (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Media:
Cells were grown in media described by ![]()
Generation of mutants:
STE4 mutations were generated by low-fidelity PCR on the basis of the protocol of ![]()
Plasmid recovery:
Yeast transformants were grown selectively in 2 ml synthetic medium to saturation, harvested, and treated with 0.2 ml Zymolyase solution for 2 hr. Subsequent steps were followed as above, except using QiaPrep Spin miniprep kit (QIAGEN) according to manufacturer's instructions. DNA was resuspended in 50 µl water, of which 1 µl was transformed into E. coli XL-1Blue competent cells (Stratagene).
Two-hybrid assays:
Quantitative ß-galactosidase assays were based on the protocol of ![]()
![]()
, where W is the volume of cell slurry in the normalization mixture, V is the volume of cell slurry in the reaction, and T is the incubation time of the ONPG reaction, in minutes. Variability due to the moderate toxicity of GAD-Ste4 was greatly reduced by the far1-1 mutation in strain M364-2C. For blue colony assays, cells were grown on Hybond-N filters (Amersham, Arlington Heights, IL), frozen in liquid nitrogen, and thawed three times, then placed onto filter paper soaked in Z buffer containing 1 mg/ml 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-GAL; Sigma) and 0.04 M ß-mercaptoethanol. For growth assays, transformants were grown selectively in liquid culture to saturation, then 10 µl applied to selective plates lacking histidine and supplemented with 10 mM 3-amino-triazole (Sigma). Plates were incubated either at 20° or 30°.
Mating assays:
SDY109 colonies transformed with GAD-Ste4 derivatives were patched onto selective medium, then replica-plated onto a lawn of the mating tester strains on YPD plates and incubated at 30° for 1624 hr. Patched SDY110 transformants of pL55 derivatives were grown on selective synthetic medium containing 2% glucose, then replica-plated onto a lawn of the mating tester strains on YPGAL plates and incubated at different temperatures for 1624 hr. The mated yeast were then replica-plated onto diploid-selective plates and grown at 30° for a further 2448 hr.
Western blotting:
Immunoblotting (![]()
![]()
Structural modeling:
The Gpa1p/Ste4p/Ste18p structure was modeled on the coordinates of mammalian Gi
1ß1
2 (![]()
| RESULTS |
|---|
Creation of a mutant Ste4p two-hybrid library:
We set out to define interaction interfaces of Ste4p important in signal transduction by identifying nonsignaling Ste4p mutants and using protein interaction assays to map any defective interactions. In the two-hybrid assay, Ste4p fused to the Gal4p activation domain (GAD-Ste4) interacts strongly with Gpa1p, Ste18p, and Ste5p (amino-terminal residues 1214) fused to the LexA DNA binding domain (Figure 1A). GAD-Ste4 can also function in the yeast pheromone-response pathway: a strain of the MAT
mating-type (SDY109), deleted for chromosomal STE4, mated with a MATa strain (DC14) when transformed with GAD-Ste4 but not when transformed with GAD alone on plasmid pGAD2F (Figure 1B). The GAD-Ste4 transformants did not mate with a MAT
strain (DC17; data not shown), indicating that GAD-Ste4 was functioning as part of a receptor-mediated response. Therefore, functional analysis and protein interaction assays can be carried out on the same Ste4p molecule.
|
A library of mutagenized STE4 DNA was made by low fidelity PCR from the GAD-Ste4 DNA template (pKB40.1) and cloned into linearized pGAD2F using homologous recombination in vivo. The recombination was performed in a two-hybrid test strain (L40a) expressing LexA-Gpa1; GAD-Ste4 fusions that were still able to interact with LexA-Gpa1 were selected. Plasmids were recovered and transformed into strain SDY109, which contains not only a deletion of chromosomal STE4, but has GPA1 under control of the methionine-repressible MET3 promoter. When this strain is grown in 2 mM methionine, expression of GPA1 is tightly repressed. In this situation, signaling-competent GAD-Ste4 molecules are free to signal to the downstream pathway, resulting in cell-cycle arrest and allowing the positive selection of nonsignaling GAD-Ste4 mutants.
This series of procedures produced a library enriched for full-length GAD-Ste4 fusions that were defective in signaling.
Ste4p mutants specifically defective in the interaction with Ste5p:
Out of 200 SDY109 transformants tested, 64 failed to mate with DC14 at 30°. Plasmids recovered from these were tested in two-hybrid blue colony assays with the LexA fusions. Of the mutant GAD-Ste4 species, 62 showed little or no interaction with LexA-Ste18. These also failed to interact with the LexA-Ste5 construct, which is understandable since Ste18p is required for the Ste4p-Ste5p interaction. Only two mutants, designated 39 and 57, were significantly defective in the LexA-Ste5 interaction while maintaining strong interactions with LexA-Ste18 (Figure 1A). Mutant 39 also had a reduced interaction with LexA-Gpa1 (Figure 1A). Neither mutant allowed mating of SDY109 at 30° (Figure 1B), nor did they induce the "shmoo" morphology characteristic of mating-competent cells (data not shown).
Sequencing revealed that mutant 39 had two amino acid changes, L49P and D224A, whereas mutant 57 had a single amino acid change, L65S. L49P, L65S, D224A and the previously identified dominant-negative mutation D62N (![]()
|
As an additional control, the mutant GAD-Ste4 constructs were tested in their interactions with LexA-Akr1. In quantitative assays, Ste4 L65S and D62N maintained strong interactions with Akr1p (Table 2). However, L49P and L49A both had a significantly reduced interaction with LexA-Akr1 (Figure 1C and Table 2). Therefore, although L49 and L65 mutations are similarly defective in their interactions with Ste5p, they are distinguishable in their interactions with Akr1p.
Mapping of the Ste4p mutations on a structural model:
Comparison with the crystal structure of the bovine Gi
1ß1
2 heterotrimer (![]()
![]()
|
Ste4 L65S is temperature-sensitive:
Strains expressing the Ste4 L65S mutant as the only Ste4p species were unable to mate at 30°, but mated efficiently when incubated at 20° (see below). In two-hybrid assays, quantitative ß-galactosidase measurements showed that while at 30° the interaction between Ste4 L65S and the LexA-Ste5 construct was barely measurable, at 20° this interaction was restored almost to the level seen with wild-type GAD-Ste4 (Table 3). The interactions of GAD-Ste4, Ste4 L49P, and Ste4 L65S with LexA-Ste18 were all slightly higher at 20° than at 30°. However, the ratios of activities of the Ste4p mutants compared to the GAD-Ste4 control were not significantly different at the two temperatures. The interactions between Ste4p and Ste4 L65S with Akr1p were both slightly increased at the higher temperature. Therefore, the temperature-sensitive signaling phenotype of Ste4 L65S correlates directly with a tightly temperature-sensitive two-hybrid interaction of this molecule with Ste5p, and suggests that the mating defect of this Ste4p mutant at 30° is not due to a reduced interaction with Ste18p.
|
Ste5p residues defective in the interaction with Ste4p:
Random mutagenesis of Ste5p failed to identify mutants able to suppress the Ste4 L49P or Ste4 L65S mutations. Therefore we investigated the effect of directed mutations in Ste5p on the interaction with Ste4p. A schematic representation of Ste5p is shown in Figure 3A. The first 214 amino acids of Ste5p are sufficient for interaction with Ste4p in the two-hybrid assay (![]()
|
|
In contrast, conservative mutations in the RING-H2 domain, depicted in Figure 3B, affected Ste4p binding (Figure 4). Ste5 L196A showed a small but measurable defect in the interaction with wild-type Ste4p, and with Ste4 D62N, as observed by a slightly reduced size in the discs of growth on 3-amino-triazole plates. However, when combined with the Ste5 L196A mutant, the Ste4 L65S interaction observed at 20° was abolished. Ste5 L201A had a less severe but measurable defect in the interaction with Ste4 L65S at 20°. A Ste5 L196A/L201 double mutation was similar to the single L196A mutation. Mutation of L173A or L179A had no measurable effects (data not shown).
|
A synthetic mating defect of Ste4p and Ste5p mutants:
To ascertain the biological significance of the Ste4p and Ste5p two-hybrid mutants, Ste4 L49P, L65S, D62N, and L49A were reconstructed in Ste4p tagged with the HA epitope; Ste5 L196A, L201A, and the L196A/L201A double mutant were reconstructed in full-length Ste5p. The constructs were expressed in a strain (SDY110) deleted for chromosomal STE4 and STE5 and signal transduction was assessed in mating assays. Strains expressing wild-type Ste4p, in combination with wild-type Ste5p, or any of the Ste5p mutants, could mate at all temperatures tested (Figure 5A). However, strains expressing Ste4 L49P as the only Ste4p species failed to mate at any temperature, irrespective of the Ste5p species. Strains expressing Ste4 L65S in combination with wild-type Ste5p failed to mate at 30°, but could mate at lower temperatures. However, when the Ste5 L196A mutant was introduced, mating was not observed at any temperature.
|
The Ste4 D62N mutant was also found to be temperature-sensitive, supporting weak mating in combination with wild-type Ste5p at lower temperatures. This signaling was also abolished in combination with the Ste5 L196A mutant. Because D62N alone has no apparent defect in the interaction with wild-type Ste5p, this synthetic effect may be due to combining the enfeebled signaling capability of D62N with the slight interaction defect of Ste5 L196A.
Immunoblotting confirmed that the Ste4p and Ste5p mutant proteins were all expressed at levels similar to the wild-type proteins (Figure 5, B and C). Therefore the signaling defects are unlikely to be caused by instability or reduced expression of the Ste4p and Ste5p mutant proteins.
| DISCUSSION |
|---|
We have identified two leucine residues in the amino terminus of Ste4p that appear to be specifically required for the interaction with Ste5p. Both residues contribute to the hydrophobic coiled-coil interface that Ste4p is predicted to form with Ste18p on the basis of homology and modeling of the Gpa1p/Ste4p/Ste18p complex on the crystal structure of mammalian Gi
1ß1
2 (![]()
![]()
![]()
![]()
![]()
![]()
structure these leucines are not obviously accessible for direct interaction with other proteins. Nevertheless, several pieces of evidence suggest that these findings are significant. First, in the quantitative two-hybrid interactions, L49P and L65S were almost completely defective in the Ste5p interaction, while having no detectable interaction defect with Gpa1p and a relatively slight interaction defect with Ste18p. Also, the temperature-sensitive mating defect caused by the Ste4 L65S mutant correlates with a striking temperature-sensitive interaction defect with Ste5p, whereas no significant temperature-sensitive two-hybrid interactions were observed with the other interacting partners. Finally, the mutations that we engineered in Ste5p provide supportive evidence that a hydrophobic interface may be involved in the interaction between the two proteins. The combination of the subtle Ste4 L65S and Ste5 L196A mutations has an effect both on the two-hybrid interaction and on signaling at the "permissive" temperature of the L65S mutant that is greatly in excess of the sum of the two individual mutations.
Since Ste18p is required for the interaction between Ste4p and Ste5p, it cannot be ruled out that a small defect in the Ste4p-Ste18p interaction in the two-hybrid assay reflects a conformational change sufficient to displace Ste5p binding from a distinct site on the Ste4 molecule. L49A and L65S are predicted to be structurally conservative but still affect the interaction with Ste18p, making it difficult to distinguish a direct from an indirect effect on Ste5p binding. However, it seems unlikely that such a dramatic effect on Ste5p binding would be caused by a relatively minor defect in Ste4p-Ste18p affinity. Furthermore, in our screen we identified other Ste4p mutants that were more severely defective in the Ste18p interaction but still able to bind Ste5p and signal (data not shown). Also, the Ste4p-Akr1p interaction was inhibited by the L49 mutations, consistent with the observation that this interaction requires Ste18p (![]()
coiled-coil. However, L65S did not affect Akr1p binding; therefore, the Ste4p-Ste5p and Ste4p-Akr1p interactions are distinguishable, and the Ste5p interaction defect caused by L65S is unlikely to be due to a major structural perturbation of the coiled-coil. Taken together these arguments may suggest a direct involvement of Ste4p L49 and L65 in the Ste5p interaction.
L49 and L65 are in close proximity to, but distinct from, residues identified as dominant negative mutations in Ste4p (K55, K59, and D62; ![]()
![]()
![]()
helices in the coiled-coil. The D62N and K55E mutations are defective in binding Ste20p (![]()
![]()
![]()
complexes may not reflect the actual conformation Ste4p/Ste18p adopts in the cell, if Ste4p is in fact constitutively associated with Ste5p.
The close proximity of the Ste20p and Ste5p binding sites is also interesting, and indicates that Ste4p may recruit Ste20p precisely to the vicinity of Ste5p and proteins known to be bound to Ste5p, such as Ste11p. The results may have implications for mammalian Gß
signaling. Although no studies have yet revealed direct involvement of mammalian Gß
coiled-coils in effector binding, the evolutionary conservation from yeast to mammals, together with recent identification that the Ste4p-binding site of Ste20p is conserved in mammalian Gß subunits (![]()
subtypes enabling, by combinatorial dimerization, many possible effector-binding specificities. The leucines that define the hydrophobic interface are among the most invariant residues in the coiled-coil. Therefore, although we identified a role for these leucines in Ste5p binding, other residues may be involved in mediating specificity in Gß
-effector interactions.
We have shown that residues in the RING-H2 domain of Ste5p are likely to contact Ste4p, although only part of the RING-H2 consensus is present in the LexA-Ste5 construct. If this model is correct, only the first of the two RING-H2 fingers is required to bind Ste4p. Two recent articles have also implicated the Ste5p RING-H2 domain in binding Ste4p. Ste5 C177S or Ste5 C177A C180A mutants were unable to complement the mating defect of a ste5
strain (![]()
![]()
![]()
![]()
The RING-H2 domain of Ste5p does not contain the consensus motif Gln-X-X-Glu-Arg identified as a putative Gß
-binding site in various mammalian proteins, including adenylyl cyclases, ß-adrenergic receptor kinases, phospholipase Cß, and a variety of ion channels (![]()
![]()
targets, and indeed, structural homologues of Ste5p remain to be identified. Gß
subunits are likely to have several distinct interaction interfaces as suggested by the number of Ste4p-binding partners and the diverse mammalian Gß
targets. Identification of the coiled-coil in effector binding is novel. However, interactions between zinc fingers and leucine zippers have been reported for a number of transcription factors, such as the glucocorticoid receptor and c-Jun (reviewed in ![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Cunle Wu and Ekkehard Leberer for plasmids, access to unpublished data, and useful discussions, and Robert Larocque for supplying plasmids. We also thank John Hillman for photography and Alan Lewis for assistance with the RasMol program. We are grateful to Mike Romanos and Mark Payton for support of this work.
Manuscript received June 3, 1998; Accepted for publication September 4, 1998.
| LITERATURE CITED |
|---|
ALANI, E., L. CAO, and N. KLECKNER, 1987 A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116:541-545
BIENSTOCK, R. J., T. DARDEN, R. WISEMAN, L. PEDERSEN, and J. C. BARRETT, 1996 Molecular modeling of the amino-terminal zinc RING domain of BRCA1. Cancer Res. 56:2539-2545
BORDEN, K. L. B. and P. S. FREEMONT, 1996 The RING finger domaina recent example of a sequence-structure family. Curr. Opin. Struct. Biol. 6:395-401[Medline].
CHEN, J. Q., M. DEVIVO, J. DINGUS, A. HARRY, and J. R. LI et al., 1995 A region of adenylyl cyclase 2 critical for regulation by G protein beta-gamma subunits. Science 268:1166-1169
CHIEN, C. T., P. L. BARTEL, and R. STERNGLANZ, 1991 The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA 88:9578-9582
CHOI, K. Y., B. SATTERBERG, D. M. LYONS, and E. A. ELION, 1994 Ste5 tethers multiple protein kinases in the MAP kinase cascade required for mating in S. cerevisiae.. Cell 78:499-512[Medline].
CLARK, K. L., D. DIGNARD, D. Y. THOMAS, and M. WHITEWAY, 1993 Interactions among the subunits of the G protein involved in Saccharomyces cerevisiae mating. Mol. Cell. Biol. 13:1-8
COOK, J. G., L. BARDWELL, and J. THORNER, 1997 Inhibitory and activating functions for MAPK Kss1 in the S. cerevisiae filamentous-growth signalling pathway. Nature 390:85-88[Medline].
CRESPO, P., N. XU, W. F. SIMONDS, and J. S. GUTKIND, 1994 Ras-dependent activation of MAP kinase pathway mediated by G protein beta-gamma subunits. Nature 369:418-420[Medline].
DEWAARD, M., H. Y. LIU, D. WALKER, V. E. S. SCOTT, and C. A. GURNETT, 1997 Direct binding of G protein beta-gamma complex to voltage-dependent calcium channels. Nature 385:446-450[Medline].
FAURE, M., T. A. VOYNO-YASENETSKAYA, and H. BOURNE, 1994 cAMP and beta-gamma subunits of heterotrimeric G proteins stimulate the mitogen-activated protein kinase pathway in COS-7 cells. J. Biol. Chem. 269:7851-7854
FEDERMAN, A. D., B. R. CONKLIN, K. A. SCHRADER, R. R. REED, and H. BOURNE, 1992 Hormonal stimulation of adenylyl cyclase through G protein beta-gamma subunits. Nature 356:159-161[Medline].
FENG, Y. Y., L. Y. SONG, E. KINCAID, S. K. MAHANTY, and E. A. ELION, 1998 Functional binding between G beta and the LIM domain of Ste5 is required to activate the MEKK Ste11. Curr. Biol. 8:267-278[Medline].
GAUDET, R., A. BOHM, and P. B. SIGLER, 1996 Crystal structure at 2.4 angstrom resolution of the complex of transducin beta-gamma and its regulator, phosducin. Cell 87:577-588[Medline].
GIETZ, D., A. ST. JEAN, R. A. WOODS, and R. H. SCHIESTL, 1992 Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425
GIVAN, S. A. and G. F. SPRAGUE, 1997 The ankyrin repeat-containing protein Akr1p is required for the endocytosis of yeast pheromone receptors. Mol. Biol. Cell 8:1317-1327[Abstract].
GRISHIN, A. V., J. L. WEINER, and K. J. BLUMER, 1994 Biochemical and genetic analysis of dominant-negative mutations affecting a yeast G protein gamma subunit. Mol. Cell. Biol. 14:4571-4578
HAMM, H. E., 1998 The many faces of G protein signaling. J. Biol. Chem. 273:669-672
HARSHMAN, K. D., W. S. MOYE-ROWLEY, and C. S. PARKER, 1988 Transcriptional activation by the SV40 AP-1 recognition element in yeast is mediated by a factor similar to AP-1 that is distinct from Gcn4. Cell 53:321-330[Medline].
HASSON, M. S., D. BLINDER, J. THORNER, and D. D. JENNESS, 1994 Mutational activation of the STE5 gene product bypasses the requirement for G protein beta and gamma subunits in the yeast pheromone response pathway. Mol. Cell. Biol. 14:1054-1065
INOUYE, C., N. DHILLON, and J. THORNER, 1997 Ste5 RING-H2 domain: role in Ste4-promoted oligomerization for yeast pheromone signaling. Science 278:103-106
KAO, L. R., J. PETERSON, R. JI, L. BENDER, and A. BENDER, 1996 Interactions between the ankyrin repeat-containing protein Akr1p and the pheromone response pathway in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:168-178[Abstract].
KATZ, A., D. WU, and M. I. SIMON, 1992 Subunits beta-gamma of heterotrimeric G protein activate beta 2 isoform of phospholipase C. Nature 360:686-689[Medline].
KLUG, A. and J. W. R. SCHWABE, 1995 Protein motifs 5. Zinc fingers. FASEB J. 9:597-604[Abstract].
KOCH, W. J., B. E. HAWES, L. F. ALLEN, and R. J. LEFKOWITZ, 1994 Direct evidence that Gi-coupled receptor stimulation of mitogen-activated protein kinase is mediated by G beta-gamma activation of p21ras. Proc. Natl. Acad. Sci. USA 91:12706-12710
KRANZ, J. E., B. SATTERBERG, and E. A. ELION, 1994 The MAP kinase Fus3 associates with and phosphorylates the upstream signaling component Ste5. Genes Dev. 8:313-327
KUNKEL, T. A., J. D. ROBERTS, and R. A. ZAKOUR, 1987 Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382[Medline].
LAEMMLI, U. K., 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
LAMBRIGHT, D. G., J. SONDEK, A. BOHM, N. P. SKIBA, and H. E. HAMM et al., 1996 The 2.0 angstrom crystal structure of a heterotrimeric G protein. Nature 379:311-319[Medline].
LEBERER, E., D. DIGNARD, D. HARCUS, D. Y. THOMAS, and M. WHITEWAY, 1992a The protein kinase homologue Ste20p is required to link the yeast pheromone response G protein beta-gamma subunits to downstream signalling components. EMBO J. 11:4815-4824[Medline].
LEBERER, E., D. DIGNARD, L. HOUGAN, D. Y. THOMAS, and M. WHITEWAY, 1992b Dominant-negative mutants of a yeast G protein beta subunit identify two functional regions involved in pheromone signalling. EMBO J. 11:4805-4813[Medline].
LEBERER, E., D. Y. THOMAS, and M. WHITEWAY, 1997 Pheromone signalling and polarized morphogenesis in yeast. Curr. Opin. Genet. Dev. 7:59-66[Medline].
LEEUW, T., A. FOUREST-LIEUVIN, C. WU, J. CHENEVERT, and K. CLARK et al., 1995 Pheromone response in yeast: association of Bem1p with proteins of the MAP kinase cascade and actin. Science 270:1210-1213
LEEUW, T., C. L. WU, J. D. SCHRAG, M. WHITEWAY, and D. Y. THOMAS et al., 1998 Interaction of a G protein beta subunit with a conserved sequence in Ste20/PAK family protein kinases. Nature 391:191-195[Medline].
MA, J. Y., W. A. CATTERALL, and T. SCHEUER, 1997 Persistent sodium currents through brain sodium channels induced by G protein beta-gamma subunits. Neuron 19:443-452[Medline].
MACKAY, V. L., 1983 Cloning of yeast STE genes in 2 micron vectors. Methods Enzymol. 101:325-343[Medline].
MADHANI, H. D., C. A. STYLES, and G. R. FINK, 1997 MAP kinases with distinct inhibitory functions impart signaling specificity during yeast differentiation. Cell 91:673-684[Medline].
MARCUS, S., A. POLVERINO, M. BARR, and M. WIGLER, 1994 Complexes between Ste5 and components of the pheromone-responsive mitogen-activated protein kinase module. Proc. Natl. Acad. Sci. USA 91:7762-7766
MILLER, J. H., 1972 Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
MIYAJIMA, I., M. NAKAFUKU, N. NAKAYAMA, and C. BRENNER, 1987 GPA1, a haploid-specific essential gene, encodes a yeast homolog of mammalian G protein which may be involved in mating factor signal transduction. Cell 50:1011-1019[Medline].
MOUNTAIN, H. A. and C. KORCH, 1991 TDH2 is linked to MET3 on chromosome X of Saccharomyces cerevisiae.. Yeast 7:873-880[Medline].
MUHLRAD, D., R. HUNTER, and R. PARKER, 1992 A rapid method for localized mutagenesis of yeast genes. Yeast 8:79-82[Medline].
NEER, E. J., 1994 G proteins: critical control points for transmembrane signals. Prot. Sci. 3:3-14[Abstract].
NERN, A. and R. A. ARKOWITZ, 1998 A GTP-exchange factor required for cell orientation. Nature 391:195-198[Medline].
PITCHER, J. A., J. INGLESE, J. B. HIGGINS, J. L. ARRIZA, and P. J. CASEY, 1992 Role of beta-gamma subunits of G proteins in targeting the beta-adrenergic receptor kinase to membrane-bound receptors. Science 257:1264-1267
PRYCIAK, P. M. and L. H. HARTWELL, 1996 AKR1 encodes a candidate effector of the G beta-gamma complex in the Saccharomyces cerevisiae pheromone response pathway and contributes to control of both cell shape and signal transduction. Mol. Cell. Biol. 16:2614-2626[Abstract].
PUMIGLIA, K. M., H. LEVINE, T. HASKE, T. HABIB, and R. JOVE, 1995 A direct interaction between G protein beta-gamma subunits and the raf-1 protein kinase. J. Biol. Chem. 270:14251-14254
RAMER, S. W. and R. W. DAVIS, 1993 A dominant truncation allele identifies a gene, STE20, that encodes a putative protein kinase necessary for mating in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 90:452-456
ROBERTS, R. L. and G. R. FINK, 1994 Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev. 8:2974-2985
SAIKI, R. K., D. H. GELFAND, S. STOFFEL, S. J. SCHARF, and R. HIGUCHI, 1988 Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491
SCHULE, R. and R. M. EVANS, 1991 Cross-coupling of signal transduction pathways: zinc finger meets leucine zipper. Trends Genet. 7:377-381[Medline].
SHERMAN, F., 1991 Getting started with yeast. Methods Enzymol. 194:3-21[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27
SOLLERBRANT, K., G. AKUSJARVI, S. LINDER, and C. SVENSSON, 1995 The DNA binding domains of the yeast Gal4 and human c-jun transcription factors interact through the zinc-finger and BZIP motifs. Nucleic Acids Res. 23:588-594
SONDEK, J., A. BOHM, D. G. LAMBRIGHT, H. E. HAMM, and P. B. SIGLER, 1996 Crystal structure of a G protein beta-gamma dimer at 2.1-angstrom resolution. Nature 379:369-374[Medline].
SPAIN, B. H., D. KOO, M. RAMAKRISHNAN, B. DZUDZOR, and J. COLICELLI, 1995 Truncated forms of a novel yeast protein suppress the lethality of a G protein alpha subunit deficiency by interacting with the beta subunit. J. Biol. Chem. 270:25435-25444
STOTZ, A. and P. LINDER, 1990 The ADE2 gene from Saccharomyces cerevisiae: sequence and new vectors. Gene 95:91-98[Medline].
TANG, W. J. and A. G. GILMAN, 1991 Type-specific regulation of adenylyl cyclase by G protein beta-gamma subunits. Science 254:1500-1503
VOJTEK, A. B., S. M. HOLLENBERG, and J. A. COOPER, 1993 Mammalian ras interacts directly with the serine/threonine kinase raf. Cell 74:205-214[Medline].
WALL, M. A., D. E. COLEMAN, E. LEE, J. A. INIGUEZ-LLUHI, and B. A. POSNER et al., 1995 The structure of the G protein heterotrimer Gi
1ß1
2. Cell 83:1047-1058[Medline].
WHITEWAY, M., L. HOUGAN, D. DIGNARD, D. Y. THOMAS, and L. BELL et al., 1989 The STE4 and STE18 genes of yeast encode potential beta and gamma subunits of the mating factor receptor-coupled G protein. Cell 56:467-477[Medline].
WHITEWAY, M., D. DIGNARD, and D. Y. THOMAS, 1992 Mutagenesis of Ste18, a putative G gamma subunit in the Saccharomyces cerevisiae pheromone response pathway. Biochem. Cell Biol. 70:1230-1237[Medline].
WHITEWAY, M. S., C. WU, T. LEEUW, K. CLARK, and A. FOUREST-LIEUVIN et al., 1995 Association of the yeast pheromone response G protein beta-gamma subunits with the MAP kinase scaffold Ste5p. Science 269:1572-1575
WICKMAN, K. D., J. A. INIGUEZ-LLUHI, P. A. DAVENPORT, and R. TAUSSIG, 1994 Recombinant G protein beta-gamma-subunits activate the muscarinic-gated atrial potassium channel. Nature 368:255-257[Medline].
WU, C., M. WHITEWAY, D. Y. THOMAS, and E. LEBERER, 1995 Molecular characterization of Ste20p, a potential mitogen-activated protein or extracellular signal-regulated kinase kinase (MEK) kinase kinase from Saccharomyces cerevisiae.. J. Biol. Chem. 270:15984-15992
ZAMPONI, G. W., E. BOURINET, D. NELSON, J. NARGEOT, and T. P. SNUTCH, 1997 Crosstalk between G proteins and protein kinase C mediated by the calcium channel alpha (1) subunit. Nature 385:442-446[Medline].
ZHAO, Z. S., T. LEUNG, E. MANSER, and L. LIM, 1995 Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator Cdc24p. Mol. Cell. Biol. 15:5246-5257[Abstract].
This article has been cited by other articles:
![]() |
N. A. Lambert Dissociation of Heterotrimeric G Proteins in Cells Sci. Signal., June 24, 2008; 1(25): re5 - re5. [Abstract] [Full Text] [PDF] |
||||