- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Farman, M. L.
- Articles by Leong, S. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Farman, M. L.
- Articles by Leong, S. A.
Chromosome Walking to the AVR1-CO39 Avirulence Gene of Magnaporthe grisea: Discrepancy Between the Physical and Genetic Maps
Mark L. Farman1,a and Sally A. Leonga,ba Department of Plant Pathology, University of Wisconsin, Madison, Wisconsin 53706
b USDA-ARS Plant Disease Resistance Research Unit, University of Wisconsin, Madison, Wisconsin 53706
Corresponding author: Sally A. Leong, Department of Plant Pathology and USDA-ARS Plant Disease Resistance Research Unit, University of Wisconsin, Madison, WI 53706., sal{at}plantpath.wisc.edu (E-mail).
Communicating editor: P. J. PUKKILA
| ABSTRACT |
|---|
The avrCO39 gene conferring avirulence toward rice cultivar CO39 was previously mapped to chromosome 1 of Magnaporthe grisea between cosegregating markers CH5-120H and 1.2H and marker 5-10-F. In the present study, this region of the chromosome was physically mapped using RecA-mediated Achilles' cleavage. Cleavage of genomic DNA sequences within CH5-120H and 5-10-F liberated a 610-kb restriction fragment, representing the physical distance between these markers. Chromosome walking was initiated from both markers but was curtailed due to the presence of repetitive DNA sequences and the absence of overlapping clones in cosmid libraries representing several genome equivalents. These obstacles were overcome by directly subcloning the target region after release by Achilles' cleavage and a contig spanning avrCO39 was thus assembled. Transformation of two cosmids into a virulent recipient strain conferred a cultivar-specific avirulence phenotype thus confirming the cloning of avrCO39. Meiotic crossover points were unevenly distributed across this chromosomal region and were clustered around the avrCO39 locus. A 14-fold variation in the relationship between genetic and physical distance was measured over the avrCO39 chromosomal region. Thus the poor correlation of physical to genetic distance previously observed in M. grisea appears to be manifested over relatively short distances.
MAGNAPORTHE grisea causes a devastating disease of rice known as rice blast. Whether the fungus is able to grow on a rice cultivar is determined by the interaction of avirulence gene (AVR/avr) products in the fungus with resistance gene products in the host (![]()
![]()
![]()
![]()
![]()
Chromosome walking has been instrumental in the cloning of genes from many organisms. For example, several human disease genes have been cloned using such approaches. Until recently, it was not possible to accurately assess the physical distance between markers flanking the target gene, and chromosome walks were initiated without prior knowledge of the distance to be covered. In well-developed systems for which YAC libraries are available, this may not be a serious concern because large sections of the genome can be covered in each step. However, if cosmid and
libraries are to be used, it is important to have knowledge of the distance involved, as it may be more expeditious to identify closer markers.
Several chromosome walks have been performed in filamentous fungal genomes such as those of Neurospora crassa (![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Bacterial and fungal strains and plasmids:
Escherichia coli strain DH5
(GIBCO BRL, Gaithersburg, MD) was used for all routine cloning experiments. M. grisea strains Guy11 and 2539 and 61 of their ascospore progeny have been described previously (![]()
![]()
Design of synthetic oligonucleotides for Achilles' cleavage experiments:
Marker CH5-120H contained two EcoRI sites. DNA sequence surrounding one of these sites was determined by subcloning the insert to place the site near a universal priming site in pBluescript KSII+ (Stratagene, La Jolla, CA).
All other markers were specified by cosmid clones. In these cases the cosmids were subjected to restriction analysis to identify BamHI fragments containing at least one EcoRI site. Candidate BamHI fragments were arbitrarily subcloned. The subclones were then restriction mapped to identify restriction sites within 300 bp of the EcoRI site in the subclone. These sites were then employed to generate further subclones to enable the DNA sequence spanning the EcoRI site to be determined using T3 and T7 primers flanking the multiple cloning site. Oligomers used were as follows: CH5-120H: 5' GGCGGGGGTCCAGAACGCTGATGTTCTCGTCGTTGGCATAGTCGACCGATGATCTCTTGGAATTCCGGTCGG 3'; 5-10-F: 5' CGAATCCTCGTCGGCATTACCACTGGCAGGTTGGATGACGAGGAGGTTCTGGAATTCGCAGG 3'; 43-2-H: 5'AATCATTACTCTCATCACTCACCATACGCTTCGGCCTACACATCACATCCGAATTCCGCATC 3'; and 18-2-F: 5' TGACGGTTGATTTATCCGACCCTGCATCTCAGTTCAGGTGTGCAAGCCTGGAATTCTGGCGT 3'.
RecA-assisted Achilles' cleavage:
Reactions were performed on 100 µl of microbead-embedded DNA (~2 µg), prepared by suspending ~5 x 108 protoplasts per milliliter of molten InCert agarose (FMC Bioproducts, Rockland, ME) and vortexing the suspension in mineral oil as described by ![]()
![]()
![]()
Chromosome walking strategy:
An ordered genomic DNA library of M. grisea strain 2539, consisting of 5184 clones, was constructed in cosmid vector pMLF1 (![]()
![]()
![]()
![]()
![]()
Preparation of subclones of a restriction fragment released by Achilles' cleavage:
Following CHEF electrophoresis, the 310-kb Achilles' cleavage product was briefly visualized by long wavelength UV illumination of the ethidium bromide-stained gel. A gel slice (~50 µl) containing the fragment was excised and equilibrated in 1 ml of TE buffer for 1 hr. The gel slice was then washed in 1 ml of restriction enzyme buffer (New England Biolabs buffer 3) for a period of 1 hr. This step was repeated for a total of three washes. Finally, excess buffer was removed, leaving just enough to cover the gel slice. Twenty units of BamHI (New England Biolabs) was then added and digestion was performed overnight at 37°. After digestion, the gel slice was equilibrated with TAE buffer. The DNA was then extracted from the gel slice using the Gene Clean procedure (BIO 101, Vista, CA).
Ten microliters of the purified restriction fragments was ligated overnight at 16° in a reaction volume of 20 µl with pBluescript KSII+ (Stratagene) that had been treated with BamHI and calf intestinal alkaline phosphatase (New England Biolabs). Ten microliters of this ligation mixture was transformed into DH5
(GIBCO BRL) using a standard protocol (![]()
RFLP mapping of cosmids containing subclones of the 290-kb Achilles' cleavage fragment:
Clones used to identify corresponding cosmids from the library had been shown to originate from the target region of the M. grisea genome by hybridization to Southern blots of CHEF-resolved cleavage products (Figure 4). These cosmids were mapped genetically within the AVR1-CO39 locus by determining RFLP marker segregation in 11 progeny that were recombinant in the genetic interval containing AVR1-CO39. Although the remaining 50 nonrecombinant progeny were not informative for mapping cosmids within the CH5-120H to 5-10-F interval, 7 of these progeny were included to reduce the likelihood of being misled by unexpected occurrences such as jumping to other chromosomes through repetitive DNA or chimeric cosmids.
|
|
|
|
Transformation of virulent strain Guy11 with cosmids within the AVR1-CO39 locus:
Cosmids from within the genetic interval containing AVR1-CO39 were introduced into Guy11 using the transformation protocol described in ![]()
Physical mapping of meiotic crossovers:
At each step of the walk, whole cosmids were labeled by nick translation and used as probes to screen for RFLPs between parental DNAs cut with five restriction enzymes (BamHI, DraI, EcoRI, HindIII, and PstI). Informative probe/enzyme combinations were then used to survey RFLP inheritance in recombinant progeny. For each recombinant progeny isolate, crossovers were revealed when adjacent cosmids identified RFLPs from opposite parents or when a single probe revealed RFLPs from each parent. These crossovers were localized to specific regions by assuming that they occurred midway between polymorphic restriction fragments, whose locations were based on several criteria: (i) If a RFLP was not shared by overlapping cosmids, it was concluded that the polymorphic fragment lay within the central portion of the cosmid insert. Conversely, if a RFLP was shared, it lay within the overlapping portion. (ii) If, in a single progeny DNA sample, a subset of the total RFLPs was inherited from each parent, it was concluded that the crossover point occurred within the region spanned by the cosmid insert. The locations of the informative RFLPs were again determined on the basis of whether they were shared by overlapping cosmids. For most crossovers, the level of resolution thus achieved was to within a window of ~20 kb. For the sliding window analysis, the locations of crossovers were assumed to lie at the midpoint of the window.
Analysis of the distribution of crossovers:
A graphical representation of crossover distribution across the 610-kb chromosome segment was obtained by plotting numbers of crossovers occurring in a 50-kb window that was slid in 20-kb steps across the region under study. The relationship of physical to genetic distance across the CH5-120H to 5-10-F interval was calculated as the distance between these markers (in kilobases) divided by the genetic distance (in centimorgans). The genetic distance was calculated by applying the Kosambi mapping function (![]()
| RESULTS |
|---|
Physical mapping of the end of the chromosome containing AVR1-CO39:
Achilles' cleavage of the 2539 genome resulted in the liberation of segments of the chromosome between the targeted cleavage sites. These fragments were resolved from the uncut chromosomes by CHEF electrophoresis. The conditions chosen for optimal separation of the cleavage products did not allow resolution of the uncut chromosomes that migrated as a single band in these experiments. In some cases, the cleavage products did not show up clearly in the agarose gel but were readily identified when Southern blots were hybridized with appropriate probes (Figure 1).
Achilles' cleavage within marker CH5-120H yielded a restriction fragment that was clearly resolved from the remaining intact chromosomes by CHEF electrophoresis and Southern hybridization with appropriate probes (Figure 1). The size of this fragment was estimated as 1.29 mb by virtue of its comigration with the correspondingly sized chromosome of Hansenula wingeii (Figure 1A and Figure B). Marker 1.2H (![]()
![]()
![]()
Chromosome walking towards AVR1-CO39:
A bidirectional chromosome walk was initiated from marker 1.2H in both directions. Cosmid 21-9-D, containing 1.2H, overlapped with 16-1-F, which identified a RFLP that mapped one map unit closer to AVR1-CO39. This recombination event established the correct orientation of the walk. The direction of the walk from marker 5-10-F was rapidly established by determining which of the two endclones from this cosmid hybridized to the 610-kb Achilles' cleavage product (results not shown). Nine steps from marker 1.2H, a cosmid was identified that contained a portion of the GRASSHOPPER retroelement (![]()
The chromosome walk from 5-10-F extended five steps and spanned four recombination points in the initial progeny population (Figure 2A). However it was not possible to identify a clone overlapping 18-2-F in the 2539 DNA library. A second library was constructed in pMLF2 and screened to bridge the gap, but no overlapping clones were identified in more than 10,000 additional cosmids surveyed.
Subcloning a restriction fragment released by Achilles' cleavage of chromosome 1 at markers 43-2-H and 18-2-F:
Oligonucleotide primers were designed to overlap restriction sites in the cosmids 43-2-H and 18-2-F, which were identified while chromosome walking towards AVR1-CO39 (indicated by triangles in Figure 2B). Achilles' cleavage of the chromosome at these sites resulted in the liberation of a 310-kb EcoRI fragment. This fragment was excised, digested with BamHI, and subcloned into pBluescript KSII+. A total of 104 subclones was obtained but it was anticipated that a proportion of the clones obtained in this manner would not be derived from the Achilles' cleavage product because some shearing had occurred during preparation of the chromosomal DNA (see Figure 1). Therefore, subclones were used as probes to Southern blots of CHEF gels in which the 310-kb fragment was resolved. Out of the first 12 subclones tested, 5 (subclones 3, 4, 7, 11, and 16) were derived from the target region and were judged to be single copy on the basis of their relative hybridization intensity to the 310-kb fragment and the uncut chromosome band (results not shown). The inserts in these clones were then used as probes to identify corresponding cosmids in the ordered library constructed in pMLF2.
Map locations of cosmids identified by subclones of the 310-kb Achilles' cleavage product:
RFLP analysis using entire cosmid clones as probes indicated that there was a considerable degree of polymorphism between the parental strains in this region of chromosome 1. A cosmid that contained subclones 3, 7, and 11 produced similar RFLP profiles to cosmid 16-5-1 and mapped at the same locus. Subclone 4 identified two cosmids, 7-4-D and 17-4-B, the latter of which identified four RFLPs (Figure 3A). Most progeny inherited all RFLPs from one or the other parent but isolates 6050, 6068, and 6081 inherited various subsets of these RFLPs from each parent. This indicated that the meiotic recombination events had actually occurred within the chromosomal region encompassed by the cosmid insert. As a result, one of the RFLPs (#1) cosegregated fully with AVR1-CO39 in the original mapping population and occurred 0.9 cM away when the progeny population was expanded for studying crossover distribution. The other RFLPs identified by 17-4-B map 1.8, 2.7, and 3.6 cM closer to 5-10-F (Figure 3B). Several cosmids were identified that contained subclone #16. One of these, cos6B, identified three RFLPs. One RFLP again cosegregated fully with AVR1-CO39 in the original progeny population (0.9 cM away in the expanded progeny population) while the others mapped 1.8 and 3.6 cM closer to 1.2H. We concluded from these studies that cosmids 17-4-B and cos6B flank AVR1-CO39 on the 5-10-F and 1.2H proximal sides, respectively.
Hybridization analysis established that there was not yet an overlap between cos6B and 17-4-B. Therefore, conventional chromosome walking was resumed to try to establish a contig encompassing the AVR1-CO39 gene. No cosmids extending beyond 17-4-B were identified among a total of 6912 clones in two ordered libraries. A total of 20,000 additional colonies (~20 genome equivalents) were screened and a single cosmid, cos18-1, was identified that extended ~16 kb beyond 17-4-B. The endclone of cos18-1 identified 13 cosmids in over 20,000 additional colonies screened and, although the ends of the inserts in many of these cosmids lay within 5 kb of the end of the contig, only one of these, cos18O3, extended further than cos18-1 and only by 800 bp. While walking towards this region from cos6B, several overlapping cosmids were identified. However, those that extended any significant distance beyond cos6B (including VIII-2) appeared to have been rearranged as their restriction maps were incongruent with a long-range physical map of the region (results not shown). Nevertheless, the end of the insert in an intact clone, cosVIII-1, was ~3 kb closer to AVR1-CO39. Together, these observations suggest that the chromosome region beyond cos18O3 and cosVIII-1 is not clonable in an intact form using a cosmid vector.
In total, over 100 independent cosmids were isolated during the walking process and over 500 kb of the chromosome was covered. A summary of the walk is shown in Figure 2A in which minimally overlapping clones and other landmark cosmids are depicted.
Transformation of Guy11 to avirulence with cosmids containing AVR1-CO39:
The 4.3-kb BamHI to NotI end-clone of cos18O3 did not hybridize to genomic DNA of the virulent M. grisea strain Guy11 (results not shown), suggesting that part of the AVR1-CO39 locus was deleted in this strain. It was hypothesized that Guy11 may have gained virulence to CO39 through deletion of the AVR1-CO39 gene. Therefore, protoplasts of Guy11 were transformed with cosmids possessing DNA that was within the deletion. Cosmids 18O3 and 18-1 both converted Guy11 to avirulence and transformants carrying these clones were unable to infect CO39. Their capability to infect cultivar 51583 was completely unaffected, confirming that the gene acted in a cultivar-specific manner. Transformants carrying an ApaI deletion derivative of 18O3, "18O3
A," were also able to confer avirulence to CO39 (Figure 4) and localized AVR1-CO39 activity to a 7.15-kb ApaI to NotI subclone of cos18O3. Transformants carrying cosmid cos18OA, which bears AVR1-CO39 with a deletion in a presumed promoter region, produced intermediate-sized lesions (results not shown), while transformants harboring cosmids cosVIII-2, cos11-1, and cos3-2, all of which lack AVR1-CO39 sequences, were unaffected in their infectivity to either CO39 (data not shown) or 51583.
Physical mapping of cosmid contigs:
As a result of directly subcloning portions of the chromosome from within the target region, it was not known how the new cosmid contigs centered around cos6B and 17-4-B were physically disposed with respect to those assembled in the initial chromosome walk. Therefore, it was not possible to physically map recombination points that were identified by cos6B, cosVIII-1, cos18O3, and 17-4-B. This limitation was overcome by applying Achilles' cleavage to map the distance between EcoRI sites within: (i) cosVIII-1 and 43-2-H and (ii) cos18O3 and 18-2-F. The sizes of the respective cleavage products revealed that cosVIII-1 lies 195 kb from 43-2-H and cos18O3 is 95 kb from 18-2-F. Additional cleavage reactions were performed with different oligonucleotide combinations to confirm these distances. A summary of these results and the physical map derived by the chromosome walking and Achilles' cleavage studies is shown in Figure 2B. By combining these data with distances determined by chromosome walking it was possible to create a comprehensive physical map of the CH5-120H to 5-10-F region (Figure 2B). These analyses revealed that AVR1-CO39 was considerably closer to 5-10-F than was expected based on its map location (Figure 2C).
Revised map location of AVR1-CO39:
The published map location of AVR1-CO39 is 11.8 cM from CH5-120H and 17.2 cM from 5-10-F (![]()
![]()
![]()
![]()
A 4.3-kb BamHI to NotI fragment containing the AVR1-CO39 gene detected three DraI fragments in 2539 but did not hybridize to genomic DNA of Guy11 (results not shown). Segregation analysis of this RFLP among a combined population of 109 progeny indicated that AVR1-CO39 actually lies 5.5 cM from CH5-120H (6 recombinant progeny out of 109) and 13.1 cM from 5-10-F (14 out of 109). Thus the total genetic distance between these markers is 18.6 cM, which equates to an average physical distance of ~33 kb/cM, or one crossover event every 30.5 kb.
Locations and distribution of crossovers:
All exchanges, except one, could be localized within sequences encompassed by cosmid clones. The exceptional crossover event occurred somewhere within the region of highly repetitive DNA and was poorly resolved to a 40-kb chromosome segment. In a related study, an anonymous GRASSHOPPER element was mapped to a location beyond this recombination point. For the sliding window analysis, a reasonable assumption was made that the mapped GRASSHOPPER corresponds to the element in cos16-5-1. It was clear that recombination was not distributed evenly across the CH5-120H to 5-10-F interval. For example, markers CH5-120H and 1.2H cosegregated fully and are ~80 kb apart (1 cM > 80 kb). Similarly, no recombination points were encountered between markers 16-1-F and 16-5-1, which are separated by ~150 kb (1 cM > 150 kb). In contrast, the inserts in cosmids cos6B and 17-4-B each detected three crossover points, implying that 1 cM < 10 kb. On the whole, recombination points appeared more evenly distributed within the rightmost cosmid contig and the pattern of recombination across the region was very similar between the first and second crosses (Figure 5A). A graphical representation of this distribution was made by performing a sliding window analysis using a 50-kb window size and plotting the number of crossovers in a window against the window position. This analysis highlighted recombinational clusters surrounding the AVR1-CO39 locus and at marker 39-5-B (Figure 5B).
|
Results obtained from three window sizes (300, 200, and 150 kb) indicated that variation of the window width altered the relationship between genetic and physical distance. This was expected because, at certain positions in the physical map, the increased window width did not encompass additional crossovers. Nevertheless, in all cases, a recombinational gradient was measured across the interval under study with the difference in the kb/cM ratio reaching as high as 14-fold using the 200-kb window in which 1 cM represented as much as 218 kb at the CH5-120H end of the interval but equated to 16 kb in regions surrounding the AVR1-CO39 locus (Figure 5C). Interestingly, the kb/cM ratio was unaffected by window size in the recombinationally active portion of the chromosome region under study (Figure 5C).
| DISCUSSION |
|---|
At least five genetic maps of M. grisea have been constructed (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The genetic distance of 18.6 cM between the markers flanking AVR1-CO39 seems large when compared to distances in organisms with larger genomes, where 1 cM can represent 1 Mb. However, earlier physical mapping studies at the other end of chromosome 1 had indicated that 1 cM represents approximately 50 kb (![]()
![]()
![]()
![]()
![]()
![]()
![]()
A physical distance of 610 kb between flanking markers CH5-120H and 5-10-F indicated that a chromosome walk of ~300 kb from each marker was certain to result in the cloning of the gene. As this physical distance was not overly large, we chose to initiate a walk rather than try to identify closer markers. At the inception of the walk we were led astray by the genetic proximity of AVR1-CO39 to markers CH5-120H and 1.2H and as a result, a greater emphasis was placed on assembling a contig from these markers. In retrospect this was an unwise strategy due to the uneven distribution of recombination points, and we hope that our findings will alert others to the pitfalls associated with such an approach.
The cloning of AVR1-CO39 described here represents one of the most extensive walks performed in M. grisea to date, and one of the largest walks in a filamentous fungal genome. All possible obstacles were encountered including occasional chimeric clones, complex arrays of repetitive elements, and chromosome regions that were apparently uncloneable in E. coli. Interestingly, ![]()
The disparity in the relationship between genetic and physical distance was great. For example, while walking from 1.2H, over 150 kb was traversed (from cosmids 16-1-F to 16-5-1) without encountering a single crossover. By contrast, a crossover was identified in almost every step while walking from 5-10-F, and cosmids 6B and 17-4-B, which defined the boundaries of the AVR1-CO39 locus, each spanned three crossover points. Over the interval studied, which represents ~1.5% of the 38 Mb M. grisea genome (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Three recombinational clusters were revealed, one on each side of the AVR1-CO39 locus and one centered around the cosmid marker 39-5-B (Figure 5C). There was a recombination-deficient area in the middle of the avirulence gene locus that corresponded to a 20-kb deletion/insertion polymorphism between the parents. Clearly this prevents sequences within the deletion/insertion from partaking in crossovers. Interestingly, there appeared to be a compensatory elevation of crossing over in the immediate flanking DNA regions.
The finding that the distribution of crossover points encountered while walking resulted in a poor correlation between the genetic and physical maps is in contrast with the reported distribution of crossovers in other filamentous fungi such as A. nidulans and N. crassa (![]()
![]()
![]()
The AVR1-CO39 avirulence gene was first identified by ![]()
![]()
![]()
Measurement of disease severity can be prone to subjective interpretation. However, the cloning of AVR1-CO39 confirmed that the phenotypic scores used to map the gene (![]()
| FOOTNOTES |
|---|
1 Present address: Department of Plant Pathology, University of Kentucky, Lexington, KY 40546. ![]()
| ACKNOWLEDGMENTS |
|---|
This work was supported by the United States Department of Agriculture and by a grant from the Rockefeller Foundation to S.A.L.
Manuscript received September 9, 1997; Accepted for publication July 2, 1998.
| LITERATURE CITED |
|---|
AN, Z., M. L. FARMAN, A. D. BUDDE, S. TAURA, and S. A. LEONG, 1996 New cosmid vectors for library construction, chromosome walking and restriction mapping in filamentous fungi. Gene 176:93-96[Medline].
ARONSON, B. D., K. A. JOHNSON, Q. LIU, and J. C. DUNLAP, 1992 Molecular analysis of the Neurospora clock: cloning and characterization of the frequency and period genes. Chronobiol. Int. 9:231-239[Medline].
BONMAN, J. M., 1992 Durable resistance to rice blast diseaseenvironmental influences. Euphytica 63:115-123.
BOURETT, T. M. and R. J. HOWARD, 1990 In vitro development of penetration structures in the rice blast fungus Magnaporthe grisea.. Can. J. Bot. 68:329-342.
BOWDEN, D. W., H. MÜLLER-KAHLE, T. R. FULTON, T. C. GRAVIUS, and D. F. BARKER et al., 1988 Studies on locus expansion, library representation, and chromosome walking using an efficient method to screen cosmid libraries. Gene 71:391-400[Medline].
CARRIBO, A., E. SPORENO, G. MACINO, and P. BALLARIO, 1991 CMB1, a Neurospora crassa genomic cosmid library in pAC3 and its use for walking on the right arm of linkage group VII. Fungal Genet. Newsl. 38:68-70.
CENTOLA, M. and J. CARBON, 1994 Cloning and characterization of centromeric DNA from Neurospora crassa.. Mol. Cell. Biol. 14:1510-1519
CHUMLEY, F. G. and B. VALENT, 1990 Genetic analysis of melanin-deficient, nonpathogenic mutants of Magnaporthe grisea.. Mol. Plant-Microbe Interact. 3:135-143.
DAVIS, C. R., R. R. KEMPAINEN, M. S. SRODES, and C. R. MCCLUNG, 1994 Correlation of the physical and genetic maps of the centrometric region of the right arm of linkage group III of Neurospora crassa.. Genetics 136:1297-1306[Abstract].
DIOH, W., D. THARREAU, R. GOMEZ, E. ROUMEN, M. ORBACH et al., 1996 Mapping avirulence genes in the rice blast fungus Magnaporthe grisea, pp. 916920 in Rice Genetics III, edited by G. S. KHUSH. International Rice Research Institute, Philippines.
DOBINSON, K. F., R. E. HARRIS, and J. E. HAMER, 1993 Grasshopper, a long terminal repeat (LTR) retroelement in the phytopathogenic fungus Magnaporthe grisea.. Mol. Plant-Microbe Interact. 6:114-126[Medline].
FARMAN, M. L. and S. A. LEONG, 1995 Genetic and physical mapping of telomeres in the rice blast fungus, Magnaporthe grisea.. Genetics 140:479-492[Abstract].
FARMAN, M. L., Y. TOSA, N. NITTA, and S. A. LEONG, 1996 MAGGY, a retrotransposon found in the genome of the rice blast fungus, Magnaporthe grisea.. Mol. Gen. Genet. 251:665-674[Medline].
FERRIN, L. J. and R. D. CAMERINI-OTERO, 1991 Selective cleavage of human DNA: RecA-Assisted Restriction Endonuclease (RARE) cleavage. Science 254:1494-1497
GIASSON, L., C. A. SPECHT, C. MILGRIM, C. P. NOVOTNY, and R. C. ULLRICH, 1989 Cloning and comparison of Aa mating-type alleles of the basidiomycete Schizophyllum commune.. Mol. Gen. Genet. 218:72-77[Medline].
HAMER, J. E., L. FARRALL, M. J. ORBACH, B. VALENT, and F. G. CHUMLEY, 1989 Host species-specific conservation of a family of repeated DNA sequences in the genome of a fungal plant pathogen. Proc. Natl. Acad. Sci. USA 86:9981-9985
HAYASHI, N., and H. NAITO, 1994 Genome mapping of Magnaporthe grisea, p. 590 in Rice Blast Disease, edited by R. S. ZEIGLER, S. A. LEONG and P. S. TENG. CAB International, Wallingford, U.K.
HULL, E. P., P. M. GREEN, H. N. ARST, JR., and C. SCAZZOCCHIO, 1989 Cloning and physical characterization of the L-proline catabolism cluster of Aspergillus nidulans.. Mol. Microbiol. 3:553-559[Medline].
KANG, S. and R. L. METZENBERG, 1990 Molecular analysis of nuc-1+, a gene controlling phosphorus acquisition in Neurospora crassa.. Mol. Cell. Biol. 10:5839-5848
KANG, S., J. A. SWEIGARD, and B. VALENT, 1995 The PWL host specificity gene family in the blast fungus Magnaporthe grisea. Mol. Plant-Microbe Interact. 8:939-948[Medline].
KEEN, N. T., 1990 Gene-for-gene complementarity in plant-pathogen interactions. Annu. Rev. Genet. 24:447-463[Medline].
KOOB, M., A. BURKIEWICZ, J. KUR, and W. SZYBALSKI, 1992 RecA-AC: Single-site cleavage of plasmids and chromosomes at any predetermined restriction site. Nucleic Acids Res. 20:5831-5836
KOSAMBI, D. D., 1944 The estimation of map distances from recombination values. Ann. Eugen. 12:172-175.
LANDER, E. S., P. GREEN, J. ABRAHAMSON, A. BARLOW, and M. J. DALY et al., 1987 MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomica 1:174-181.
LEONG, S. A., M. L. FARMAN, J. A. SMITH, A. D. BUDDE, Y. TOSA et al., 1994 Molecular-genetic approach to the study of cultivar specificity in the rice blast fungus, pp. 87110 in Rice Blast Disease, edited by R. S. ZEIGLER, S. A. LEONG and P. S. TENG. CAB International, Wallingford, UK (in association with the International Rice Research Institute, Philippines).
LEUNG, H., E. S. BORROMEO, M. A. BERNARDO, and J. L. NOTTEGHEM, 1998 Genetic analysis of virulence in the rice blast fungus Magnaporthe grisea. Phytopathology 78:1227-1233.
LEUNG, H., U. LEHTINEN, R. KARJALAINEN, D. SKINNER, and P. TOOLEY et al., 1990 Transformation of the rice blast fungus, Magnaporthe grisea to hygromycin B resistance. Curr. Genet. 17:409-411[Medline].
LINTS, R., M. DAVIS, and M. HYNES, 1995 A chromosome walk linking the gatA and alcC genes of Aspergillus nidulans. Fungal Genet. Newsl. 42:44-45.
MANDEL, M. A., V. W. CROUCH, U. P. GUNAWARDENA, T. M. HARPER, and M. J. ORBACH, 1997 Physical mapping of the Magnaporthe grisea AVR1-MARA locus reveals the virulent allele contains two deletions. Mol. Plant-Microbe Interact. 10:1102-1105.
MAUTINO, M. R., S. D. HAEDO, and A. L. ROSA, 1993 Physical mapping of meiotic crossover events in a 200 kb region of Neurospora crassa linkage group I. Genetics 134:1077-1083[Abstract].
NITTA, N., M. L. FARMAN, and S. A. LEONG, 1997 Genome organization of Magnaporthe grisea: integration of genetic maps, clustering of transposable elements and identification of genome duplications and rearrangements. Theor. Appl. Genet. 95:20-32.
ROMAO, J. and J. E. HAMER, 1992 Genetic organization of a repeated DNA sequence family in the rice blast fungus. Proc. Natl. Acad. Sci. USA 89:5316-5320
ROSA, A. L., S. D. HAEDO, E. D. TEMPORINI, G. A. BORIOLI, and M. R. MAUTINO, 1997 Mapping chromosome landmarks in the centromere I region of Neurospora crassa.. Fungal Genet. Cell Biol. 21:315-322.
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SKINNER, D. Z., A. D. BUDDE, M. L. FARMAN, J. R. SMITH, and H. LEUNG et al., 1993 Genome organization of the rice blast fungus, Magnaporthe grisea: genetic map, electrophoretic karyotype and occurrence of repeated DNAs. Theor. Appl. Genet. 87:545-557.
SMITH, J. R. and S. A. LEONG, 1994 Mapping of a Magnaporthe grisea locus affecting rice (Oryza sativa) cultivar specificity. Theor. Appl. Genet. 88:901-908.
SWEIGARD, J. A., B. VALENT, M. J. ORBACH, A. M. WALTER, A. RAFALSKI et al., 1993 Genetic map of the rice blast fungus Magnaporthe grisea (n = 7), pp. 3.1123.114 in Genetic Maps, Ed. 6, edited by S. J. O'BRIEN. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SWEIGARD, J. A., A. CARROL, S. KANG, L. FARRALL, and F. G. CHUMLEY et al., 1995 Identification, cloning, and characterization of PWL2, a gene for host species specificity in the rice blast fungus. Plant Cell 7:1221-1233[Abstract].
VALENT, B., and F. G. CHUMLEY, 1994 Avirulence genes and mechanisms of genetic instability in the rice blast fungus, pp. 111134 in Rice Blast Disease, edited by R. S. ZEIGLER, S. A. LEONG and P. S. TENG. CAB International, Wallingford, UK (in association with the International Rice Research Institute, Philippines).
VALENT, B., L. FARRALL, and F. G. CHUMLEY, 1991 Magnaporthe grisea genes for pathogenicity and virulence identified through a series of backcrosses. Genetics 127:87-101[Abstract].
ZEIGLER, R. S., L. X. CUOC, R. P. SCOTT, M. A. BERNADO, and D. CHEN et al., 1995 The relationship between lineage and virulence in Pyricularia grisea in the Philippines. Phytopathology 85:443-451.
This article has been cited by other articles:
![]() |
B. C. Couch, I. Fudal, M.-H. Lebrun, D. Tharreau, B. Valent, P. van Kim, J.-L. Notteghem, and L. M. Kohn Origins of Host-Specific Populations of the Blast Pathogen Magnaporthe oryzae in Crop Domestication With Subsequent Expansion of Pandemic Clones on Rice and Weeds of Rice Genetics, June 1, 2005; 170(2): 613 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. U. Bohnert, I. Fudal, W. Dioh, D. Tharreau, J.-L. Notteghem, and M.-H. Lebrun A Putative Polyketide Synthase/Peptide Synthetase from Magnaporthe grisea Signals Pathogen Attack to Resistant Rice PLANT CELL, September 1, 2004; 16(9): 2499 - 2513. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Linning, D. Lin, N. Lee, M. Abdennadher, D. Gaudet, P. Thomas, D. Mills, J. W. Kronstad, and G. Bakkeren Marker-Based Cloning of the Region Containing the UhAvr1 Avirulence Gene From the Basidiomycete Barley Pathogen Ustilago hordei Genetics, January 1, 2004; 166(1): 99 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Gao, C. H. Khang, S.-Y. Park, Y.-H. Lee, and S. Kang Evolution and Organization of a Highly Dynamic, Subtelomeric Helicase Gene Family in the Rice Blast Fungus Magnaporthe grisea Genetics, September 1, 2002; 162(1): 103 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Farman Meiotic Deletion at the BUF1 Locus of the Fungus Magnaporthe grisea Is Controlled by Interaction With the Homologous Chromosome Genetics, January 1, 2002; 160(1): 137 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Orbach, L. Farrall, J. A. Sweigard, F. G. Chumley, and B. Valent A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta PLANT CELL, November 1, 2000; 12(11): 2019 - 2032. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Farman, M. L.
- Articles by Leong, S. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Farman, M. L.
- Articles by Leong, S. A.






