- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Wang, W.
- Articles by McLeod, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Wang, W.
- Articles by McLeod, M.
Characterization of Functional Regions in the Schizosaccharomyces pombe mei3 Developmental Activator
Wei Wanga, Peng Li*,a, Annette Schettino
,a,
Zhe Penga, and
Maureen McLeoda
a Department of Microbiology and Immunology, Morse Institute for Molecular Biology and Genetics, Health Science Center, State University of New York, Brooklyn, New York 11203
Corresponding author: Maureen McLeod, State University of New York, Health Science Center, Department of Microbiology and Immunology, Morse Institute for Molecular Biology and Genetics, 450 Clarkson Ave., Brooklyn, New York 11203., mmcleod{at}netmail.hscbklyn.edu (E-mail).
Communicating editor: P. G. YOUNG
| ABSTRACT |
|---|
The Schizosaccharomyces pombe mei3+ gene is expressed only in diploid cells undergoing meiosis. Ectopic expression of mei3+ in haploid cells causes meiotic catastrophe. Mei3 is an inhibitor of Ran1/Pat1 kinase and contains a nine-amino-acid motif, Mei3-RKDIII, that resembles two regions in the Ste11 substrate for Ran1/Pat1. Substitution of serine for Arg-81 within Mei3-RKDIII transforms the inhibitor into a substrate for Ran1/Pat1. Thus, it is likely that Mei3-RKDIII defines a pseudosubstrate sequence. In this study, we constructed a series of mei3 deletion mutations and assayed each for activity. This analysis indicates that the carboxy-terminal domain of Mei3 is sufficient for function in vivo. Alanine-scanning mutagenesis identifies critical residues within the inhibitory domain. Two mutations, SM1 and SM8, fail to cause meiotic catastrophe. The SM1 mutation contains alterations of amino acid residues in Mei3-RKDIII. Recombinant SM1 protein exhibits reduced ability to inhibit Ran1/Pat1 kinase in vitro and interacts inefficiently with the kinase in a two-hybrid assay. The SM8 protein binds to Ran1/Pat1 in a two-hybrid assay but fails to inhibit Ran1/Pat1 substrate phosphorylation in vitro. These findings provide evidence that Mei3-RKDIII defines a Ran1/Pat1-binding site that is necessary but not sufficient for inhibition of the kinase. Using fusions to green fluorescent protein, the cellular localization of Ran1 and Mei3 was examined in living cells. Ran1 is concentrated in the nucleus. Mei3 is also enriched in the nucleus and, consistent with the genetic and biochemical results, the inhibitory domain of Mei3 is sufficient for nuclear localization.
IN the presence of sufficient nutrients, Schizosaccharomyces pombe cells proliferate by means of mitotic cell division. However, as nutrients become limiting, cells accumulate at G1 and those of opposite mating-type conjugate. The diploid cell formed through conjugation is able to divide vegetatively or undergo meiosis. A variety of studies indicate that Ran1/Pat1 kinase (referred to as Ran1 hereafter) functions as a pivotal regulator of all phases of sexual differentiation: G1 delay, conjugation, premeiotic DNA synthesis, and sporulation.
Inactivation of Ran1 kinase is both necessary and sufficient to divert cells from the mitotic cell cycle into the meiotic developmental program (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Attenuation of Ran1 activity provokes expression of a set of meiosis-specific genes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Cells containing a loss-of-function mei3 allele are able to conjugate and undergo nuclear fusion, but arrest just before premeiotic DNA synthesis (![]()
![]()
![]()
![]()
![]()
![]()
Mei3 contains a nine-amino-acid region (Mei3-RKDIII) that is homologous to two regions (Ste11-RKDI and Ste11-RKDII) in the Ste11 substrate for Ran1. It has been proposed that the RKD motifs contain substrate specificity determinants. In support of this hypothesis, amino residues in Ste11-RKDI (Thr-173) and Ste11-RKDII (Ser-218) that are critical for phosphorylation by Ran1 have been identified. Substitution of the corresponding amino acid within Mei3-RKDIII (Arg-81) transforms the inhibitor into a substrate for Ran1 (![]()
![]()
This article presents evidence supporting the identification of RKD motifs as functional elements. Using defined deletions, we determine that the C-terminal domain of Mei3 is sufficient to cause meiotic catastrophe, to localize Mei3 to the nucleus, and to inhibit Ran1 substrate phosphorylation. Alanine scanning mutagenesis of the inhibitory domain defines two regions, SM1 and SM8, that are critical for Mei3 function in vivo and for inhibition of Ran1 in vitro. The SM1 mutation encompasses residues that reside in Mei3-RKDIII. The SM8 mutation contains alterations of amino acids distinct from Mei3-RKDIII. In vitro kinase assays show that SM1 and SM8 are each ineffective inhibitors of Ran1 substrate phosphorylation compared to the wild-type protein. Using a two-hybrid assay, we demonstrate that the RKD region is responsible for the interaction between Ran1 and Mei3. These studies indicate that Mei3-RKDIII is a pseudosubstrate motif required for efficiently binding Ran1. However, although binding is necessary, it is not sufficient to inhibit Ran1 kinase activity. One other region, defined by the SM8 mei3 allele, is required as well. Finally, using fusions to green fluorescent protein (GFP), the cellular localization of Ran1 and Mei3 was examined in living cells. Ran1 is concentrated in the nucleus of the cell. Mei3 is also enriched in the nucleus. Consistent with the genetic and biochemical results described above, the inhibitory domain of Mei3 is sufficient for nuclear localization.
| MATERIALS AND METHODS |
|---|
Strains and media:
The genotypes of S. pombe strains used in this study are as follows: SP66, h90 leu1-32 ade6-M216; SPB46, h90 leu1-32 ade6-M216 mei2::lacZ; SPB95, h90 leu1-32 ura4-D18 ade6-M216 mei2-ts ran1+O.P; SPB158, h90 leu1-32 ura4-D18 ade6-M210 mei2-lacZ ran1+O.P; SPB203, h90 leu1-32 ura4-D18 ade6-M210 mei3::ura4; SPB204, h90 leu1-32 ura4-D18 ade6-M210 mei3::sm1; SPB205, h90 leu1-32 ura4-D18 ade6-M210 mei3::sm8; SPB77, h90 leu1-32 ura4-D18 ade6-M216 mei2-ts; SPB65, h90 leu1-32 ura4-D18 ade6-M216 ste11::ura4. S. pombe cells were cultured in rich medium (YEA) or minimal defined medium (EMM) with the required amino acid supplements, as described (![]()
![]()
gal80
URA3::GAL1-LacZ LYS::GAL1-HIS3 cyhr) was used for two-hybrid assays (![]()
Oligonucleotides:
The oligonucleotides used in this study were designed with assistance from the OLIGO software package (National Biosciences Inc., Plymouth, MN). The 5' complementary end of each oligonucleotide used for scanning mutagenesis has a calculated Tm of
35°. The 3' complementary end has a calculated Tm of
25° (![]()
SM2, 5'CATGAAACGCACTAAAGCTGTTGCAGCAACCCCTGCAC3';
SM3, 5'CGAACCCCTGCAGCAGCAATTGCACATGAAAATAAAGA3';
SM4, 5'AACGCATTGAACATGCAGCTGCAGAAAATATTCAGAC3';
SM5, 5'TTGAACATGAAAATAAAGCAGCTATTGCAACTGAAAAGGTTTAT3';
SM6, 5'GAAAATATTCAGACTGCAGCAGTTTATGCAATTAAGCCTGTC3';
SM7, 5'GGTTTATAGGATTGCACCTGTCGCTGCAGTTCTTTCTCC3';
SM8, 5'CTTTCTCCCTCAGCACTCACTGCAGCACTAACCATCCTGG3';
SM98FS, 5'CATTGAACATGAAAATAAAGCAGCTATTGCAACTGAAAAAGGTT3';
MEI3NDE, 5'CTCGAGTATACATCTTCATCTTT;
MEI814, 5'AGAATTGCCCATATGAAACGCACTAAACGT; MEI128, 5'ATCCTGGATCCTATTTTAATAGTACGCATCG3';
HA-NHE, 5'AGATTACGCTAGCTTGGGTG3'; MEI3-p10RKD, 5'GTGGATCCTCAAACACGTTTAGTGCGTTTC3';
RAN1-NOT, 5'GTAGATCCATCTCGAAGCGGCCGCTAAAGTTACTTGCTT3';
MEI3-NOT, 5'CCGACCGTGTAAACAACAGCGGCCGCTAAGCAACTGC3';
GFP-NHE, 5'CAGCGCTAGCAGTAAAGGAGAAGAACTTTTCA3';
GFP-BAM, 5'CGGGGATCCTTATTTGTATAGTTCATCC3';
MEI3C-NHE, 5'CGGTAGCTAGCGTTCCCATGAAACG3';
MEI3-p10, 5'TGGGATCCTAGGGAACGCTATGTACCGAT3'.
Oligonucleotide mutagenesis:
SM1SM8 and SM98FS were isolated using single-strand mutagenesis. Single-strand phage was prepared from the E. coli essentially as described (![]()
![]()
Plasmids:
pALT2 was used for expression of genes in fission yeast. pALT2 is essentially identical to pART3 (![]()
![]()
![]()
Plasmid constructions:
- pMEI3.25, SM1SM8, and SM98FS: Contain the entire HA-mei3 gene or the designated mutant mei3 allele as an NdeI/BamHI fragment (
MCLEOD et al. 1987 ) in the yeast expression vector pALT2.
- pMEI3.23: PCR product formed using oligonucleotides MEI814 and MEI128 in pALT2.
- pMEI3-N: PCR product formed using oligonucleotides MEI3p10 and HA-NHE in pALT2.
- pMEI3-N/RKD: PCR product formed using oligonucleotides MEI3-p10RKD and HA-NHE in pALT2.
- pMEI3-C: An NdeI site was introduced using oligonucleotide MEI814 for expression of the C terminus in pALT2.
- WT-pET15b: Contains the entire HA-mei3 gene as an NheI/BamHI fragment in the bacterial expression vector pET15b.
- p11-pET15b: Contains the mei3 allele identical to that in MEI3-C in the bacterial expression vector pET15b.
- Mei3-GFP: A NotI site was introduced into the C terminus of HA-mei3 using oligonucleotide MEI3-NOT to create a Mei3-GFP fusion protein. The fusion was expressed as an NheI/BamHI fragment in the vector pALT2.
- Ran1-GFP: A NotI site was introduced into the C terminus of HA-ran1 using oligonucleotide RAN1-NOT to create a Ran1-GFP fusion protein. The fusion was expressed in the vector pALT2.
- GFP-2: PCR product formed using oligonucleotides GFP-NHE and GFP-BAM. The template used was GFP1-S65T (kindly provided by Dr. Jeanne Hirsch, Columbia University, New York).
- Mei3-C-GFP: PCR product formed using oligonucleotides MEI3C-NHE and GFP-BAM. The template used was Mei3-GPF.
Expression of recombinant proteins:
The plasmids used for expression of recombinant proteins were WT-pET15b (p21) and p11-pET15b (p11). The construction of plasmids is described in a preceding section. All recombinant proteins were expressed as N-terminal fusion proteins to (HIS)6-HA1 sequences (![]()
![]()
![]()
Yeast extracts:
In experiments using Western blots, cells were grown to a density of 1.02.0 x 107 cells/ml in minimal selective medium. Pelleted cells were washed in HE buffer (50 mM Tris HCl, pH8.0, 5 mM EDTA, 1 mM DTT) and resuspended in 0.5 ml HE buffer containing 1 mM PMSF. After addition of sterile glass beads, the cells were broken by vortexing for 15 min at 4°. Lysates were removed to a fresh tube, and the glass beads were washed in 2.0 ml RIPA buffer (HE plus 0.5% sodium deoxycholate). Clarified lysate was obtained by centrifugation at 12,000 rpm for 30 min. Protein concentrations were determined using bovine serum albumin as a standard in a protein assay system (Bio-Rad, Richmond, CA). A permeabilized cell assay was used to measure ß-galactosidase activity in either fission or budding yeast cells (![]()
Western blots:
Either yeast total cell lysate (100 µg) or purified recombinant protein (50 ng) were separated on a 5.015.5% gradient SDS-polyacrylamide gel before electrophoretic transfer to Hybond-C membranes (Amersham). Membranes were incubated for 1 hr at room temperature with 5.0% nonfat dry milk in TBST (20 mM Tris-HCl, pH 7.6, 137 mM NaCl, 0.2% Tween 20). The blocking solution was removed and replaced with primary antibody after extensive washes in TBST. The primary antibody was a mixture of R30, R48, and R99 monoclonal antibody (![]()
![]()
Enzyme kinetic studies:
The concentrations of inhibitor proteins (p21 and p11) were determined after visualization of the protein on a SDS-polyacrylamide gel and comparison with a known protein standard. This value was confirmed using a Bio-Rad protein assay with BSA as a standard. All inhibitor proteins and the p39ste11 substrate were judged to be 99% pure. Kinase assays were performed as described (![]()
Sporulation assay:
Cells were grown on EMM plates for 4 days at 30° as single colonies. An entire single colony was resuspended in EMM and examined using a microscope. A minimum of three individual colonies were analyzed, and 1000 cells/colony were counted.
Fluorescent microscopy:
Plasmids constructed for expression of GFP fusion protein in fission yeast are as follows: Ran1, Ran1-GFP; Mei3, Mei3-GFP; Mei3-C, Mei3C-GFP; and GFP alone, GFP-2. The plasmids were transformed into the strains indicated in the text. Transformants were grown in selective medium to a density of 5.0 x 106 to 1 x 107. The GFP fusion proteins were visualized in live cells using a Nikon Axiophot with a BA 520-560 filter.
| RESULTS |
|---|
The C-terminal domain of Mei3 is sufficient for function:
Previous experiments indirectly implicated the C terminus as the active region of Mei3 (![]()
![]()
|
|
Ran1 kinase represses sexual differentiation, at least in part, by regulation of meiosis-specific gene expression. For instance, inactivation of Ran1 provokes expression of matPc and bypasses the usual requirement for nitrogen starvation (![]()
![]()
![]()
|
The genetic assays described above indicate that the Mei3 C-terminal domain is active. To determine if a correlation could be drawn between the in vivo function of Mei3 and its ability to inhibit Ran1 kinase, the activity of the C-terminal domain was investigated in vitro. A truncated Mei3 polypeptide corresponding to amino acid residues 75148 was produced in bacteria as a (HIS)6 fusion protein. Either full-length (HIS)6-MEI3 (p21) or an equivalent molar amount of the truncated (HIS)6-Mei3 (p11) were incubated with Ran1, Ste11 substrate (p39), and [32P]ATP. After SDS-PAGE, we observed that both p21 and p11 inhibited Ran1 substrate phosphorylation to the same extent (Figure 2B).
Identification of critical residues in the Mei3 inhibitory region:
To further define the functional region of mei3, specific mutations were created in the inhibitory domain. Each mutation was designed to substitute a charged amino acid residue with an alanine. To increase the likelihood of obtaining inactive alleles, residues were altered in groups of three. Each plasmid-borne mutation (SM1SM8, Figure 1) was constructed in a full-length mei3 gene, expressed under adh control, and assayed for the ability to cause meiotic catastrophe. Neither wild-type mei3+ nor any of the SM mutations gave rise to a significant number of viable transformants in mei2+ cells, although all were capable of high frequency transformation in mei2- cells (Table 1). Thus, all the SM mutations caused meiotic catastrophe and could not be distinguished from each other or from wild-type mei3+ in this experiment. However, this result indicates that none of the SM mutations result in a null allele; each is active in the in vivo assay used.
As a means of discriminating between the activity of each SM mutation, the following strategy was used. Because meiosis induced by expression of mei3+ appears to be caused solely by inhibition of Ran1 kinase, Mei3 mutations with decreased activity might be identified by an inability to induce meiotic catastrophe in cells producing high levels of Ran1. A yeast strain was constructed to produce high amounts of Ran1 under adh control. The strain was further modified to contain a thermolabile mei2 allele (mei2-ts) so that viable transformants could be obtained at a restrictive temperature for mei2ts (35°) and tested for induction of meiotic catastrophe at 30°, a permissive temperature for this allele (Figure 3A). This strain (SPB95) was transformed with plasmids expressing either Mei3 or one of the SM mutant proteins. All the plasmids gave rise to viable transformants at the restrictive temperature for mei2ts. However, when a representative number of transformants were transferred to fresh plates and incubated at the permissive temperature, none gave rise to colonies, except for the SM1 and SM8 plasmids (Figure 3B). The steady-state levels of Mei3 protein produced by each plasmid and of Ran1 were compared in an immunoblot (Figure 3C). With the exception of SM8, whole-cell extracts from each of the transformants contained comparable amounts of Mei3. As anticipated, the steady-state abundance of Ran1 was equivalent in cell extracts from all transformants examined. Taken together, these results support several conclusions. First, because high-level expression of Ran1 is required to discriminate between active and inactive mei3-SM mutations, then Mei3 most likely causes meiosis through interaction with Ran1. Thus, amino acid residues altered in SM1 (K-77, R-78, and K-80) are likely required for interaction with or inhibition of Ran1 in vivo. Notably, all three residues are located within the Mei3-RKDIII motif. One other region, defined by the SM8 mutation, is also required for Ran1 inhibition. However, because the steady-state level of the SM8 protein is reduced compared to Mei3 (or any of the SM mutations), the biochemical basis for the inability of SM8 to induce meiotic catastrophe cannot be fully assessed in this experiment.
|
The above experiments define specific regions of Mei3 required to cause meiotic catastrophe in cells producing high levels of both Ran1 kinase and mutant versions of Mei3. To confirm that SM1 and SM8 are physiologically significant regions of Mei3, we replaced the endogenous mei3 allele with either sm1 or sm8 by using one-step gene replacement. h90 cells containing a mei3 null allele are able to conjugate efficiently, but do not undergo meiosis and sporulation (![]()
|
In vitro interactions between Ran1 and Mei3 proteins:
Protein kinase inhibitors function using a variety of mechanisms. In some cases, they directly hinder catalytic activity by blocking the active site of the enzyme or by interfering with residues required for nucleotide binding. In other cases, kinase activity is modulated in vivo by association with a regulatory protein that targets the enzyme to a specific location in the cell. None of these mechanisms can be distinguished from one another using meiotic catastrophe as an assay for Mei3 activity. As an initial step to define the mechanism(s) Mei3 uses for its function, we directly examined the ability of the SM1 and SM8 proteins to inhibit Ran1 substrate phosphorylation. To accomplish this, SM1 and SM8 were expressed in bacteria as (HIS)6-tagged fusion proteins and purified to 99% homogeneity using Ni2+-NTA chromatography. Various amounts of either Mei3, SM1, or SM8 recombinant proteins were added to reactions containing Ran1 kinase and p39Ste11 as substrate. This experiment revealed that wild-type Mei3 inhibited Ran1 substrate phosphorylation with an IC50 value of 0.14 nM. In contrast, SM1 and SM8 inhibited the phosphorylation of p39ste11 with IC50 values of ~15 and 58 nM, respectively (Figure 5). Thus, SM1 and, to an even greater extent, SM8 are poor inhibitors of Ran1 in vitro. This result provides biochemical evidence that SM1 and SM8 define regions of Mei3 that directly interfere with Ran1 catalytic activity. Notably, there is good correlation between the biochemical and genetic data, which both indicate that the SM8 mutation is a less effective inhibitor than the SM1 mutation.
|
Two-hybrid interactions between Ran1 and Mei3 proteins:
Previous biochemical experiments established the significance of RKD motifs as substrate specificity determinants. Amino residues in Ste11-RKDI and Ste11-RKDII (Thr-173 and Ser-218, respectively) are critical for phosphorylation by Ran1 in vitro. Substitution of the corresponding amino acid within Mei3-RKDIII (Arg-81, ![]()
The two-hybrid system has been widely used to study protein-protein interactions, and, in some cases, point mutations that interfere with association between members of a complex can be observed in this system (![]()
|
Localization of Ran1 and Mei3:
In view of data supporting a direct interaction between Ran1 and Mei3, as well as experiments demonstrating that two substrates for Ran1, Mei2p and Ste11p, are localized to the nucleus (![]()
![]()
![]()
![]()
![]()
|
For some protein kinases, high-level expression masks conditions that regulate localization of the kinase. For instance, mitogen-activated protein kinase localizes to the nucleus after activation by extracellular stimuli. High-level expression of mitogen-activated protein kinase results in nuclear accumulation in the absence of stimulation (![]()
| DISCUSSION |
|---|
The Mei3 protein is composed of two distinct domains:
The mei3 gene acts as a developmental activator in fission yeast. Expression of mei3 is sufficient to cause cells to exit the cell cycle and to undergo premeiotic DNA synthesis, both meiotic divisions and sporulation. Mei3 accomplishes this by inhibition of Ran1 kinase. We previously used in vitro assays to provide evidence that Mei3 contained a pseudosubstrate motif. Here, we show that the pseudosubstrate motif is required for Mei3 function in vivo. Deletion mutations establish that the C-terminal domain of Mei3 is sufficient to cause meiotic catastrophe. Moreover, this domain is indistinguishable from the full-length protein as an in vitro inhibitor of Ran1 substrate phosphorylation. Consistent with these observations, a polypeptide containing only the C-terminal domain associates with Ran1 in a two-hybrid assay. Thus, the C-terminal domain is sufficient for Mei3 function in vivo and for inhibition of Ran1 in vitro. These results raise a question as to the role of the N-terminal portion of the Mei3 protein. On one hand, it may be totally dispensable for Mei3 function, although it comprises half the entire protein. Alternatively, Mei3 may be required for other functions during meiosis that are not measured using meiotic catastrophe as an assay. It has been reported that meiotic catastrophe caused by loss of Ran1 produces spores with low viability, even in diploid cells. Consistent with this observation, meiotic recombination is severely reduced during meiosis caused by inactivation of Ran1 (![]()
Two independent regions in the inhibitory domain are required for activity:
The function of specific amino acid residues in the C-terminal domain was investigated using alanine-scanning mutagenesis. Two mutations, SM1 and SM8 (see Figure 1 and Figure 3), fail to cause meiotic catastrophe in cells producing high levels of Ran1 kinase. In contrast, both SM1 and SM8 cause meiotic catastrophe in cells producing normal amounts of Ran1. Because the level of Ran1 kinase affects the phenotype caused by expression of the mei3 mutations, it appears that the physiological function of Mei3 is to activate meiosis through association with and inhibition of Ran1. Mei3 does not appear to function as a nonspecific protein kinase inhibitor. The activity of cAMP-dependent protein kinase, which, like Ran1, negatively regulates sexual differentiation, is not inhibited by Mei3 in vivo (W. WANG and A. SCHETTINO, unpublished data).
The catalytic activity of a number of protein kinases is negatively regulated by association with pseudosubstrate sequences (for review see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
Evidence that Mei3 and Ran1 are localized to the nucleus:
All evidence obtained to date supports the conclusion that inactivation of Ran1 by Mei3 leads to meiosis. However, Ran1 is highly regulated to control events that occur before meiosis, such as G1 arrest and conjugation. One means of regulating kinase activity is to direct the cellular localization of the enzyme as a means of controlling access to inhibitors or substrates. We examined the localization of Ran1 and Mei3 in living cells using GFP fusions. These studies revealed that both Ran1 kinase and the Mei3 inhibitor are able to concentrate GFP to the nucleus of the cell. Ran1-GFP is excluded from the nucleolar region, perhaps indicating that Ran1 may be tethered to a specific region of the nucleus by an as yet undescribed anchoring protein. Notably, the appearance of Ran1-GFP in the nucleus is not altered, even in the absence of Mei2 or Ste11, both of which are substrates for Ran1 and are themselves found in the nucleus.
Mei3 is also highly enriched in the nucleus of the cell. In contrast with Ran1, Mei3 is not excluded from the nucleolus and may, in fact, be concentrated in the nucleolar compartment (W. WANG, unpublished observation). This observation raises the possibility that Mei3 has an as yet undescribed function independent of inhibition of Ran1. The nuclear localization of Mei3 is especially intriguing in comparison with that of the PKI pseudosubstrate inhibitor. Both Mei3 and PKI are small proteins, presumably able to diffuse in and out of the nucleus (![]()
![]()
| FOOTNOTES |
|---|
* Present address: New York University Medical Center, New York, NY 10003. ![]()
Present address: Schering Plough Research Institute, Kenilworth, NJ 07033. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Jeanne Hirsch for the green fluorescent probe. We are grateful to Hua Chen for providing soluble Ran1, and to Steve Elledge, Christopher Hellen, and Brehon Laurent for providing yeast strains and plasmids. This work was supported by an American Heart Award (New York City affiliate) and a National Science Foundation Career Advancement Award to M.M.
Manuscript received March 6, 1998; Accepted for publication July 24, 1998.
| LITERATURE CITED |
|---|
ALFA, C., P. FANTES, J. HYAMS, M. MCLEOD and E. WARBRICK, 1993 Experiments with Fission Yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BAHLER, J., P. SCHUCHERT, C. GRIMM, and J. KOHLI, 1991 Synchronized meiosis and recombination in fission yeast: observations with pat1-114 diploid cells. Curr. Genet. 19:445-451[Medline].
BEACH, D., L. RODGERS, and J. GOULD, 1985 RAN1+ controls the transition from mitotic division to meiosis in fission yeast. Curr. Genet. 10:297-311[Medline].
BRESCH, C., G. MULLER, and R. EGEL, 1968 Genes involved in meiosis and sporulation of a yeast. Mol. Gen. Genet. 102:301-306[Medline].
CHALFIE, M., Y. TU, G. EUSKIRCHEN, W. W. WARD, and D. PRASHER, 1994 Green fluorescent protein as a marker for gene expression. Science 263:802-805
CHENG, H. C., S. M. VAN PATTEN, A. J. SMITH, and D. WALSH, 1985 An active twenty-two-amino-acid residue peptide derived from the inhibitor protein of the cAMP-dependent protein kinase. Biochem. J. 105:655-661.
DAVEY, J. and O. NIELSEN, 1994 Mutations in cyr1 and pat1 reveal pheromone-induced G1 arrest in the fission yeast Schizosaccharomyces pombe.. Curr. Genet. 121:105-112.
DEVOTI, J., G. SEYDOUX, D. BEACH, and M. MCLEOD, 1991 Interaction between ran1+ protein kinase and cAMP-dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 10:3759-3768[Medline].
DOOIJES, D., M. VAN DE WETERING, L. KNIPPELS, and H. CLEVERS, 1993 The Schizosaccharomyces pombe mating-type gene mat-Mc encodes a sequence-specific DNA-binding high mobility group box protein. J. Biol. Chem. 268:24813-24817
EGEL, R., 1973 Commitment to meiosis in fission yeast. Mol. Gen. Genet. 121:277-284.
FIELD, J., J. I. NIKAWA, D. BROEK, B. MACDONALD, and L. RODGERS et al., 1988 Purification of a ras-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159-2165
FUKUDA, M., Y. GOTOH, and E. NISHIDA, 1997 Interaction of MAP kinase with MAP kinase kinase: its possible role in the control of nucleocytoplasmic transport of MAP kinase. EMBO J. 16:1901-1908[Medline].
GIBBS, C. S. and M. J. ZOLLER, 1991 Rational scanning mutagenesis of a protein kinase identifies functional regions involved in catalysis and substrate interactions. J. Biol. Chem. 266:8923-8931
GOLDBERG, J., A. C. NAIRN, and J. KURIYAN, 1996 Structural basis for the autoinhibition of calcium/calmodulin-dependent protein kinase I. Cell 84:875-887[Medline].
HARPER, J. W., G. R. ADAMI, K. KEYOMARSI, and S. ELLEDGE, 1993 The p21 CDK-interacting protein is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816[Medline].
IINO, Y. and M. YAMAMOTO, 1985a Mutants of Schizosaccharomyces pombe which sporulate in the haploid state. Mol. Gen. Genet. 198:416-421.
IINO, Y. and M. YAMAMOTO, 1985b Negative control for the initiation of meiosis in Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 82:2447-2451
KELLY, M., J. BURKE, M. SMITH, A. KLAR, and D. BEACH, 1988 Four mating-type genes control sexual differentiation in the fission yeast. EMBO J. 7:1537-1547[Medline].
KEMP, B. E. and R. B. PEARSON, 1991 Intrasteric regulation of protein kinases and phosphatases. Biochim. Biophys. Acta 1094:67-76[Medline].
KNIGHTON, D. R., J. ZHENG, L. F. TEN EYCK, V. A. ASHFORD, and N. H. XUONG et al., 1991a Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science 253:407-414
KNIGHTON, D. R., J. ZHENG, L. F. TEN EYCK, N. H. XUONG, and S. S. TAYLOR et al., 1991b Structure of a peptide inhibitor bound to the catalytic subunit of cyclic adenosine phosphate dependent protein kinase. Science 253:414-420
LI, B. and S. FIELDS, 1993 Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J. 7:957-963[Abstract].
LI, P. and M. MCLEOD, 1996 Molecular mimicry in development: identification of ste11+ as a substrate and mei3+ as a pseudosubstrate inhibitor of ran1+ kinase. Cell 87:869-880[Medline].
MCLEOD, M. and D. BEACH, 1988 A specific inhibitor of the ran1+ protein kinase regulates entry into meiosis in Schizosaccharomyces pombe.. Nature 332:509-514[Medline].
MCLEOD, M., M. STEIN, and D. BEACH, 1987 The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast. EMBO J. 6:729-736[Medline].
NAKIENLY, S. and G. DREYFUSS, 1997 Nuclear import of proteins and RNA. Curr. Opin. Cell Biol. 9:420-429[Medline].
NIELSEN, O., 1993 Signal transduction during mating and meiosis in S. pombe.. Trends Cell Biol. 3:60-65.
NIELSEN, O. and R. EGEL, 1990 The pat1 protein kinase controls transcription of the mating-type genes in fission yeast. EMBO J. 9:1401-1406[Medline].
NURSE, P., 1985 Mutants of the fission yeast Schizosaccharomyces pombe which alter the shift between cell proliferation and sporulation. Mol. Gen. Genet. 198:497-502.
RUSSELL, R. P., 1983 Evolutionary divergence of the mRNA transcription initiation mechanism in yeast. Nature 301:167-169[Medline].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SCOTT, J. D., E. H. FISCHER, J. D. DEMAILLE, and E. G. KREBS, 1985 Identification of an inhibitory region of the heat-stable protein inhibitor of the cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 82:4379-4383
SMITH, M. C., T. C. FURMAN, T. D. INGOLIA, and C. PIDGEON, 1988 Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins. J. Biol. Chem. 263:7211-7214
SUGIMOTO, A., Y. IINO, T. MAEDA, Y. WATANABE, and M. YAMAMOTO, 1991 Schizosaccharomyces pombe ste11+ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev. 5:1990-1999
WATANABE, Y., S. SHINOZAKI-YABANA, Y. CHIKASHIGE, Y. HIRAOKA, and M. YAMAMOTO, 1997 Phosphorylation of RNA-binding protein controls cell cycle switch from mitotic to meiotic in fission yeast. Nature 386:187-190[Medline].
WEN, W., S. S. TAYLOR, and J. L. MEINKOTH, 1995 The expression and intracellular distribution of the heat-stable protein kinase inhibitor is cell cycle regulated. J. Biol. Chem. 270:2041-2046
WILLER, M., L. HOFFMANN, U. STYRKARDOTTIR, R. EGEL, and J. DAVEY et al., 1995 Two-step activation of meiosis by the mat1 locus in Schizosaccharomyces pombe.. Mol. Cell. Biol. 15:4964-4970[Abstract].
This article has been cited by other articles:
![]() |
K. Tanabe, N. Ito, T. Wakuri, F. Ozoe, M. Umeda, S. Katayama, K. Tanaka, H. Matsuda, and M. Kawamukai Sla1, a Schizosaccharomyces pombe Homolog of the Human La Protein, Induces Ectopic Meiosis when Its C Terminus Is Truncated Eukaryot. Cell, December 1, 2003; 2(6): 1274 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Qin, W. Kang, B. Leung, and M. McLeod Ste11p, a High-Mobility-Group Box DNA-Binding Protein, Undergoes Pheromone- and Nutrient-Regulated Nuclear-Cytoplasmic Shuttling Mol. Cell. Biol., May 1, 2003; 23(9): 3253 - 3264. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. McLeod, B. Shor, A. Caporaso, W. Wang, H. Chen, and L. Hu Cpc2, a Fission Yeast Homologue of Mammalian RACK1 Protein, Interacts with Ran1 (Pat1) Kinase To Regulate Cell Cycle Progression and Meiotic Development Mol. Cell. Biol., June 1, 2000; 20(11): 4016 - 4027. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Wang, W.
- Articles by McLeod, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Wang, W.
- Articles by McLeod, M.










