Genetic Variation and Phylogeography of Central Asian and Other House Mice, Including a Major New Mitochondrial Lineage in Yemen

Corresponding author: Ellen M. Prager, Department of Biology, San Francisco State University, 1600 Holloway Avenue, San Francisco, CA 94132-1722., emprager{at}sfsu.edu (E-mail).

Communicating editor: W. F. EANES

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The mitochondrial DNA (mtDNA) control region and flanking tRNAs were sequenced from 76 mice collected at 60 localities extending from Egypt through Turkey, Yemen, Iran, Afghanistan, Pakistan, and Nepal to eastern Asia. Segments of the Y chromosome and of a processed p53 pseudogene (p53) were amplified from many of these mice and from others collected elsewhere in Eurasia and North Africa. The 251 mtDNA types, including 54 new ones reported here, now identified from commensal house mice (Mus musculus group) by sequencing this segment can be organized into four major lineages—domesticus, musculus, castaneus, and a new lineage found in Yemen. Evolutionary tree analysis suggested the domesticus mtDNAs as the sister group to the other three commensal mtDNA lineages and the Yemeni mtDNAs as the next oldest lineage. Using this tree and the phylogeographic approach, we derived a new model for the origin and radiation of commensal house mice whose main features are an origin in west-central Asia (within the present-day range of M. domesticus) and the sequential spreading of mice first to the southern Arabian Peninsula, thence eastward and northward into south-central Asia, and later from south-central Asia to north-central Asia (and thence into most of northern Eurasia) and to southeastern Asia. Y chromosomes with and without an 18-bp deletion in the Zfy-2 gene were detected among mice from Iran and Afghanistan, while only undeleted Ys were found in Turkey, Yemen, Pakistan, and Nepal. Polymorphism for the presence of a p53 was observed in Georgia, Iran, Turkmenistan, Afghanistan, and Pakistan. Sequencing of a 128-bp p53 segment from 79 commensal mice revealed 12 variable sites and implicated 14 alleles. The allele that appeared to be phylogenetically ancestral was widespread, and the greatest diversity was observed in Turkey, Afghanistan, Pakistan, and Nepal. Two mice provided evidence for a second p53 locus in some commensal populations.

WITHIN the past two decades, a number of important issues about the genetic variation and phylogenetic relationships of members of the house mouse species group have been resolved, and data are accumulating steadily with respect to several remaining fundamental questions about the extent and organization of the variation in wild mice and the relationships, origin, and radiation of the commensal taxa (e.g., see BOURSOT et al. 1993 , BOURSOT et al. 1996 ; SAGE et al. 1993 ; MORIWAKI et al. 1994 ; DIN et al. 1996 ; PRAGER et al. 1996 ; BOISSINOT and BOURSOT 1997 ). Thus, it has been demonstrated that the three aboriginal species—Mus spicilegus, M. macedonicus, and M. spretus, each of which occupies limited ranges in Europe, western (W) Asia, and North Africa—lie phylogenetically outside the commensal clade. The preponderance of evidence indicates that M. spretus is an outgroup to all the other house mouse taxa.

The native range of the commensal house mice collectively is all of Eurasia plus North Africa. According to the most commonly used system, they can be divided into three or four taxa that, in a binomial classification, are designated M. domesticus of W Europe, North Africa, and the Middle East; M. musculus of eastern (E) Europe and northern (N) Asia; M. castaneus of southeastern (SE) Asia; and M. bactrianus of south-central (SC) Asia from Iran to N India. (In the trinomial classification system, these taxa would be called M. m. domesticus, M. m. musculus, M. m. castaneus, and M. m. bactrianus.) M. bactrianus is the least well defined and characterized taxon, and it is not known whether it is a cohesive genetic entity. On a broader scale, the genetic constitution of the central populations—from the Indian subcontinent, Afghanistan, and Iran—and their genetic affiliations with the other taxa are just now being elucidated, and it has been suggested (BOURSOT et al. 1993 , BOURSOT et al. 1996 ; DIN et al. 1996 ) that assignment of a particular taxonomic name to members of the central populations (including those previously called M. bactrianus) be held in abeyance. [Mice from many central populations have been categorized as M. domesticus on the basis of morphological criteria (MARSHALL and SAGE 1981 ).]

The corollary issues being addressed concern the geographic origin of the commensal clade and the modes and routes of radiation giving rise to the diverse species and populations over their present-day ranges. The geological feature of primary importance in understanding the past and present ranges of house mice is the east-west wall of high mountains that runs through Europe and Asia. This backbone of Eurasia, which in Central Asia encompasses the ranges from the Caucasus to the Himalayas, is the major geographic barrier that keeps M. musculus in northern Eurasia, away from the commensal taxa that inhabit southern (S) Eurasia. The Zagros Mountains, which run N–S through W and S Iran, may well act in the same way and form the major geographic barrier that keeps M. domesticus in the west, away from other SC Asian mice. These mountain massifs act as barriers to mice during both glacial periods (when the higher elevations are colder and even glaciated) and interglacials [when these mountains become forested and, thus, also inhospitable to house mice (SAGE 1981 )]. Explaining where and how ancestral house mice got from one side of these barriers to the other is a significant challenge for any hypothesis of commensal mouse origin and radiation.

A consensus is lacking as to whether the commensal house mouse taxa should be regarded as full species or as subspecies or perhaps as semispecies (e.g., see SAGE et al. 1986 , SAGE et al. 1993 ; AUFFRAY et al. 1990A ; BOURSOT et al. 1993 ; BONHOMME et al. 1994 ; PRAGER et al. 1996 ; references therein). Thus, on the basis of evidence of separate gene pools, notably of M. domesticus and M. musculus in Europe, R. D. Sage and E. M. Prager have denoted them as full species, while other investigators, including P. Boursot, F. Bonhomme, and co-workers (e.g., BOURSOT et al. 1993 , BOURSOT et al. 1996 ; MORIWAKI et al. 1994 ; DIN et al. 1996 ), designate them as subspecies in light of appreciable evidence for a continuum of interbreeding populations over much of Eurasia. These contrasting views become more understandable if M. musculus is a ring species (BONHOMME et al. 1994 ; DIN et al. 1996 ), with the secondary contact in Europe occurring between the most divergent, longest separated forms. Here we designate the taxa as full species, but recognize that it may ultimately prove appropriate to denote at least some commensal populations as members of subspecies.

Recent investigations have addressed the questions of the genetic make-up of the SC Asian populations and the origin and radiation of house mice by restriction analysis (BOURSOT et al. 1996 ) and sequencing (BOISSINOT and BOURSOT 1997 ) of mitochondrial DNA (mtDNA); by electrophoresis of proteins encoded by autosomal loci and restriction analysis of three genes on chromosome 6 (DIN et al. 1996 ); and by Southern blotting, PCR amplification of a variable length marker and of microsatellites, and sequencing of the Y chromosome (NAGAMINE et al. 1992 ; BOISSINOT and BOURSOT 1997 ). The mice studied came from N and S India, several localities in Pakistan, and N and E Iran. The central populations were found to be highly polymorphic for nuclearly encoded proteins and mtDNA in comparison to the populations recognized as M. domesticus, M. musculus, and M. castaneus from around the periphery of the Eurasian land mass. Most of the mtDNAs fell into a diverse group of types that BOURSOT et al. 1996 and BOISSINOT and BOURSOT 1997 call "oriental" (and we call castaneus), while some from Iran were musculus types. Of two categories of Y chromosome, the type found in M. domesticus was detected in the Indian and Pakistani mice, while the Ys in Iran were of the type found in M. musculus and peripheral populations of M. castaneus. These molecular and biochemical data provided the foundation for the hypothesis of the northern part of the Indian subcontinent as the cradle of the commensal species, with centrifugal radiations to the west, north, and east giving rise to the peripheral taxa (BOURSOT et al. 1993 , BOURSOT et al. 1996 ; BONHOMME et al. 1994 ; DIN et al. 1996 ). TANOOKA et al. 1995 and OHTSUKA et al. 1996 , in turn, carried out limited surveys for the presence or absence of a processed p53 pseudogene (p53) on chromosome 17. They observed polymorphism in the Central Asian region, in contrast to the invariable presence (in the homozygous state) of this p53 in a broad survey of mice recognized phenotypically and genetically as M. domesticus and its complete absence in a similar survey of those recognized as M. musculus (PRAGER et al. 1997 ).

In this article, we extend and augment the previously published work in several ways. First, we have filled in genetic "blank spots" on the house mouse map by sampling additional areas—particularly Yemen, Turkey, W and SC Iran, localities throughout Afghanistan, SW as well as N Pakistan, and Nepal. Included are regions, notably Yemen and Nepal, from where anatomical and ecological information is available (e.g., GRUBER 1969 ; HARRISON 1972 ; MARSHALL 1981 ; HARRISON and BATES 1991 ), but no molecular work has been done.

Second, our mtDNA study is done by sequencing all or much of the control region and flanking tRNAs, which, relative to restriction analysis (BOURSOT et al. 1996 ) and sequencing the most variable part of the control region (BOISSINOT and BOURSOT 1997 ), facilitates data analyses involving more distantly related lineages (including those of aboriginal mice), increases resolution, enhances delineation of evolutionary tree structure, and does not require intact high-molecular-weight DNA. In addition to focusing on phylogenetic analyses and biogeographic models, we quantitatively compare the independent duplications of the same tandem repeat.

Third, besides assessing for presence or absence, we carried out a broad survey of sequence variation in a short segment of p53. Fourth, to relate the molecular results to morphologically based categories (e.g., see MARSHALL 1981 ; MARSHALL and SAGE 1981 ), we provide phenotypic and anatomical information for many of the animals we studied.

Finally, our survey of the geographically most interesting areas was carried out largely using museum skins as the DNA source because of the ready availability of specimens from these remote areas. A special value of using museum study skins is that molecular genotypes can be linked to specimens that have been previously classified by taxonomists on the basis of morphological traits conventionally used to define rodent taxa. In addition, these study skins are in public institutions and, thus, available for future analyses by other investigators. Because the DNA in such skins is present in reduced amounts and is generally broken down into small pieces, we used sets of primers that amplify short segments to screen the genetic variability of house mouse specimens. As one must amplify several fragments to sequence the same mtDNA region normally obtained in one or two fragments from total genomic DNA prepared from frozen tissues, our strategy was to sample one or two individuals per locality over a broad range and to survey dozens rather than hundreds of individuals. The markers, i.e., variable sites, we identified among new mtDNA lineages and at a p53 locus should facilitate future surveys of variation in house mice from additional localities.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Specimens:
Skin snippets, typically 6 mm² per mouse, from 50 of the animals (Table 1, Figure 1) were sent to us in 1991 and 1992 from the Field Museum of Natural History in Chicago. Using ethanol- and flame-sterilized instruments, we cut similarly sized skin snippets from 18 mice in the collection of the Museum of Vertebrate Zoology (MVZ) at the University of California in Berkeley; the 12 samples from mainland China came to the MVZ from the Academia Sinica in Beijing. The Museum of Zoology at the University of Michigan in Ann Arbor sent us frozen tissues of eight Pakistani mice listed by the Field Museum (Table 1); we snipped and extracted them in the same ways as the skin specimens. The mice had been collected during 1951–1954 in Yemen and Turkey, 1961–1975 in Egypt, Iran, Afghanistan, and Nepal, 1990 in Pakistan, and 1945–1978 in eastern Asia. Genomic DNAs, many of them available from previous projects (PRAGER et al. 1993 , PRAGER et al. 1996 , PRAGER et al. 1997 ), were used along with the skin and tissue extracts to survey the following: (1) types of Y chromosomes and (2) presence/absence polymorphism and sequence differences at a p53 locus. Table 2 provides phenotypic descriptions and measurements of 74 of the commensal mice studied.

View larger version (28K): In this window In a new window Download PPT slide   Figure 1. Map showing 67 collecting localities for mice, as numbered in Table 1. Locality 52 is placed roughly because its latitude and longitude could not be obtained.

Extractions:
With sterilized forceps, we rinsed each snippet of skin or tissue through a series of eight 40-µl drops of water before putting it into 250 or 500 µl of extraction solution in a 2-ml screw-cap (for autoclaving) or 1.5-ml locking microcentrifuge tube. Negative controls consisted of (1) sterilized forceps put through the water droplets and then dipped into the extraction tube and (2) untouched extraction solution. Specimens from all 76 individuals were extracted by adding them to a 5% Chelex (Bio-Rad, Richmond, CA) suspension in water, autoclaving for 5 min, and vortexing vigorously for 15 sec. Working stocks containing some Chelex beads were stored at -20°; these sample tubes were vortexed, and the beads were spun down before each PCR. For each 12.5-µl double-stranded amplification of mtDNA and nuclear loci, 1–2 µl of extract was generally used. Fresh snippets of 13 MVZ skins and of the frozen tissues were extracted by a second procedure that, for several skins, markedly improved our ability to amplify at least mtDNA segment 1 (Figure 2) or additional, longer pieces (e.g., segment 4), and for the Pakistani tissues, facilitated amplification of 0.5–0.7-kb fragments. The samples were first heated at 56° for 2 hr in 250 µl of hair lysis buffer, which contains 10 mM Tris-HCl (pH 8.0), 35 mM dithiothreitol, 0.9% Laureth 10 (Macol LA-12; PPG Industries), and 50 µg/ml proteinase K. The tubes were then spun down, 2.5 µl of 10 mg/ml RNase A was added, and the 56° incubation was continued for 1 hr. After the tubes were vortexed, 225 µl of a 5% Chelex suspension in water was added and incubation at 95° was done for 20 min. After centrifugation, 350 µl of the supernatant (without Chelex beads) was removed, stored, and used as the DNA source for PCR as described above.

View larger version (11K): In this window In a new window Download PPT slide   Figure 2. Strategy for amplification and sequencing of 0.8–0.9 kb of the control region and flanking tRNA genes of mouse mtDNAs retrieved from museum skins. Arrows denote primers, bars 1–4 indicate the individual segments amplified, and r1 and r2 represent, respectively, the 5' and 3' tandem repeats. Three-letter abbreviations stand for the tRNA genes; 12S is the small ribosomal RNA gene. Nucleotide positions are numbered throughout this report according to the domesticus type 1 sequence as described previously (PRAGER et al. 1993 , PRAGER et al. 1996 ). The basic strategy was to amplify segments 1–4 with primer pairs 1 + 2, 3 + 4, 7 + 9, and 10 + 12, and to sequence single-stranded templates generated from both strands with the PCR primers used as sequencing primers, except that primer 11 was substituted for primer 12. Additional primer pairs (e.g., 13 + 14, 15 + 16) and internal sequencing primers (e.g., 13–16) were sometimes used. Apart from occasional length variants, the sizes (between primers) of amplified segments 1–4 are in order 160, 224–301, 242–243, and 194 bp. Primers 5, 6, and 8 were used during amplification in two portions and sequencing of the entire 1.0–1.1-kb region from extracts of frozen tissue according to strategies described previously (PRAGER et al. 1993 , PRAGER et al. 1996 ). The region between segments 2 and 3 is totally invariant among all reported commensal mouse mtDNA sequences; the 12–18 bp where primers 2 and 3 and primers 9 and 10 overlap are conserved, except for three positions, each of which is variant in one domesticus or musculus mtDNA, and a fourth position that is variant in two castaneus mtDNAs (PRAGER et al. 1996 and references therein; BOISSINOT and BOURSOT 1997 ; this report). Primers 3, 5, 6, 8, 9, 11, and 12 correspond, respectively, to primers 2–5, 7, 8, and 9B of PRAGER et al. 1993 , and primer 4 corresponds to H15720 of PRAGER et al. 1996 . Locations (L, light strand; H, heavy strand; numbers representing positions of the 3' base) and 5'-to-3' sequences of the other primers are as follows: 1, L15320, ATTACTCTGGTCTTGTAAACC; 2, H15481, ATGTACTTGCTTATATGCTT; 7, L15911, GTGGTGTCATGCATTTGGTAT; 10, L16171, TTAACTATCAAACCCTATGT; 13, L15537, GGTCATAAAAYAACYATCAACA; 14, H15612, TCATGRTGTATATCAGTTTAGTYA; 15, L15538, AAGACATACCTRTRTTATCTRACT; 16, H15616, AGAGTTTATGACTGTATGGTGTAT.

PCR amplification and sequencing:
Figure 2 outlines the strategy for obtaining the sequence of the variable parts of the mitochondrial control region plus flanking tRNAs from extracts of museum skins by amplifying with four pairs of primers. Double-stranded products of segment 2 (the most variable region) from most of the skin specimens from the Field Museum were generated in 25-µl volumes using reactant solution 1 (PRAGER et al. 1993 ), which has 1 mM of each dNTP and 6.7 mM MgCl₂, and adding 1.6 µg of T4 gene 32 protein (United States Biochemical Co., Cleveland, OH; LESSA et al. 1992 ). Amplification was done in a PCR-1000 thermal cycler (Perkin Elmer, Norwalk, CT) for 35–38 cycles of denaturation at 92° for 40 sec, annealing at 60° for 1 min, and extension at 72° for 30 sec. The rest of the double-stranded PCRs were done in 12.5-µl volumes using reactant solution 2 (PRAGER et al. 1997 ), which has 0.2 mM of each dNTP and MgCl₂ at 2.5 mM (primer pairs 1 + 2 and 3 + 4) or 3.5 mM (primers 7 + 9 and 10 + 12); 0–0.8 µg of T4 gene 32 protein or 0.13 µg of Escherichia coli SSB (Pharmacia, Piscataway, NJ) was added for segment 1, and 0.2 µg of the T4 protein was added for segments 2 and 4. PCR in a Perkin Elmer 480 cycler was generally carried out for 36–37 cycles; each cycle consisted of 92° for 50 sec (but 3 min for the first cycle), 60° for 45 sec, and 72° for 20 sec (but 3 min for the last cycle). For segment 3, a hot start [as described by PRAGER et al. 1997 ] was followed by a "touchdown" procedure: seven precycles, during which an initial annealing temperature of 67° was lowered by 1° for each successive cycle, preceded 36 cycles with annealing at 60°. Amplifications with primer pairs 13 + 14, 13 + 16, 15 + 16, 3 + 16, and 13 + 4 were done for 43–45 cycles, often with a hot start, using reactant solution 2 (2.5 mM MgCl₂ for all) and the second cycling protocol given above, except that the annealing temperature was 56° for pairs 15 + 16 and 13 + 4.

For the eight mice from Pakistan, we not only amplified and sequenced segments 1–4, but also amplified the entire region in Figure 2 in two portions, with primer pairs 1 + 6 and 5 + 12, as done previously for genomic DNAs and purified mtDNAs (PRAGER et al. 1993 , PRAGER et al. 1996 ), and sequenced unidirectionally using primers 1, 3, 8, 9, and 11. Amplification of these two longer fragments from our extracts was appreciably harder than from isolated genomic DNAs. The 5' portion was amplified from seven individuals with reactant solution 2 (with 2.5 mM MgCl₂) and, after a hot start, 45 cycles of 93° for 50 sec (3 min during cycle 1), 60° for 45 sec, and 72° for 20 sec (3 min during cycle 45). The 3' portion was amplified from four mice using reactant solution 1 and the previous protocol (PRAGER et al. 1993 ), but with 32 cycles rather than 25, and from three other mice using solution 2, but with the high dNTP and MgCl₂ concentrations characteristic of solution 1 and, after a hot start, 36 or 43 cycles of 93° for 50 sec (3 min for cycle 1), 64° for 45 sec, and 72° for 1 min (3 min for the last cycle).

Gel purification of the double-stranded products in 5 µl of the reaction was done in 2% (occasionally 3%) NuSieve agarose as described previously (PRAGER et al. 1993 ); some or all of the band with the amplified fragment was diluted 2- to 40-fold in water. PCR to yield single-stranded templates for sequencing in both directions was done in 25-µl volumes under a variety of conditions (details available from the authors). Segment 3 in Figure 2 proved to be the hardest from which to obtain templates amenable to sequencing, particularly in the direction of excess primer 7, and we did not sequence the segment fully from any individual. Nearly all 50 skin samples from the Field Museum worked well for PCR and sequencing. In contrast, 14 of the 18 from the MVZ (all but those from Korea and Taiwan) were harder to amplify; from eight, we could sequence only segment 1 or segments 1 and 4 (see Table 1).

Double-stranded amplifications of a short segment of the duplicated Zfy-1 and Zfy-2 genes on the Y chromosome (with a hot start and 45 cycles for the museum skin and tissue extracts) and of two short segments of a p53 plus one of the functional p53 gene (with 37 cycles or a hot start followed by 42 cycles for the skin and tissue extracts) were done as described by PRAGER et al. 1997 . The Y primers, Zfy2DF and Zfy2DR, yield PCR products of 184 and 202 bp and bracket the 139- or 157-bp region extending from the second position of codon 467 through the second position of codon 519, with codons 480–485 deleted in Zfy-2 in one type of Y. p53 and p53 primer pair Int5S + Int5R brackets the 89- or l67-bp region extending from the third position of codon 182 to the first position of codon 212, with codons numbered according to the cDNA sequence of the functional gene; the size difference is caused by the 78-bp intron 5 in p53. As the p53 and p53 PCR products of 137 and 215 bp are close in size, one can score presence or absence of p53 while confirming successful PCR by appearance of the p53 product, and can usually also distinguish between individuals homozygous and heterozygous for p53 (PRAGER et al. 1997 ). Primers Exon 4 and Exon 5 bracket a 128-bp piece of the p53 in commensal mice and a 133-bp piece in M. macedonicus and M. spicilegus; these extend from the third position of codon 109 to the third position of codon 153, and the PCR products are 176- or 181-bp long. We tested one or both p53 primer pairs on genomic DNA of nine M. spretus (four from Catalunya and two from Puerto Real in Spain plus three from Azrou, Morocco) to confirm the previous inference, based on one Spanish mouse (TANOOKA et al. 1995 ; OHTSUKA et al. 1996 ), that this species lacks a p53. Gel analysis and purification of PCR products in 3% NuSieve agarose were done as described before (PRAGER et al. 1993 , PRAGER et al. 1997 ). Single-stranded templates for sequencing were made (details available from the authors) in one direction from the shorter Y chromosome fragment (for sequencing with primer Zfy2DR), in both directions with primers Exon 4 and Exon 5, and in one or both directions with primers Int5S and Int5R.

Desalting of templates, which were generally resuspended in 15 µl of water, and dideoxy sequencing were done as described before (PRAGER et al. 1993 ), except that half volumes were used for the sequencing reactions and usually only wedge gels were required. Segments 1–4 in Figure 2 total 820–835 bp in most of the mtDNAs and 898 bp in those bearing a tandem 76-bp repeat. For mice where museum skins were the starting material, we read for n = 58 an average of 744 bp (range, 385–890 bp), and for the n = 10 worst results, an average of 233 bp (range, 160–354 bp). Starting with the frozen tissues, we read (of totals of 1043 or 1119 bp) an average of 1059 bp (range, 964–1119 bp; n = 6 had no unread sequence). GenBank accession numbers for the 59 new mtDNA sequences we determined are AF074490–AF074548.

Y chromosome sequences of the 139-bp segment (average of 126 bp read) were determined to see whether the same 18 bp had been deleted in Ys from diverse areas. The mice assessed were 13 of the 16 with the B type of Y in Table 1 (all but that from locality 34 and two from locality 50) plus one each from Croatia, Moldova, and Ukraine, and two from Germany. The GenBank accession no. for the variant sequence found is AF074549.

An average of 126 bp was read for a 128-bp p53 fragment flanked by primers Exon 4 and Exon 5 (n = 79 commensal mice; localities and individuals detailed in Figure 10). Complete 133-bp sequences (which match the functional gene) inferred to come from a separate p53 locus were determined from two commensal mice; to obtain this slightly longer sequence from a mouse yielding both bands, with heteroduplex formation and/or trailing of the shorter fragment in the area of the longer one, we subtracted out the bases found in the shorter piece. The mice and localities that yielded each of the five distinct sequence phenotypes (see RESULTS) obtained by sequencing 133 bp (average of 129 bp read; n = 9) from aboriginal mice at the locus, designated p53-1, that is shared with most commensal mice are as follows: (1) two M. macedonicus from Gradsko, Macedonia, and one from Turkey (no. 74392), plus a M. spicilegus from Halbturn, Austria; (2) one M. spicilegus from Debeljaca, Serbia, and one from Kishinev, Moldova; (3 and 4) each in one M. spicilegus from Srpska Mitrovica, Serbia; (5) one M. spicilegus from Debeljaca. By sequencing between primers Int5S and Int5R, we defined one 89-bp sequence for this second segment of p53-1 (in Georgian mouse 4569 plus one from Bokhorst, Germany) and two 167-bp sequences for the equivalent part of the functional p53 (from the data for two German mice from Burg and Dannau). GenBank accession numbers for the 24 p53 and two p53 sequence phenotypes we obtained are AF074551–AF074576.

View larger version (40K): In this window In a new window Download PPT slide   Figure 3. Variable sites in newly described types of domesticus, musculus, and macedonicus mtDNAs. For each category, the polymorphic sites are listed vertically across the top; lowercase letters denote sites added 3' of the indicated nucleotide relative to the baseline (domesticus 1) sequence. The sequence for each type 1 (previously determined) is shown at all sites; the bases in the other types are shown only where different. —, deletions relative to other sequences; ?, unsequenced sites. Length changes involving >1 bp have been counted as single sites. Among the 110 distinct domesticus mtDNAs in Figure 7, 107 sites are variable; 7 more vary among the 20 additional distinct domesticus mtDNAs identified from the partial sequences reported by BOISSINOT and BOURSOT 1997 . Among musculus mtDNA types 1–45 (see Figure 5A), 55 sites are variable (with position 15470 uniquely variant in type 45, which is omitted from all analyses), and 10 more vary among the 15 additional distinct musculus mtDNAs identified from the partial sequences in BOISSINOT and BOURSOT 1997 .

View larger version (59K): In this window In a new window Download PPT slide   Figure 4. Variation at 94 polymorphic sites among 34 types of castaneus and Yemeni mtDNA sequences shown in the format of Figure 3. The + at 15537a indicates a tandem 76-bp repeat of the sequence from 15538 to 15615; the variation in the 3' repeat appears on separate lines designated 3'. Among the 28 castaneus types, 78 sites are variable, and 16 more vary among the 27 additional distinct castaneus mtDNAs identified from the partial sequences in BOISSINOT and BOURSOT 1997 (see Figure 6). The tandem repeats in castaneus types 16–28 are 76-bp long, rather than the 75 bp in musculus types 32–36 (Figure 5A), because all musculus mtDNAs have a 1-bp gap at positions 15570–15572. Among the six Yemeni mtDNAs, 16 sites vary.

View larger version (22K): In this window In a new window Download PPT slide   Figure 5. Parsimony trees for 44 musculus mtDNAs (A) and six Yemeni mtDNAs (B). The number of mutations inferred to have occurred along each lineage is indicated. The large solid triangle in A marks the lineage where the 75-bp tandem repeat of the sequence from 15538–15615 arose; small open triangles mark the five lineages with inferred additions of 1–2 bp. Aust, Austria; Bavaria and Bav, Bavarian transect (see PRAGER et al. 1996 ); Croa, Croatia; Czech, Czech Republic; Dagh, Daghestan; N, northern; NC, north central; S, southern; Slov, Slovakia; SW, southwestern; Turk, Turkmenistan. Heavy horizontal lines in A highlight the terminal lineages leading to the eight new musculus mtDNA types and also the 15 of 23 internal branches present in 100% of the 4128 minimal-length trees that PAUP found for these 44 mtDNAs plus castaneus type 1 used as an outgroup. The musculus tree requires 84 mutations: 66 transitions, 12 transversions, and six length changes (consistency index = 0.73). The eight internal branches not highlighted in A occur in 44–86% of all the minimal-length trees. The musculus tree was rooted as shown in all PAUP analyses done. The variation in the single most parsimonious network derived for the six types of Yemeni mtDNA can be explained by 16 transitions and one transversion (consistency index = 0.94). The root was placed as shown in B on the basis of diverse analyses that included a variety of commensal or commensal plus aboriginal mtDNAs. Among the 17 distinct musculus mtDNAs identified by BOISSINOT and BOURSOT 1997 by sequencing positions 15443–15742, type B92 from Latvia matches our types 7, 9, 10, and 16–19 for this 0.3-kb region, and B94 from Georgia matches type 31. Their 15 other musculus mtDNAs can be added to the tree in A as follows (see MATERIALS AND METHODS for details), with several of the placements being tentative: types B93 from Latvia and Armenia, B95 from Armenia, and B96, B97, B99, and B101–B103 from Georgia emanating from the same basal node as types 25–28 and 31, with B97 + B99 + B103 and B101 + B102 associated in clades; B130 from Moscow in a clade with type 35; B91 from Georgia and B100 from Daghestan emanating from the same basal node as types 32–36 and 44; B98 from Georgia breaking up the deepest internal branch into two branches, such that among the types depicted, only the clade of 38–40 lies deeper within the musculus tree; the phylogenetically equivalent Iranian types B118 and B129 from Mashhad and B119 from Kakhk in a clade that shares a common lineage with the clade of types 38–40 or (among additional equally parsimonious options) emanation from the same node as suggested for B98.

View larger version (27K): In this window In a new window Download PPT slide   Figure 6. Parsimony tree constructed for 28 types of castaneus mtDNAs shown with heavy lines in the format described for Figure 5. Thin lines indicate the placement (see MATERIALS AND METHODS) of and additional branchings generated by the 29 castaneus mtDNAs identified by BOISSINOT and BOURSOT 1997 from the sequences of positions 15443–15742; type B127 matches our types 3 and 4 in that portion of the control region and B136 matches our type 19. Pak, Pakistan; single letters and two-letter combinations of C, central; E, eastern; N, northern; S, southern; W, western. The source localities

View larger version (43K): In this window In a new window Download PPT slide   Figure 7. Parsimony tree for 110 domesticus mtDNAs shown in the format described for Figure 5. Solid circles indicate the connection of the left and right halves of the tree. Den, Denmark; Eng, England; Fin, Finland; Ger, Germany; Nor, Norway; Swe, Sweden; Switz, Switzerland; Scotland includes also localities in the Orkney and Shetland Islands. The solid triangle marks the lineage where the 11-bp direct repeat of the sequence at positions 16073–16083 has arisen; open triangles mark 36 lineages with inferred additions or deletions of 1–5 bp. Heavy horizontal lines highlight the 14 new domesticus mtDNA types and the 36 of 54 internal branches that are present in 100% of all minimal-length trees. This tree requires 237 mutations: 171 transitions, 26 transversions, and 40 length changes (consistency index = 0.50). The root was placed as shown from the strict consensus tree of an analysis that included musculus mtDNA types 1, 20, 29, 30, and 38–40; Yemeni types 1, 2, and 6; and castaneus types 1, 9, 12, and 28. Six of the internal branches not highlighted occurred in 65–90% of all minimal-length trees, nine occurred in 21–50%, and three were not evaluated [see MATERIALS AND METHODS and PRAGER et al. 1993 , PRAGER et al. 1996 for further details]. Among the 25 distinct domesticus mtDNAs identified by BOISSINOT and BOURSOT 1997 by sequencing positions 15443–15742, type B66 from Tunisia matches types 86, 87, 89, and 90 for this 0.3-kb region; Tunisian B67 matches type 94; Tunisian B75 matches types 80 and 99; French B82 matches type 76; and French B84 matches types 15, 16, and 59–61. Twelve of their 20 domesticus sequences distinct from types 1–110 could be assigned (see MATERIALS AND METHODS) to specific sections of our tree with reasonable confidence, as follows: B83 from Italy emanating from the same node as type 17 and the clades of 11 + 81 and 13–16 + 57–61; clades of Tunisian B64 + B65 and B78 + B79 emanating from the same basal node as types 80, 99, and several other lineages; Spanish B80 + B81 in a clade emanating from the same node as types 20 and 21; Tunisian B76 and B77 emanating from the same node as types 18 and 77; Tunisian B72–B74 in a clade with type 100, with B72 + B73 grouped therein. Possible placements for the remaining eight sequences are as follows: clades of Georgian types B85 + B88 and B86 + B87 emanating from the same node as type 110 and the clade of 1–6 + 70; Tunisian B68, B69, a clade of B70 + B71, and perhaps also B67 (see above) emanating from the same node as type 97 and the clade extending from type 7 to 10.

View larger version (14K): In this window In a new window Download PPT slide   Figure 8. Parsimony tree for mtDNAs of commensal house mice. First, this tree schematically summarizes the information in Figure 5 Figure 6 Figure 7. Thus, for example, the musculus portion represents the deepest intra-musculus node, plotted at an average of 4.2 events per lineage as in Figure 5A. Second, it adds six lineages that connect the four trees in Figure 5 Figure 6 Figure 7 to one another; the 48 events assigned to these lineages (at 47 polymorphic sites) consist of 35 transitions, nine transversions, and four 1–2-bp length changes (open triangles). Assignment of mutations to these six lineages, selection of branching order, and root placement were done by considering 188 commensal mtDNA sequences (i.e., all those in Figure 5 and Figure 7 plus types 1–28 in Figure 6) and those from aboriginal house mice. Parsimony and neighbor-joining (Figure 9) trees, pairwise distances, and estimates of nucleotide variability (Table 3) were taken into account. In analyses of commensal plus aboriginal sequences, arrangement of the deeper commensal lineages and placement of the deepest root were not completely stable to methods of tree construction and choice of representative sequences (e.g., see Figure 9 and its legend). While the musculus, Yemeni, and domesticus mtDNAs each invariably formed a monophyletic clade (bootstrap values of 97–100% in 1000 replications in two parsimony analyses of 13 commensal plus 6 aboriginal sequences, including the set of types in Figure 9), as did all commensal mtDNAs collectively (100% bootstrap values), this was not true of the castaneus mtDNAs. Indeed, in some parsimony analyses, the domesticus mtDNAs were implied to emanate from the same node as castaneus type 13. The branching order and rooting shown here were, therefore, chosen based on intracommensal parsimony trees and distance values.

View larger version (18K): In this window In a new window Download PPT slide   Figure 9. Neighbor-joining trees for 19 mtDNAs from commensal and aboriginal house mice. In A, all changes were weighted equally; in B, transversions were weighted fivefold relative to transitions and length changes. The deepest and second-deepest commensal clades are, respectively, domesticus and Yemeni mtDNAs in both trees. However, the castaneus mtDNAs are monophyletic in A but paraphyletic in B. In the analogous analyses for only 14 sequences (with dom 96, mus 38, and cas types 10, 13, and 14 omitted), the branching order of both trees matched A here.

View larger version (30K): In this window In a new window Download PPT slide   Figure 10. Variable sites, observed sequence patterns (A), and inferred alleles (B) in a 128-bp segment of a p53 pseudogene among 79 commensal mice from 68 localities, presented in the format of Figure 3 and Figure 4. The 12 variable sites are listed vertically according to codon number and position within the codon; S, R, and Y indicate, respectively, C + G, A + G, and C + T; ?, unsequenced sites. Phenotype 1 and allele 1 at locus p53-1 differ from the functional p53 in having codons 120 and 121 deleted, a T inserted between positions 2 and 3 of codon 122, and a stop signal at codon 143. Locality numbers and, if necessary, identification numbers are included in A for regions in Table 1 where not all mice had the same sequence phenotype. A, Afghanistan; P, Pakistan; N, Nepal; h, heterozygosity for presence/absence of the p53. In B, Chr tabulates the number of chromosomes out of 151. Because phenotypic patterns 4, 9, and 14 are each polymorphic at two or three sites, one cannot infer their allele sequences conclusively in the absence of sequencing multiple clones of PCR products. Thus, 14 should be regarded as the minimum number of distinct alleles, and the sequences of postulated alleles 3 and 14 should be viewed as uncertain. (Assignment of both variant bases in phenotype 4 to allele 3 was arbitrary.) At site 111-2 in phenotypes 17 and 18, the Nepalese mouse and Taiwanese animal 152831 may have A +

Calculations:
We made use of the 139 published Mus mtDNA sequences for this 1-kb region included by PRAGER et al. 1996 : domesticus types 1–96, musculus types 1–36, castaneus and macedonicus types 1, spicilegus types 1–3, and spretus types 1 and 2. Because segments 1–4 encompass almost all the known intracommensal mtDNA sequence variation in the whole control region and flanking tRNAs (Figure 2), we assumed for all sequences considered here a length of 1000 bp for computations of nucleotide variability, which was estimated with the parameters and as before (NACHMAN et al. 1994 ; PRAGER et al. 1996 ). This assumed length is very close to the averages read by PRAGER et al. 1996 (and references therein), starting with total genomic DNA or purified mtDNA.

Character-state parsimony trees for mtDNAs were constructed with the PAUP (Phylogenetic Analysis Using Parsimony) version 3.0s program with a heuristic search procedure and equal weighting of all character changes, as described in detail previously (PRAGER et al. 1993 , PRAGER et al. 1996 ). As before, smaller subsets of a given dataset (notably that of 110 domesticus mtDNA sequences) were analyzed with PAUP to examine all most-parsimonious arrangements in various sections of the tree and to root trees and relate major commensal mtDNA lineages to one another (see also legends to Figure 5 Figure 6 Figure 7 Figure 8). Neighbor-joining mtDNA trees were constructed with the PHYLIP 3.572c program from matrices of pairwise differences computed after weighting transversions five times as heavily as other changes, as well as from matrices of unweighted differences. M. spretus mtDNAs served as the outgroup to those of all the other taxa (cf. PRAGER et al. 1996 ).

For the reasons discussed by PRAGER et al. 1996 , we assumed the likeliest base at missing variable sites for tree construction and computation of pairwise differences; as argued before, the likelihood of an incorrect assignment is often low and the consequences are in most cases expected to be minor. For the sequence types newly defined here, we do not expect the assumptions made for unsequenced sites to have an effect on any substantial inferences, except perhaps with respect to castaneus types 14 and 15. The specific assumptions made beyond those in PRAGER et al. 1996 are as follows: For musculus mtDNA types 37–44: as in type 1 at all missing sites. For domesticus types 97–110: T at position 15912 in types 97–99 and 102–110, C at position 16012 in type 99, as in type 1 at all other missing sites. Among castaneus types 2–28: as in type 1 at all sites missing in types 6, 7, 12, 14, 16, 17, and 19; G at position 15958 in type 23; types 15, 20, 22, and 25 taken as matching, respectively, types 14, 21, 23, and 24. For the mtDNAs in Figure 4, except castaneus 8 (for which we made no assumptions), any additional missing sites beyond the 94 sites in that figure were assumed to match castaneus type 1; macedonicus types 1–3 were assumed to match at all sites missing in any of the three sequences.

Analogous to the procedures described for musculus mtDNA types 32–36 (PRAGER et al. 1996 ), variable positions within the tandem repeats in castaneus types 16–28 were entered into the computer only once for PAUP analyses, and seven events were added by hand after tree construction: at position 15548, T to A in the 5' copy of type 23; at 15550, T to C in the 5' copy of type 24 or in the 3' copy of type 25; at 15554, T to C in the 5' copy along the lineage leading to the clade of types 16–28 and C to T in the 5' copy of type 22; at 15569, T to C in the 5' copy of type 28; at 15581, A to G in the 5' copy of type 27; at 15601, T to C in the 3' copy of type 18.

BOISSINOT and BOURSOT 1997 reported the sequences of mtDNA positions 15443–15742 from 131 commensal mice. Among the 71 mtDNA types they defined, 62 are distinct from the 189 collectively defined by us and NACHMAN et al. 1994 . Their segment of 297–374 bp (allowing for length variants and tandem repeats) encompasses segment 2 and part of segment 1 in Figure 2, and includes the most variable part of the control region (PRAGER et al. 1993 , PRAGER et al. 1996 ). Sequencing this 0.3-kb fragment is likely to detect much of the diversity among the mtDNAs examined, but it lacks many of the variable sites that provide structure and define clades in our parsimony trees based on the 1-kb region in Figure 2. We, therefore, added the BOISSINOT and BOURSOT 1997 mtDNAs to the trees in Figure 5A, Figure 6, and Figure 7 by hand after tree construction. Their 29 castaneus mtDNAs could be placed with appreciable confidence, so we show them explicitly in Figure 6; placement of their 17 musculus (Figure 5A) and 25 domesticus (Figure 7) mtDNAs is described in the figure legends. We preface the BOISSINOT and BOURSOT 1997 mtDNA type numbers with the letter B, except within Figure 6.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Mitochondrial DNA sequences:
Among the 76 newly studied mice from 60 localities, we resolved 61 distinct sequences (Table 1, Figure 3 and Figure 4); 57 of them correspond to types of mtDNA not seen in earlier surveys (PRAGER et al. 1993 , PRAGER et al. 1996 ; NACHMAN et al. 1994 ; BOISSINOT and BOURSOT 1997 ). The new types are assignable to four previously recognized clades (i.e., domesticus, musculus, castaneus, and macedonicus) and one distinctive new clade (see below). Two types we saw before were dom 28 and mus 24; in addition, each of the partial sequences B127 and B136 matches one or two of our castaneus types (see Figure 6). For eight animals, our fragmentary sequences allowed classification to the musculus and castaneus mtDNA categories, but not designation of specific mtDNA types (Table 1).

Our survey revealed domesticus mtDNAs in 18 mice—all the commensals from Egypt and Turkey plus three from Iran. The results for the Egyptian mice concur with previous mtDNA (e.g., FERRIS et al. 1983 ; PRAGER et al. 1993 ) and protein electrophoretic (SAGE 1981 ) evidence as well as phenotypic classification. They supplement the earlier mtDNA work on specimens from NE Egypt by documenting domesticus mtDNAs in the NW and SE parts of the country. In what appears to be the first mtDNA characterization of Turkish mice, we detected six domesticus mtDNAs from four localities in the country's SE quarter, from sea level on the eastern Mediterranean to the mountains bordering Lake Van. This study also marks the first report of domesticus mtDNA in Iran, which we found at localities 18, 19, and 21 along the western border, the first two in the Zagros Mountains and the third near the Persian Gulf.

Seventeen of the newly surveyed mice had musculus mtDNAs, 13 of them from areas in East Asia known to harbor musculus mtDNAs (YONEKAWA et al. 1988 ; NAGAMINE et al. 1994B ). We found musculus mtDNA in NC Iran, at locality 25 on the Caspian Sea, which is consistent with recent detection of musculus mtDNAs in E Iran (BOISSINOT and BOURSOT 1997 ). Our study is the first report of musculus mtDNA in Afghanistan, which we found at localities 31–33, extending some 500 km across the northern edge of the country, just north of the great central mountain range.

Seven of the newly surveyed mice had sequences (cas types 1–5; Figure 4, Table 1) very similar to castaneus type 1 known from Thailand. Four of these mice came from Taiwan, SE mainland China, and the Philippines, areas where such castaneus mtDNAs are well known (YONEKAWA et al. 1988 ; NAGAMINE et al. 1994B ; BOURSOT et al. 1996 ; BOISSINOT and BOURSOT 1997 ); the M. castaneus animal from the Mariana Islands also had such a cas mtDNA. Types 2 and 3 at localities 38 and 40 on the SW Pakistan coast are the first report of this kind of mtDNA in that country. Transport beyond a natural range by humans via shipping merits consideration. However, as BOURSOT et al. 1996 and BOISSINOT and BOURSOT 1997 have documented such castaneus mtDNAs in SW and NC India (see Figure 6) and the subspecies (castaneus and tytleri) of M. castaneus are known from much of India, finding this kind of mtDNA in SW Pakistan may not be surprising. The pelage of these two Pakistani mice is not characteristic of M. castaneus, but the skull of one of them is (Table 2).

We found a diverse collection of mtDNAs denoted castaneus types 6–28 among 23 mice from Central Asia: Iran, Afghanistan, Pakistan, and Nepal. Among the mice with such mtDNAs are those from localities 35–37, which are in the general area of Kabul, and Pakistani localities 43–45, which are in the general area of some of those in the BOURSOT et al. 1996 and BOISSINOT and BOURSOT 1997 surveys; the remainder represent previously unsampled areas. As reported in a preliminary account (PRAGER et al. 1996 ), types cas 16–28 have a second, tandem 76-bp copy of a control region segment that is independently duplicated in the musculus 32–36 clade of mtDNAs (cf. Figure 5A). Within a given mtDNA type, the repeats differ by one to seven base substitutions and, by several criteria (see below), are considerably more diverse than those of the musculus mtDNAs. BOISSINOT and BOURSOT 1997 have also documented the independence of the musculus and castaneus duplications.

We use the name castaneus for mtDNA types cas 1–28 [and the 29 phylogenetically related types from BOISSINOT and BOURSOT 1997 ], even though few of the mice bearing these mtDNAs, especially outside the clade of types 1–5, have been called M. castaneus on phenotypic and morphological grounds (Table 2). There are two reasons to apply one name to all these mtDNAs: first, mice bearing mtDNAs in the shallow clade with types 1–5 are intermixed throughout the Indo-Pakistan area with mice bearing types outside this clade (see Figure 6), which suggests they belong to the same interbreeding population and are connected by considerable amounts of gene flow. Second, these mtDNAs constitute a phylogeographic unit. BOURSOT et al. 1996 and BOISSINOT and BOURSOT 1997 have also recognized the apparent unity of this group, but with the name "oriental." We prefer castaneus because it follows the heretofore used protocol of describing gene lineages with names derived from species names of the mice and was already applied to type 1.

PRAGER et al. 1996 reported both domesticus and musculus mtDNAs in SW Georgia (locality 16), which is consistent with the ORTH et al. 1996 inference of a broad area of secondary contact and remixing of genomes in Transcaucasia. To the countries with different major lineages of commensal mtDNAs we can now add Iran [also from the results of BOISSINOT and BOURSOT 1997 ] and Afghanistan.

Most remarkable in our present survey are the six mtDNAs of Yemeni mice (Figure 4). They are similar and clearly related to one another (pairwise differences of 2–11 bp) but rather different from all the other kinds of mtDNAs of commensal mice (pairwise differences of 24–47 in Table 3 below). Thus, the Yemeni mtDNAs represent a major new lineage from part of the house mouse range previously unexplored at the molecular level. Relevant to our findings, the mice in the southern portion of the Arabian Peninsula were given a distinct subspecific or racial name, M. m. gentilulus [HARRISON 1972; HARRISON and BATES 1991; M. d. gentilulus in MARSHALL and SAGE 1981 ], in light of their being so conspicuously smaller that HARRISON 1972 called them pygmy mice. The Yemeni animals are clearly the smallest long-tailed mice we studied (Table 2). Nine mice from eight nearby localities, to the south and east of ours, had similar traits—with averages (and ranges) for total length, tail length, and tail-to-body ratio, respectively, being 134 mm (111–161), 69 mm (63–83), and 1.07 (0.80–1.31)—as was true also for mice assigned to this taxon from Oman on the SE tip of the Arabian Peninsula and from Bahrain on the Persian Gulf (HARRISON 1972 ). The cranial measurements of the M. (m.) gentilulus mice seem even more distinctively small, relative to the mice from the northern Arabian Peninsula and Mesopotamian areas assigned to M. (m. or d.) praetextus, than do their external dimensions (HARRISON 1972 ).

Evolutionary trees and diversity of mtDNAs:
Figure 5A presents a rooted parsimony tree relating 44 musculus mtDNAs. The present tree differs from the one for musculus types 1–36 (PRAGER et al. 1996 ) in two conspicuous ways: first, it has a new basal clade that is made up of Afghan types 38–40. That the deepest lineage stems from Afghanistan and the next-deepest clade is also from Central Asia accords well with a model [e.g., see Figure 4 of BOURSOT et al. 1996 ] postulating the original homeland of M. musculus and the start of intraspecific divergence in or near this northern fringe of Afghanistan. Our results for nuclear loci (see below) along with their short tails (Table 2) suggest that these mice are authentic M. musculus rather than the products of mtDNA introgression into another species. Second, the average depth of the tree in Figure 5A is ~4.2 events per lineage, 20% deeper than the tree in PRAGER et al. 1996 and close to two-thirds that shown for 110 types of domesticus mtDNAs in Figure 7, contrasted to the earlier relative value of about half inferred for the tree for 36 musculus mtDNAs vs. that for 96 domesticus mtDNAs (PRAGER et al. 1996 ). If we assume that the deepest split among commensal species occurred 350,000–900,000 years ago (SHE et al. 1990 ; BOURSOT et al. 1993 , BOURSOT et al. 1996 ) and that this split corresponds to the deepest node among commensal mtDNA lineages (at the base of the tree in Figure 8), the implication is that the musculus mtDNA lineages examined could have shared a common ancestor some 70,000–180,000 years ago.

Figure 5B shows the most parsimonious rooted tree for the six types of mtDNA from Yemen. The eye-catching feature of the Yemeni tree is that, with a depth of ~3.7 events per lineage, it is nearly as deep as the musculus tree in Figure 5A even though it is derived from ~5% of the number of specimens represented in the musculus tree. One implication is that the mitochondrial lineages in a limited part of the Arabian Peninsula might have begun diverging nearly as long ago (perhaps 60,000–160,000 years) as did the lineages for extant musculus mtDNAs over their entire range of northern Eurasia. The and values in Table 3 suggest that the mice in Yemen are mitochondrially ~60% as variable as is M. musculus, an inference supported by the relative ranges of pairwise differences (notably 0–1 vs. 0–5 transversions and 0 vs. 0–3 length changes). An expectation, also in light of our evolutionary model (see DISCUSSION), is that sampling from additional localities on the southern Arabian Peninsula (HARRISON and BATES 1991 ) would reveal more lineages, including deeper ones, in this newly described major branch of the commensal mtDNA tree.

Figure 6 presents a parsimony tree constructed for the 28 castaneus mtDNA sequences in Figure 4 and also shows placement of the BOISSINOT and BOURSOT 1997 castaneus sequences. The tree for 28 sequences has a transition-to-transversion ratio of 4.2, a value lower than those of 5.5 and 6.6, respectively, for the trees in Figure 5A and Figure 7 and indicative of greater sequence divergence. The average depth of the tree in Figure 6 of ~10.6 events per lineage is, respectively, ~2.5 and 1.7 times as deep as those for musculus and domesticus mtDNAs. The implication is that the mtDNA lineages in Figure 6 began diverging from one another some 170,000–460,000 years ago. The values in Table 3 suggest that these mtDNAs exhibit at least as much genetic diversity as do the domesticus mtDNAs.

Members of the shallow clade of cas 1–5 and related types (Figure 6) are found across the range of mice designated M. bactrianus and M. castaneus, from SW Pakistan through NC India to Taiwan, but the southeastern mice have only this category of mtDNA. One possibility is that ships moved mice with this mtDNA lineage around the area and that this lineage is the dominant one in SW Pakistan and SW India. Another interpretation is that M. castaneus only recently spread into extreme SE Asia. This latter hypothesis invokes filtering out of the mtDNA diversity from the core Indo-Pakistan area as the mice moved through patchy habitats into E India and SE Asia. SAGE and WOLFF 1986 have shown how such repeated colonization events lead to erosion of genetic diversity in peripheral populations. Under the filter hypothesis, we would expect to find only this mtDNA clade in future surveys of mice from the extreme southeastern part of the M. castaneus range. The out-of-India filter model appears favored over the out-of-Pakistan shipping model because members of this shallow clade also occur in NC India.

Figure 7 shows a rooted parsimony tree for 110 domesticus mtDNAs. An important feature is the placement of the easternmost domesticus mtDNAs, i.e., those from Iran, Turkey, and Georgia. Under the earlier hypothesis that the commensal clade arose in the east and M. domesticus originated via westward migration (see Introduction and DISCUSSION), one would predict that the eastern M. domesticus mice would have representatives of all the major mtDNA clades and perhaps some clades not detected in the extensive surveys of the Mediterranean (including North African) and western European animals. Instead, all our Iranian, Turkish, and Georgian mtDNAs [and possibly also the Georgian sequences of BOISSINOT and BOURSOT 1997 ] are limited to the clade comprising the top left quarter of the tree. In contrast, the deepest lineage in our domesticus tree (type 96) comes from two Greek mice, and mtDNAs from Greek mice are also found in all but one of the other deep clades in this tree. Sampling of the eastern domesticus mtDNAs was limited (n = 11 mice and l = 7 localities from Turkey plus Iran; n = 8 and l = 6 for Georgia), but the Greek sample size was similar (n = 11, l = 6). mtDNAs from Spain (n = 11, l = 7) and Italy (n = 34, l = 18) are also found as members of diverse deep clades. This tree does further support the view (PRAGER et al. 1996 and references therein) that southern Mediterranean domesticus mtDNA lineages are older than northern European ones.

Among the new domesticus mtDNAs from Egypt, types 99–101 fall into the same large clade as do the previously characterized Egyptian types 18 and 22–25, type 97 is a deeper lineage in a clade previously containing mtDNAs from NW Europe and Croatia, type 98 constitutes a relatively deep monotypic branch, and type 28 extends the range of mtDNAs with an 11-bp direct repeat to North Africa. Ten Tunisian mtDNAs belong to the clade containing most of our Egyptian mtDNAs (see legend to Figure 7). These results provide increasing evidence for considerable molecular evolution within NE Africa (see also TUCKER et al. 1989 ).

The tree in Figure 7 differs structurally from that presented for 96 domesticus mtDNAs (PRAGER et al. 1996 ) in two notable respects: first, it is shallower, with an average depth of ~6.4 events per lineage rather than 7.3. The start of divergence among all 110 lineages is suggested as some 100,000–280,000 years ago. Second, there has been some rearrangement of the deeper lineages. Specifically, the mtDNAs with C at position 00055 (types 53–56, 68, 69, 91–95, and 102–110) no longer form a monophyletic clade, and they have moved from the lower right of the tree to the upper left. Consequently, the G at position 00055 in types 1–6 and 70 arises via a C-to-G transversion rather than an A-to-G transition. In addition, all the mtDNAs with A at position 00055 are united in a clade (from type 7 down to type 98 in the figure). We previously chose from among equally parsimonious alternatives a tree structure that accounted for the four different bases at position 00055 with two transitions and one transversion (see also PRAGER et al. 1993 ), an option that now does not yield minimal-length trees.

Figure 8 provides an overview of the character-state phylogenetic analyses in Figure 5 Figure 6 Figure 7 and relates the four major commensal mtDNA lineages to one another. The neighbor-joining trees in Figure 9 exhibit the same branching order of the major lineages and the cohesiveness of the musculus, Yemeni, and domesticus clades (each of which is united by 9–14.5 events on the common lineages in Figure 8). The trees reinforce the view that the Yemeni mtDNAs constitute a distinct branch. In both figures, the domesticus lineage occupies the ancestral position among the commensal mtDNAs, the Yemeni lineage appears as the next oldest, and the castaneus and musculus lineages appear to be the two shallowest. This arrangement and rooting of the four commensal lineages are consistent with the values in Table 3. Leaving out the newly discovered Yemeni lineage, the trees in Figure 8 and Figure 9 have the same branching order and root placement as the trees of BOURSOT et al. 1996 and BOISSINOT and BOURSOT 1997 (see DISCUSSION for details). However, as emphasized in the DISCUSSION, the available data do not permit the arrangement and rooting of the four major lineages in Figure 8 to be inferred with statistical confidence, as is true also of the assessment of the cohesiveness of the castaneus mtDNAs. The deepest internal branches in Figure 8 have only three to four events, and they are similarly short in Figure 9. An obvious possibility is that cladogenesis has been rapid.

Tandem repeats of 75 and 76 bp:
Table 4 quantitatively compares the results of the independent duplications of the same control region segment in castaneus and musculus mtDNAs. By all criteria, the duplication occurred earlier among the castaneus mtDNAs: assuming roughly equal rates of evolution, the tree-based analyses place the duplication point at least twice as long ago for the castaneus lineage, with computed depths of ~6.5 vs. 3.0 events per lineage. About the same number of events occurred in the areas flanking and within the repeats among the castaneus mtDNAs, but none accumulated outside the repeats after the duplication among the musculus mtDNAs. Pairwise, the averages and, more importantly, the tops of the ranges are all roughly 1.5- to 3-fold greater among the castaneus repeats. Another contrast is that in the musculus mtDNAs, the 3' copy has accumulated more base substitutions, while among the castaneus mtDNAs, the 5' copy seems to have changed more. Finally, the average of 4.2 substitutions between repeats within a given type of castaneus mtDNA scarcely exceeds that of 3.9 among 5' copies, compared to musculus mtDNAs with noticeably more differences between repeats within a type than in the 5' copy among types (averages of 2.9 vs. 1.2).

Y chromosomes:
In mice from areas where it is clear, based on phenotypic and genotypic criteria, that the nuclear genomes are M. domesticus (e.g., Europe and North Africa), the Zfy-1 and Zfy-2 genes are the same length; equal-sized genes have been reported also for mice [M. (m.) bactrianus or M. (m.) sp.] from India and Pakistan (NAGAMINE et al. 1992 , NAGAMINE et al. 1994B ; BOISSINOT and BOURSOT 1997 ; PRAGER et al. 1997 ). Where the nuclear genomes are M. musculus (E Europe and N Asia) by the same criteria, the Zfy-2 gene is 18 bp shorter; such shorter genes have been found also in M. castaneus mice of extreme SE Asia (NAGAMINE et al. 1992 , NAGAMINE et al. 1994B ; BOISSINOT and BOURSOT 1997 ; PRAGER et al. 1997 ). The shorter Zfy-2 can be inferred to be the derived state, given that the cladistic study by TUCKER et al. 1989 of restriction fragment length polymorphisms (RFLPs) of retroviral-related elements in commensal and aboriginal mice places the Y of M. domesticus as ancestral to those of M. musculus and M. castaneus.³ Furthermore, it appears reasonable to assume that this 18-bp deletion occurred only once (see also below). A few other Y chromosomal markers have been identified as varying in concordance with the length state of Zfy-2 (BOISSINOT and BOURSOT 1997 and references therein). Nevertheless, it must be recognized that assessment of the Zfy-2 size class (and of concordant markers) affords little resolving power among Y chromosomes of commensal mice compared to the existing variation demonstrated by TUCKER et al. 1989 . That study of sequences presumably spread over a large part of the Y chromosome revealed extensive interpopulational variation and regional differentiation within M. domesticus and, to a lesser extent, the same phenomena within M. musculus. We do not know whether or not Ys with equally sized Zfy-1 and Zfy-2 genes from outside the well-recognized territory of M. domesticus are about as different from M. domesticus Ys as are Ys bearing the deletion in Zfy-2. Until such mice are included in a study having the multistate discriminating power and phylogenetic potential of the TUCKER et al. 1989 analysis, only limited inferences about Y chromosomal variation can come from two-state assays such as that used here.

Consistent with previous reports (NAGAMINE et al. 1992 , NAGAMINE et al. 1994B ; ORTH et al. 1996 ; BOISSINOT and BOURSOT 1997 ; PRAGER et al. 1997 ), we found (Table 1) the A allele (Zfy-2 same length as Zfy-1) in Egypt, SW Georgia, and Pakistan and the B allele (Zfy-2 shorter) in Daghestan, Korea, and Taiwan. In agreement with well-recognized species distributions and the mtDNA data, the five Siberian males had the B allele. We found only the A allele in Turkey, as expected from domesticus mtDNA and anatomical evidence, and in Yemen and Nepal. In light of the mtDNA trees in Figure 8 and Figure 9, finding only undeleted Zfy-2s in Yemen strengthens the view that equal lengths are the ancestral condition.

In Turkmenistan, we detected only the B allele, along with only musculus mtDNA. Two mice from Iran carried the B allele—at NW locality 18 in an animal with domesticus mtDNA and at SC locality 22 in an animal with castaneus mtDNA (Table 1). These findings extend to other areas of Iran the published reports (NAGAMINE et al. 1992 ; BOISSINOT and BOURSOT 1997 ) of Ys with the B allele along the NE edge of the country (from Mashhad to 400 km south in Birjand) and in Tehran in the NC region. Two other Iranian mice carried the A allele, which appears to be the first detection of this type of Y in Iran. These two animals, collected along the country's western edge (at localities 19 and 21), also had domesticus mtDNA and the anatomical features of this species (Table 2). In Afghanistan, we also found both kinds of Y. Notably, both males among the three Afghan animals with musculus mtDNA had the Y B allele, which, coupled with their appearance (Table 2), supports the idea of M. musculus populations across the country's northern edge.

Sequencing the shorter kind of Zfy-2 from 18 mice from localities extending from N Germany to Korea and Taiwan (see list in MATERIALS AND METHODS) confirmed deletion of the identical 18 bp in all cases, which bolsters the view that this deletion was a singular event. A base substitution was noted in the Iranian mouse from locality 18: a G-to-A change in the first position of codon 507 encodes a threonine in place of alanine.

p53 pseudogenes:
The species and geographic distribution of variation at a locus we designate p53-1 is somewhat like that of the Zfy-2 length states: the p53 is present (P in Table 1) in pure M. domesticus populations and absent (N in Table 1) in pure M. musculus populations, with a more complex pattern of variation and polymorphism in Central and SE Asia (TANOOKA et al. 1995 ; OHTSUKA et al. 1996 ; PRAGER et al. 1997 ; this report). To account for the inter- and intraspecific variation they observed in the genus Mus, OHTSUKA et al. 1996 suggest a single reverse transcription of p53 cDNA, incorporation of this processed gene into the genome of an ancestral mouse, p53 fixation in the ancestral mouse population, and p53 loss along several lineages. The alternative model invokes nonfixation in the ancestral population and maintenance of an old polymorphism through several speciation events. Whichever model is correct for older intrageneric divergences, the presence of p53-1 can be reasonably inferred as the ancestral condition for the commensal clade. This conclusion derives from the branching structure of the mtDNA trees (Figure 8 and Figure 9) and the homozygous p53 presence in a broad survey of European and North African M. domesticus (PRAGER et al. 1997 ; this report) and in the Yemeni mice (Table 1); it receives further support from sequence data (see below) implying that the p53-positive aboriginal species, M. macedonicus and M. spicilegus, which are the sister group to the commensals (Figure 9), also have the p53-1 locus. (We confirmed absence of a p53 in the phylogenetically more remote M. spretus by testing nine mice from Spain and Morocco—see MATERIALS AND METHODS.)

All our mice from Egypt, Turkey, and Yemen had the p53. For the Egyptian and Turkish mice, the results for this autosomal locus add to the evidence from mtDNA, the Y chromosome, and anatomical traits that they are M. domesticus mice. The implication for Yemen is that this area was colonized by founders carrying ancestral traits. The three mice from W Iran were homozygous positive for p53. Two of them, from localities 19 and 21 on the western side of the Zagros Mountains, are M. domesticus by mtDNA, the Y chromosome, and appearance, and they could be representatives from the eastern edge of pure M. domesticus populations. The third one, from locality 18, also has domesticus mtDNA and a M. domesticus phenotype, but carries the Y B allele.

p53 absence in all the mice from Daghestan and Siberia fits with other evidence (FRISMAN et al. 1990 ; ORTH et al. 1996 ; BOISSINOT and BOURSOT 1997 ; Table 1) that these are M. musculus populations. Like TANOOKA et al. 1995 , we did not detect the p53 in animals from Korea and N China, in agreement with mtDNA, Y chromosomal, and phenotypic evidence (YONEKAWA et al. 1988 ; NAGAMINE et al. 1994B ; Table 1 and Table 2) that these are M. musculus mice. The northern Afghan mice (localities 31–33) are M. musculus by mtDNA, the Y chromosome, and anatomical traits, and they uniformly lack the pseudogene at p53-1. They could be representatives at the southern edge of pure M. musculus populations in Central Asia.

The p53 polymorphism we noted in SW Georgia supplements other evidence (e.g., FRISMAN et al. 1990 ; MILISHNIKOV et al. 1990 ; ORTH et al. 1996 ; Table 1) of a contact zone between M. domesticus and M. musculus in Transcaucasia. p53 polymorphism in both S and N Turkmenistan provided our survey's first suggestion of non-M. musculus genes in populations in that country. These results are consistent with Turkmenistan's proximity to the highly polymorphic central populations and with evidence from other studies (e.g., MILISHNIKOV et al. 1994 ) that indicate high diversity in the Central Asian republics of the former Soviet Union. They also raise the possibility of residual polymorphism for P and N at p53-1 in M. musculus. Similar considerations may apply to the mouse with musculus mtDNA and p53 P and N from NC Iranian locality 25 on the Caspian Sea.

Though the majority of animals with castaneus mtDNA carry the p53 (Table 1), we found exceptions at localities 26, 27, 30, and 38 in NE Iran, WC Afghanistan, and SW Pakistan and heterozygosity for P and N at locality 36 in EC Afghanistan. Both our M. castaneus from Taiwan had p53 in the homozygous state, but OHTSUKA et al. 1996 reported polymorphism there. These observations for Central and SE Asia suggest that M. castaneus is polymorphic for P and N at p53-1. Furthermore, while most of the p53-positive males with castaneus mtDNA carry the Y A allele, we observed castaneus mtDNA, p53 P, and the Y B allele at SC Iranian locality 22 and SC Afghan locality 34, as well as in Taiwan.

Figure 10 summarizes the results of sequencing from 79 commensal mice a 128-bp piece of p53-1 that includes the 3' end of exon 4 and the 5' end of exon 5. What makes this region ideal for providing assurance that one is looking at the same locus and the products of the same incorporation event are the deletion of 6 bp plus the insertion of 1 bp relative to the functional gene within a span of 9 bp. We found 12 variable sites and 18 sequence phenotypes, 3 of them widespread and 13 of them each exhibited by only one individual (Figure 10A). To the extent that the positions sequenced overlap, our sequences 1–3 match those reported by OHTSUKA et al. 1996 for two M. domesticus, a M. castaneus, and two M. bactrianus, and they correspond to the common commensal type II of TANOOKA et al. 1995 . The substitution of A at position 137-3 (in our patterns 17 and 18) corresponds to type III seen by TANOOKA et al. 1995 in M. castaneus from Taiwan and Indonesia.

From the 18 sequence phenotypes, we inferred a minimum of 14 alleles (Figure 10B), which differ pairwise by one to six base substitutions. The alleles can be related in almost a star phylogeny (not shown), which requires 16 mutations (consistency index = 0.81) to explain the observed variation. Typical trees have a nine-way multifurcation at the basal node, whose sequence matches allele 1, with subsequent sharing of common lineages by alleles 2 + 3, 8–10, 12 + 13, and 5 + 4 or 6. Allele 1 can be inferred to be the ancestral allele for the commensal pseudogene at p53-1 because at all 12 variable sites in Figure 10, it matches the sequences from all the aboriginal mice examined (see below and MATERIALS AND METHODS for details).

The geography of the commensal p53-1 alleles is revealing (Figure 10, Table 5). In addition to being phylogenetically ancestral, allele 1 is widespread, occurring in every region we looked at, except Taiwan. The mice from Yemen and Turkmenistan are monomorphic for allele 1. In contrast, allele 2 was found only in mice with M. domesticus genomes, except for the Iranian mouse at locality 23. The observed allelic diversity is greater in Turkey, Afghanistan, Pakistan, and Nepal (h = 0.69–0.89; each area has three to five alleles for only 7–16 chromosomes assessed) than in western Europe plus North Africa (h = 0.48). Rare alleles generated in situ in western Europe beyond type 3 in England may not have been uncovered because the sampling was not intense in any one area, but two rare alleles (4 and 7) were detected in M. domesticus territory in Turkey. The overall scenario suggested is an ancestral allele 1, eastward migration(s) by founder populations carrying this allele, and in situ generation of rarer alleles (5, 6, and 8–14) in Central Asian and emigrant populations.

View this table: In this window In a new window   Table 5. p53 diversity among commensal house mice

The aboriginal mice do not share with the commensals the deletion of 6 bp, insertion of 1 bp, and stop at codon 143 (see Figure 10), but our mice plus other representatives of these two species (TANOOKA et al. 1995 ; OHTSUKA et al. 1996 ) share a C-to-T substitution at the first position of codon 139. Among nine mice, we found only two polymorphic sites, both in codon 122, but five sequence phenotypes: at the second and third positions, respectively, of this codon, CG (type 1) in both species, as well as CA, YG, CR, and YR (types 2–5 in the order listed) in M. spicilegus [with CA being the M. spicilegus sequence in TANOOKA et al. 1995 ]. From these observations, we inferred a minimum of three aboriginal alleles: CG, CA, and TG, with respective frequencies of 0.56, 0.33, and 0.11. A strong indication that the p53 common in commensal genomes (i.e., p53-1) is the same locus in the aboriginal mice as a consequence of incorporation before the commensal-aboriginal split comes from the sequences of another piece of the p53, the 89 bp extending from the 3' end of exon 5 through most of exon 6 and bounded by primers Int5S and Int5R. In this second segment, all the house mouse sequences reported by OHTSUKA et al. 1996 , i.e., including M. spicilegus and M. macedonicus, as well as a German and a Georgian mouse (see MATERIALS AND METHODS) with the prevalent category of commensal p53, share three base substitutions relative to the functional gene: C to A at 193-1 (codon 193, position 1), C to G at 200-1, and G to A at 201-3. The juxtaposed length changes of -6 bp and +1 bp would then be assigned to the common lineage preceding intracommensal divergence and considered diagnostic of commensal p53-1.

The mice from localities 31 in Afghanistan and 48 in Nepal provided evidence for a second processed p53 locus (cf. Table 1 and MATERIALS AND METHODS). With primers Exon 4 + Exon 5, both mice yielded p53 fragments matching the coding portion of the functional gene in length and sequence, and sequence data for the segment amplified by primers Int5S + Int5R supported the hypothesis of a locus distinct from p53-1 (details available from the authors). The demonstration of a variant p53 locus in the northern Afghan mouse fits nicely with its otherwise M. musculus-like genotype and phenotype. We infer that these two unusual mice are each probably exemplars of two new and independent retrotranspositions of the p53 mRNA because it is not apparent how the same new p53 would be shared exclusively (in our survey) by two mice whose genotypes and phenotypes are otherwise quite different and that are from localities some 2200 km apart in an area dominated by inhospitable mountainous terrain. The rat Rattus norvegicus has multiple p53 loci (WEGHORST et al. 1995 ), and our findings provide additional impetus for characterizing the p53 insertion points in the genomes of house mice. The Nepalese mouse from locality 48 is intriguing, not only in having two p53 loci, but also in having a M. castaneus phenotype (Table 2), an mtDNA (cas 13) rather distantly linked to all others, and a p53-1 allele (type 13) with two base changes uniquely shared with M. castaneus from Taiwan.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Commensal house mice of Yemen:
The implication from the evolutionary trees in Figure 8 and Figure 9 and the pairwise comparisons in Table 3 is that the mtDNAs of the Yemeni mice are phylogenetically distinct from the other categories of commensal mtDNAs heretofore recognized. Furthermore, the mtDNAs extant in Yemen appear to have been diverging from one another for an appreciable amount of time, approaching the time characterizing the mtDNA divergence of M. musculus over its entire range (Figure 5). At the level of resolution used in this survey, the Yemeni mice have the ancestral states for all three traits at the two nuclear loci examined—the Y chromosome A allele, presence of p53-1, and allele 1 at p53-1. The distinct monophyletic clade of their mtDNAs suggests that these Arabian Peninsular animals may represent another recognizable species in the commensal mouse complex. As they have already been given a separate taxonomic designation because of their small size (see RESULTS), we will use the name M. gentilulus henceforth in this article to refer to them.

The results reported here suggest that more attention be given to the genetics and morphology of M. gentilulus than has been done by earlier systematists. As its nuclear gene traits revealed by the present study plus some of its anatomical features are characteristic of mice from diverse areas, additional nuclear loci should be assessed. To investigate further the origin and dispersal of the Yemeni mice, it becomes desirable to sample for genetic analyses from diverse parts of the Arabian Peninsula, all along the northern shores of the Persian Gulf and the Gulf of Oman, and also the Horn of Africa and adjacent areas. Indeed, discovery of the gentilulus mtDNAs provides a strong stimulus for a molecular genetic analysis of house mice from throughout Africa. It has been presumed that, except for North Africa, the continent became populated by commensal house mice because of spreading by humans during recent millennia. Furthermore, it now seems generally believed that these African mice are all M. domesticus (e.g., see KLEIN et al. 1987 ; BOURSOT et al. 1993 ; K.S.J. 1995; DIN et al. 1996 ). SCHWARZ and SCHWARZ 1943 , however, placed M. (m.) castaneus on the coast of East Africa and throughout southern Africa while designating the mice in Somalia as M. (m.) bactrianus and those on the Eritrean coast (on the Red Sea) and in northern Sudan as M. (m.) praetextus.

Origin and radiation of commensal house mice:
The centrifugal model of evolution proposed by BOURSOT et al. 1993 , BOURSOT et al. 1996 , BONHOMME et al. 1994 , and DIN et al. 1996 hypothesizes the northern Indian subcontinent as the cradle of the commensal clade as a whole, and from there, range expansions westward, northward, and eastward to give rise, respectively, to the peripheral populations that are now called M. domesticus, M. musculus, and M. castaneus (designated by them as subspecies of M. musculus). They refer to the central populations as M. m. subspp. and identify them geographically as Delhi, Pak, and Iran, as their genetic affinities were not clarified. After an initial westward movement of mice along the Arabian Sea and eastern Persian Gulf, the area west of the Zagros Mountains is suggested as a good candidate for the original homeland of M. domesticus, from where mice subsequently spread westward to colonize the present-day range of the taxon around the Mediterranean and in NW Europe. The progenitors of M. musculus are hypothesized [see Figure 4 in BOURSOT et al. 1996 ] to have moved northward between the Kopet Dagh Mountains and the Paropamisus Range (approximately at the corner of NE Iran and NW Afghanistan), with the original homeland of this taxon then suggested as being in Transcaucasia or east of the Caspian Sea. From there, mice subsequently spread further northward and to the east and west to colonize the enormous expanse of N and E Eurasia currently inhabited by this species. A population isolated for only a short time is suggested as having given rise to M. castaneus in SE Asia and S India. The M. gentilulus lineage implicated by the present mtDNA data makes the centrifugal model somewhat more complicated in that it would need to include a fourth movement out of the postulated N Indo-Pakistan cradle area. This model is based chiefly on the following: (1) Among the commensals, the central populations (included under the name M. castaneus by us) have the highest nuclear gene variability, as assessed by electrophoresis of proteins and RFLP of Vß genes, and the deepest clades of mtDNA lineages. (2) There is a 2-million-year-old Mus fossil of the house mouse group in N India. This hypothesized centrifugal model is already becoming accepted in the literature (KSJ 1995).

In their description of the Indian fossil, PATNAIK et al. 1996 state that their specimen has several diagnostic traits that are absent in any of the living species of the subgenus Mus. Thus, this mouse cannot be the immediate ancestor of the commensal mice because there are at least eight living species in this subgenus that are ancestral to the commensals and to which this fossil mouse is also ancestral. The collective range of these eight species stretches from China to North Africa and W Europe, and, thus, other places might well be where the commensal mice began their evolution. Indeed, the fossils of the most immediate ancestors of the commensal mice are in Europe and North Africa (JAEGER 1975 ; JANOSSY 1975 ; AUFFRAY and BRITTON-DAVIDIAN 1992 ).

The other support for the centrifugal model comes from the variability and degree of divergence of nuclear autosomal loci (chiefly allozymes) and mtDNA sequences. Our present study also supports the claim that the greatest divergence within a monophyletic clade of mtDNA molecules exists among the M. castaneus mice. But other clades of mtDNA molecules appear to be older than those in the castaneus lineage, which implies that they evolved before those in the present-day M. castaneus. The mtDNA lineages leading to the domesticus and gentilulus clades are apparently ancestral to the lineage giving rise to the castaneus clade (Figure 8 and Figure 9). Allozyme heterozygosity is not, per se, a demonstration of the ancestral condition. Under the neutral model of molecular evolution, high heterozygosity is the result of both population size and persistence time (KIMURA 1983 ). Thus, the high levels of variability in the Indo-Pakistan mice may imply only that there have been large numbers of mice in that area for a long time. They could have been living there for an absolutely longer time than anywhere else and be ancestral, but that historical inference is not proven from levels of variability per se. Indeed, the three aboriginal species of house mice that are the immediate ancestors of the commensal mice have low levels of allozyme variability (SAGE et al. 1993 ).

What are the strongest kinds of evidence that can support a biogeographic model? Fossils and molecular data with a phylogenetic signal are good information for reconstructing this type of historical record. A continuous fossil record in one stratigraphic column showing the transitional morphological types from the ancestral to the modern condition would be the strongest possible proof for the place of origin of a living species. Unfortunately, such series do not exist for the house mouse. The best series are Late Pleistocene Mus fossils in the Near East (TCHERNOV 1984 ; AUFFRAY et al. 1990B , AUFFRAY et al. 1990C ), but because the commensal mice began to evolve and differentiate in the Early and Middle Pleistocene, these Palestinian fossils are not very suggestive of their place of origin. TCHERNOV 1986 observed that house mouse fossils tended to be uncommon in strata where other rodents are found, which suggests that we are unlikely ever to find the complete series of transitional fossils leading to the commensal mice.

The most powerful kind of molecular information has a clear phylogenetic signal in it, which means that the ancestral/descendant polarity of the variation is apparent. Using such molecular data to infer geographical histories is frequently done (reviewed in FELSENSTEIN 1982 ; AVISE 1994 ). Perhaps the best known example of such phylogeographical analysis is the model of the African origin of modern humans (CANN et al. 1987 ), which was proposed primarily because the most ancestral mtDNA lineages these investigators found existed in living African peoples. The use of gene frequencies and matrices of genetic distances derived from them for making phylogeographic inferences has several weaknesses involving the methods of data analysis, the sample sizes, the nature of the information (which is essentially phenetic), and, most importantly, the underlying population genetic events leading to the gene differences observed and the distances computed (e.g., see FELSENSTEIN 1982 ; DAVIS and NIXON 1992 ; CORNUET and LUIKART 1996 ; DIN et al. 1996 ; references therein).

Despite their shortcomings with respect to statistical support [which likewise beset previous studies (BOURSOT et al. 1996 ; BOISSINOT and BOURSOT 1997 )], our trees in Figure 8 and Figure 9 along with Table 3 stimulated us to develop another model for the origin and radiation of commensal house mice for consideration as an alternative hypothesis to the centrifugal model. We used the phylogeographic approach and assumptions of AVISE 1994 to infer the sequence and direction of spread of the mice themselves from the geographic patterning of the mtDNA genes. These assumptions are the following: (1) mitochondrial-gene trees are likely to represent the species tree; (2) in a broad sense, genes originated in the place where the present-day carriers of particular gene lineages live; and (3) spreading of mice carrying the genes of different lineages, rather than gene flow into already established populations, is responsible for the geographic patterning of variation.

The sequential or linear model that we propose postulates a western origin within the range of present-day M. domesticus followed by an easterly, arcing spread of new mouse populations to give rise to the progenitors of the other species. We constructed this scenario for the origin and historical route of spreading of commensal mice in Eurasia from the assumption of the relative ages of the mouse lineages inferred from the relative ages implied by the mtDNA trees in Figure 8 and Figure 9. Though they lack the Yemeni mtDNA lineage, the midpoint-folded trees of BOURSOT et al. 1996 and outgroup-rooted tree of BOISSINOT and BOURSOT 1997 agree with our trees in having domesticus mtDNAs as the sister group to the other commensal mtDNAs. [ BOURSOT et al. 1996 suggested placing the root within the castaneus lineages, based on SHE et al. 1990 , but both of these reports emphasized the uncertainty in root assignment.] Their trees share with ours consistent support for the monophyly of the musculus and of the domesticus mtDNAs, lack of such support for monophyly of the castaneus mtDNAs, and uncertainty in the branching order of the major commensal mtDNA lineages and placement of the root. We do not claim that our trees resolve these questions with more significant support than do those published earlier. Rather, we have used a phylogenetic tree as the foundation for an alternative hypothesis instead of using mainly nontree criteria as was done in the development of the centrifugal model (see above). The Yemeni mtDNA lineage increases the plausibility of considering a tree-based hypothesis.

Our sequential model begins with pre-M. domesticus mice arising in WC Asia, within the current range of the mice identified as M. domesticus (including subspecies domesticus, brevirostris, and praetextus). Because these mice live so well and are presently most abundant in oases or wet places in arid lands, the ancestral populations may have lived in the Tigris-Euphrates River Valley (i.e., in Mesopotamia). Paleobiological studies suggest that this area has maintained its arid steppe and riverine environments throughout the Pleistocene (FRENZEL et al. 1992 ; VRBA et al. 1995 ). The Tigris-Euphrates River Valley could have served as a continuous home to this mouse species. But, given that the deepest lineages in the mtDNA tree in Figure 7 are from around the Mediterranean and we have examined few samples from the Mesopotamian region, we do not rule out, for example, the Nile River Valley as the possible pre-M. domesticus homeland. We postulate that the ancestors of M. gentilulus, the group that now lives in the southern Arabian Peninsula and has the next-oldest category of mtDNA, moved south from Mesopotamia at a time when desert conditions were not as extreme as they are now. At various times during the Pleistocene, the entire Arabian Peninsula was wetter and more hospitable than it is today (RIPLEY 1954 ; GASPERETTI 1988 ).

Our proposed model continues with mice from southern Arabia moving eastward and northward to establish the M. castaneus-M. musculus ancestor. The most direct path for the dispersal of M. gentilulus mice to the Indian subcontinent would be to have crossed the area where the Strait of Hormuz is presently located (joining the Persian Gulf and the Gulf of Oman). Mice might have rafted across this narrow water barrier (now only 70 km wide) or perhaps had a land route available as a result of sea level lowering, which led to emptying of the Persian Gulf such that the two regions were separated only by the freshwater flow of the Tigris and Euphrates Rivers (KASSLER 1973 ). House mice currently do well in both salt- and freshwater marshlands in California and the Near East (SAGE 1981 ), so rafting dispersal across a flooding Tigris-Euphrates River may have been a frequent event. An all-land route, with the spread of mouse populations north and then east around the present-day Persian Gulf, seems less likely for two reasons. First, it would have required that M. domesticus be displaced from and then return back into the southern Mesopotamian valley region. Also, this route is much longer and requires population expansion through the southern part of the Zagros Mountains, where forests would not be a preferred habitat of feral commensal mice. [The progenitors of the M. castaneus-M. musculus stock could also have reached the Indian subcontinental region if two groups at the periphery of the area of origin moved in different directions, one southward and southwestward (to give rise to M. gentilulus) and the other eastward (by the all-land route described above) or southward and then eastward across the Strait of Hormuz area. We recognize that this option implies a centrifugal model rather than a linear one.]

In the last aspect of this reconstruction, which is the history of separation of the ancestral M. castaneus-M. musculus stock into the two modern species, our proposed scenario is the same as or similar to parts of the centrifugal model. We propose that this ancestral stock spread and occupied the entire Indo-Pakistan area south of three transverse mountain massifs (the Kopet Dagh, the series of ranges from the Paropamisus to the Hindu Kush, and the Himalayas) that separate the SC and NC Asian lowlands. They became the ancestors of this region's present-day M. castaneus mice and probably occupied this large area for a comparatively long period of the Pleistocene because there were always large areas of this southland warm enough to support mouse populations. Soon after these ancestral mice occupied the area, a population moved through the mountains into the steppe regions on the north side. This passage, which probably occurred during an interglacial period, may well have been by their dispersing through the Hari River Valley in NW Afghanistan bordering NE Iran. This river system runs between the Kopet Dagh and Paropamisus Mountains. Somewhat to the east, the Amu Darya River system drains the northern slopes of the Hindu Kush mountains of Afghanistan, where present-day mice have musculus mtDNAs. A different crossing point from SC to NC Asia could be envisioned somewhat to the west, between the Elburz and Kopet Dagh Mountains and along the SE coast of the Caspian Sea. From this NC location, the mice bearing musculus mtDNAs ultimately spread west to central Europe and east to China and Japan.

We propose that the Indo-Pakistan stock then evolved the modern castaneus types of mtDNA, as well as a number of distinctive morphological types in this region of much geographic variability. These include the distinctive form called homourus in the highlands in and adjacent to Nepal and the form called castaneus in the humid lowlands of SE Asia. Most recently, populations spread into SE Asia, carrying a limited diversity of these mtDNA molecules.

The model we propose implies that generation of the deleted states of the Y chromosome (Zfy-2 shorter by 18 bp) and p53-1 (absence of the locus) occurred after the ancestral stock arrived in the southern Indo-Pakistan area, so that both loci became polymorphic for the two conditions. Generation of new mutations and persistence of polymorphisms are likelier in the larger populations presumed to have occupied this region. Maintenance of polymorphisms plus sorting and filtering of ancestral lineages (as outlined in RESULTS for the castaneus mtDNA lineage found in SE Asia) may explain the geographic pattern of variation observed today. Evidence of such ancestral polymorphism is apparent in Iran, Afghanistan, and Pakistan, notably including castaneus mtDNA and the Y B allele in mice from SC Afghan locality 34 and SC Iranian locality 22 (Table 1) and in several individuals from NC and NE Iran studied by BOISSINOT and BOURSOT 1997 . This same mtDNA and Y combination is found also in extreme SE Asia. Our model does not require secondary sweeps, as proposed by BOISSINOT and BOURSOT 1997 to explain the observed distribution of Ys with the A and B alleles. (The possible residual polymorphism for P and N at p53-1 in mice that otherwise appear to be M. musculus at Turkmen locality 29 near the Tedzhen River, which is the northern end of the Hari River, would be consistent with proximity to the initial crossing point from SC to NC Asia.)

That the geographic ranges of the species that are the closest living relatives of the commensal mice are in SW Eurasia provides additional support in favor of a western origin as opposed to an Indo-Pakistan cradle. M. macedonicus and M. spicilegus occur, respectively, from Macedonia to W Iran and in steppe habitats from SE Austria to the Black Sea. M. spretus ranges around the western end of the Mediterranean Sea. The present-day range of M. domesticus thus overlaps completely with those of M. macedonicus and M. spretus, which might suggest that M. domesticus also arose in this western area rather than far away from its closest relatives. The centrifugal model requires assuming that the species ancestral to the aboriginal house mouse species lived in the Indo-Pakistan region long enough to have produced another lineage that would become the precommensal lineage and that the whole aboriginal stock then went extinct throughout the entire Indo-Pakistan area, surviving only in the Near Eastern and central European steppelands. Only more distant relatives of the commensal mice (e.g., M. terricolor and M. booduga) have ranges close to the lands considered ancestral to the commensals in the centrifugal model.

The two models make different and testable predictions about the relative branching order of gene trees made from commensal mouse DNA sequences and about the geographic location of the oldest fossil remains of these mice. The oldest fossil bones that are morphologically assignable to commensal mice should be found in W Eurasia under the linear model. Under the centrifugal model, these fossils are expected to be found in the Indo-Pakistan area. When DNA sequences with adequate amounts of phylogenetic information are available, the linear model predicts that the M. domesticus sequences will be ancestral to those from M. castaneus mice, while the centrifugal model predicts the opposite branching order. To date, cladistic analyses of mtDNAs (BOISSINOT and BOURSOT 1997 ; this report), Y chromosome DNA (TUCKER et al. 1989 ), and Y chromosomal Sry genes [E. M. PRAGER, unpublished results based on the GenBank sequences of ALBRECHT and EICHER 1997 ] favor the branching order predicted by the linear model. (However, the cited Y chromosome studies examined M. castaneus only from one SE Asian locality.)

p53 pseudogene polymorphisms:
Findings reported here indicate a need to consider three kinds of polymorphism for processed p53 pseudogenes in the house mouse genome: presence vs. absence at a given locus, number of alleles at one locus, and number of p53 loci. In a survey of one or two individuals per species, OHTSUKA et al. 1996 found that outside the house mouse complex, p53 is absent in M. caroli, present in M. booduga (M. leggada in their nomenclature), and absent in M. platythrix (which is in another subgenus). Their phylogenetic analyses make it reasonable to assume that the M. booduga p53 lies at the same place, on chromosome 17, as mapped for laboratory strains of M. domesticus (i.e., at p53-1). As outlined in RESULTS, OHTSUKA et al. 1996 favored only losses rather than maintenance of an ancient trans-species polymorphism to explain absence of a p53 in several mouse lineages. Among the commensals and in light of the linear biogeographic model of origin and radiation, we postulated one loss and then maintenance of the presence/absence polymorphism in M. castaneus and lineage sorting or filtering to give only absence (or a low level of polymorphism) in M. musculus. However, we cannot rule out multiple independent losses, particularly among the large and collectively diverse M. castaneus populations. Furthermore, genomes of different taxa may differ with respect to ease of loss of p53-1.

Our demonstration of at least 14 alleles at one nuclear locus seems indicative of an unusually high level of variability. However, because much of this p53-1 variability is geographically partitioned among different taxa and collectively encompasses an enormous territory, this number of alleles inferred at a locus presumably free of functional constraints may not be surprisingly large. The rarer p53-1 alleles may serve as useful markers for the timing and routes of spreading of diverse populations, and they may also provide insight into rates of evolution at this locus. Our evidence for a second and likely a third p53 locus in house mice suggests that p53 pseudogene generation and integration may be facile. It invites mapping of the new locus (or loci) and investigation into the presumably viral mediators of the requisite reverse transcription and their geographic and phylogenetic distribution among house mice. Multiple loci and possibly repeated losses at a given locus among commensal mice dictate caution in using scoring for the presence/absence of a p53.

Future directions:
A correct understanding of the evolutionary history of commensal house mice is needed because these are the animals that gave rise, via interspecific hybridization by early mouse breeders, to the highly variable inbred strains of laboratory mice that are central to much research on genetic interactions during mammalian development (SAGE et al. 1993 ). As the role of gene-gene interactions in development and physiology becomes better understood in mice, researchers need to be alert as to whether the interactions are the result of intra- or interspecific combinations of alleles at the interacting loci.

Our contribution of a new model of commensal mouse origins makes it appropriate to do future comparative molecular surveys in a way that will test the phylogenetic relationships of alleles as predicted by the contrasting models. They should be done using cladistic methods and should use a minimum of four mouse stocks, including at least one aboriginal species as a close outgroup sample and at least one authentic M. domesticus, M. castaneus, and M. musculus (all of which are commercially available, as are their DNAs). The recent availability of some 30 inbred strains from India (K.S.J. 1995) facilitates including members from the center of the highly diverse M. castaneus phylogeographic unit. Bringing M. gentilulus into laboratory culture for molecular genetic and other studies emerges as a goal from our present investigation.

The work described here provides a stimulus for further work in at least four different arenas. First, additional mouse populations need to be sampled for mtDNA and other genetic analyses, with priority areas being Iraq, the Arabian Peninsula, East Africa, Iran, and along the southern slopes of the Himalayas to Burma. Notably, Iraqi mice need to be surveyed to test the supposition that they have domesticus mtDNAs. Second, longer mtDNA sequences, maybe even whole genomes, should be obtained from representatives of all the major commensal mtDNA lineages now identified (preferably including two deep lineages from those in Figure 6) and from the aboriginal species to try to determine definitively the branching order and root position in Figure 8. Third, the generation and maintenance of p53 pseudogene diversity require elucidation. Cloning and sequencing of PCR products in cases of sequence phenotypes polymorphic at two or more positions are needed to determine allele sequences directly. Sequencing longer stretches of p53-1, and from more than the 79 commensal mice we surveyed, may yield a better estimate of the actual diversity and permit relating the alleles phylogenetically with greater resolution. Finally, because many future surveys will probably have to depend at least in part on museum skins as the source of genetic information, development of DNA markers for a variety of additional nuclear loci merits attention. Microsatellite loci in general should be accessible via museum skins, as pieces of 100–250 bp are frequently amplified. Diagnostic loci well known from protein electrophoresis may also become assessable at the DNA level.

	FOOTNOTES

¹ Present address: Department of Biology, San Francisco State University, San Francisco, CA 94132-1722.
² Present address: Department of Biological Sciences, University of California, Santa Barbara, CA 93106.
³ The 18-bp deletion has been reported as absent in M. spretus and in the more distantly related non-house mouse M. caroli (NAGAMINE et al. 1994A ), but no survey of M. spretus and the other two aboriginal house mouse species appears to have been done. The apparent variation in the number of Zfy genes among mouse species outside the commensal group (NAGAMINE et al. 1994A ) would complicate such a survey and its interpretation.

	ACKNOWLEDGMENTS

The late A. C. Wilson provided essential ideas for this survey, notably including Yemen along with the central areas from Afghanistan to Turkey and using museum skins to retrieve mtDNA sequences. We deeply appreciate the efforts of all the mouse collectors, and are especially grateful to L. Heaney, B. D. Patterson, J. D. Phelps, and W. T. Stanley of the Field Museum of Natural History for cutting and sending skin samples, providing information about localities and anatomical measurements, and sending specimens of whole animals on loan and extending hospitality to J. T. Marshall. We are particularly thankful to J. T. Marshall for anatomical assessments of the museum specimens we studied molecularly, communication of unpublished results based on anatomical assessments of many hundreds of other museum specimens, and valuable discussions. We thank P. K. Tucker and J. Arnold for transmitting frozen tissues; C. Cicero, J. L. Patton, and B. R. Stein for providing access to specimens housed at the MVZ at U.C. Berkeley; P. Boursot for communicating an earlier, unpublished version of BOISSINOT and BOURSOT 1997 , in which mtDNA variation was assessed by restriction analysis; and P. Boursot, A. E. Leviton, S. J. Mack, T. J. Papenfuss, J. L. Patton, T. W. Quinn, A. Sidow, M. Slatkin, W. K. Thomas, G. Thomson, and D. L. Yowe for helpful discussion. E.M.P. thanks K. Le, W. K. Thomas, D. B. Wake, and the MVZ for reagents and supplies, as well as the laboratory of B. N. Ames for use of the Perkin Elmer 480 thermal cycler. This work received support from National Science Foundation grants BSR88-18053 and DEB90-08912 to A.C.W. and (for preparation of genomic DNAs) National Institutes of Health grant R01 AI29800 to R.D.S.

Manuscript received October 20, 1997; Accepted for publication July 7, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALBRECHT, K. H. and E. M. EICHER, 1997  DNA sequence analysis of Sry alleles (subgenus Mus) implicates misregulation as the cause of C57BL/6J-Y^POS sex reversal and defines the SRY functional unit. Genetics 147:1267-1277[Abstract].

AUFFRAY, J.-C. and J. BRITTON-DAVIDIAN, 1992  When did the house mouse colonize Europe? Biol. J. Linn. Soc. 45:187-190.

AUFFRAY, J.-C., J. T. MARSHALL, L. THALER, and F. BONHOMME, 1990a  Focus on the nomenclature of European species of Mus. Mouse Genome 88:7-8.

AUFFRAY, J.-C., E. TCHERNOV, F. BONHOMME, G. HETH, and S. SIMSON et al., 1990b  Presence and ecological distribution of Mus "spretoides" and Mus musculus domesticus in Israel. Circum-Mediterranean vicariance in the genus Mus. Z. Säugetierkd. 55:1-10.

AUFFRAY, J.-C., F. VANLERBERGHE, and J. BRITTON-DAVIDIAN, 1990c  The house mouse progression in Eurasia: a paleontological and archaeozoological approach. Biol. J. Linn. Soc. 41:13-25.

AVISE, J. C., 1994 Molecular Markers, Natural History and Evolution. Chapman & Hall, New York.

BOISSINOT, S. and P. BOURSOT, 1997  Discordant phylogeographic patterns between the Y chromosome and mitochondrial DNA in the house mouse: selection on the Y chromosome? Genetics 146:1019-1034[Abstract].

BONHOMME, F., R. ANAND, D. DARVICHE, W. DIN and P. BOURSOT, 1994 The house mouse as a ring species?, pp. 13–23 in Genetics in Wild Mice, edited by K. MORIWAKI, T. SHIROISHI and H. YONEKAWA. Japan Sci. Soc. Press, Tokyo/S. Karger, Basel, Switzerland.

BOURSOT, P., J.-C. AUFFRAY, J. BRITTON-DAVIDIAN, and F. BONHOMME, 1993  The evolution of house mice. Annu. Rev. Ecol. Syst. 24:119-152.

BOURSOT, P., W. DIN, R. ANAND, D. DARVICHE, and B. DOD et al., 1996  Origin and radiation of the house mouse: mitochondrial DNA phylogeny. J. Evol. Biol. 9:391-415.

CANN, R. L., M. STONEKING, and A. C. WILSON, 1987  Mitochondrial DNA and human evolution. Nature 325:31-36.

CORNUET, J. M. and G. LUIKART, 1996  Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144:2001-2014[Abstract].

DAVIS, J. I. and K. C. NIXON, 1992  Populations, genetic variation, and the delimitation of phylogenetic species. Syst. Biol. 41:421-435.

DIN, W., R. ANAND, P. BOURSOT, D. DARVICHE, and B. DOD et al., 1996  Origin and radiation of the house mouse: clues from nuclear genes. J. Evol. Biol. 9:519-539.

FELSENSTEIN, J., 1982  How can we infer geography and history from gene frequencies? J. Theor. Biol. 96:9-20[Medline].

FERRIS, S. D., R. D. SAGE, E. M. PRAGER, U. RITTE, and A. C. WILSON, 1983  Mitochondrial DNA evolution in mice. Genetics 105:681-721[Abstract/Free Full Text].

FRENZEL, B., M. PÉCSI and A. A. VELICHKO (Editors), 1992 Atlas of Paleoclimates and Paleoenvironments of the Northern Hemisphere. Hungarian Academy of Sciences, Bern, Switzerland.

FRISMAN, L. V., K. V. KOROBITSINA, L. V. YAKIMENKO, F. M. BOKSHTEIN, and A. I. MUNTYANU, 1990  Genetic differentiation of U.S.S.R. house mice: electrophoretic study of proteins. Biol. J. Linn. Soc. 41:65-72.

GASPERETTI, J., 1988 Snakes of Arabia, pp. 169–392 in Fauna of Saudi Arabia, Vol. 9, edited by W. BÜTTIKER and F. KRUPP. National Commission for Wildlife Conservation and Development, Riyadh, Saudi Arabia, and Pro Entomologia c/o Natural History Museum, Basel, Switzerland.

GRUBER, U. F., 1969  Tiergeographische, ökologische und bionomische Untersuchungen an kleinen Säugetieren in Ost-Nepal. Khumbu Himal, Ergebn. Forsch.-Unternehmen Nepal Himalaya 3:197-312.

HARRISON, D. L., 1972 The Mammals of Arabia, Vol. III. Ernest Benn Ltd., London.

HARRISON, D. L., and P. J. J. BATES, 1991 The Mammals of Arabia, Ed. 2. Harrison Zoological Museum, Sevenoaks, Kent, UK.

JAEGER, J.-J., 1975 The mammalian faunas and hominid fossils of the Middle Pleistocene of the Maghreb, pp. 399–418 in After the Australopithecines, edited by K. W. BUTZER and G. LL. ISAAC. Mouton Publishers, The Hague.

JÁNOSSY, D., 1975 Mid-Pleistocene microfaunas of continental Europe and adjoining areas, pp. 375–397 in After the Australopithecines, edited by K. W. BUTZER and G. LL. ISAAC. Mouton Publishers, The Hague.

KASSLER, P., 1973 The structural and geomorphic evolution of the Persian Gulf, pp. 11–32 in The Persian Gulf, edited by B. H. PURSER. Springer-Verlag, New York.

KIMURA, M., 1983 The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge, UK.

KLEIN, J., H. TICHY, and F. FIGUEROA, 1987  On the origin of mice. Ann. Univ. Chile 5(14):91-120.

K. S. J., 1995 How the mouse's tale began life in India. Nature 377: 188.

LESSA, E. P., M. F. SMITH, and C. ORREGO, 1992  A cool hot start for PCR amplifications. Ancient DNA Newslett. 1(1):40-42.

MARSHALL, J. T., 1981 Taxonomy, pp. 17–26 in The Mouse in Biomedical Research, Vol. 1, edited by H. L. FOSTER, J. D. SMALL and J. G. FOX. Academic Press, New York.

MARSHALL, J. T., 1986  Systematics of the genus Mus. Curr. Top. Microbiol. Immunol. 127:12-18[Medline].

MARSHALL, J. T. and R. D. SAGE, 1981  Taxonomy of the house mouse. Symp. Zool. Soc. Lond. 47:15-25.

MILISHNIKOV, A. N., A. N. RAFIEV, L. A. LAVRENCHENKO, and V. N. ORLOV, 1990  A high level of introgression of the genes of Mus domesticus in a Mus musculus s. str. population of Transcaucasia. Doklady Akademii Nauk SSSR 311:764-768[Medline].

MILISHNIKOV, A. N., A. N. RAFIEV, and V. N. ORLOV, 1994  Genetic variation in populations of the house mouse Mus musculus L. 1758 s. stricto from western, central, and southeastern parts of the species range. Genetika 30:906-912[Medline].

MORIWAKI, K., T. SHIROISHI and H. YONEKAWA (Editors), 1994 Genetics in Wild Mice. Its Application to Biomedical Research. Japan Sci. Soc. Press, Tokyo/S. Karger, Basel, Switzerland.

NACHMAN, M. W., S. N. BOYER, J. B. SEARLE, and C. F. AQUADRO, 1994  Mitochondrial DNA variation and the evolution of Robertsonian chromosomal races of house mice, Mus domesticus. Genetics 136:1105-1120[Abstract].

NAGAMINE, C. M., Y. NISHIOKA, K. MORIWAKI, P. BOURSOT, and F. BONHOMME et al., 1992  The musculus-type Y chromosome of the laboratory mouse is of Asian origin. Mamm. Genome 3:84-91[Medline].

NAGAMINE, C. M., P. BOURSOT, Y.-F. C. LAU and K. MORIWAKI, 1994a Evolution of the Y-chromosome in the wild mouse, pp. 41–55 in Genetics in Wild Mice, edited by K. MORIWAKI, T. SHIROISHI and H. YONEKAWA. Japan Sci. Soc. Press, Tokyo/S. Karger, Basel, Switzerland.

NAGAMINE, C. M., T. SHIROISHI, N. MIYASHITA, K. TSUCHIYA, and H. IKEDA et al., 1994b  Distribution of the molossinus allele of Sry, the testis-determining gene, in wild mice. Mol. Biol. Evol. 11:864-874[Abstract].

OHTSUKA, H., M. OYANAGI, Y. MAFUNE, N. MIYASHITA, and T. SHIROISHI et al., 1996  The presence/absence polymorphism and evolution of the p53 pseudogene in the genus Mus. Mol. Phylo. Evol. 5:548-556[Medline].

ORTH, A., E. LYAPUNOVA, A. KANDAUROV, S. BOISSINOT, and P. BOURSOT et al., 1996  L'espèce polytypique Mus musculus en Transcaucasie. C. R. Acad. Sci. Paris, Sci. Vie/Life Sci. 319:435-441.

PATNAIK, R., J.-C. AUFFRAY, J.-J. JAEGER, and A. SAHNI, 1996  House mouse ancestor from late Pliocene Siwalik sediments of India. C. R. Acad. Sci. Paris, Sci. Vie/Life Sci. 319:431-434.

PRAGER, E. M., R. D. SAGE, U. GYLLENSTEN, W. K. THOMAS, and R. HÜBNER et al., 1993  Mitochondrial DNA sequence diversity and the colonization of Scandinavia by house mice from East Holstein. Biol. J. Linn. Soc. 50:85-122.

PRAGER, E. M., H. TICHY, and R. D. SAGE, 1996  Mitochondrial DNA sequence variation in the eastern house mouse, Mus musculus: comparison with other house mice and report of a 75-bp tandem repeat. Genetics 143:427-446[Abstract].

PRAGER, E. M., P. BOURSOT, and R. D. SAGE, 1997  New assays for Y chromosome and p53 pseudogene clines among East Holstein house mice. Mamm. Genome 8:279-281[Medline].

RIPLEY, S. D., 1954  Comments on the biogeography of Arabia with particular reference to birds. J. Bombay Nat. Hist. Soc. 52:241-248.

SAGE, R. D., 1981 Wild mice, pp. 39–90 in The Mouse in Biomedical Research, Vol. 1, edited by H. L. FOSTER, J. D. SMALL and J. G. FOX. Academic Press, New York.

SAGE, R. D. and J. O. WOLFF, 1986  Pleistocene glaciations, fluctuating ranges, and low genetic variability in a large mammal (Ovis dalli). Evolution 40:1092-1095.

SAGE, R. D., J. B. WHITNEY, III, and A. C. WILSON, 1986  Genetic analysis of a hybrid zone between domesticus and musculus mice (Mus musculus complex): hemoglobin polymorphisms. Curr. Top. Microbiol. Immunol. 127:75-85[Medline].

SAGE, R. D., W. R. ATCHLEY, and E. CAPANNA, 1993  House mice as models in systematic biology. Syst. Biol. 42:523-561.

SCHWARZ, E. and H. K. SCHWARZ, 1943  The wild and commensal stocks of the house mouse, Mus musculus Linnaeus. J. Mammal. 24:59-72.

SHE, J. X., F. BONHOMME, P. BOURSOT, L. THALER, and F. CATZEFLIS, 1990  Molecular phylogenies in the genus Mus: comparative analysis of electrophoretic, scnDNA hybridization, and mtDNA RFLP data. Biol. J. Linn. Soc. 41:83-103.

TANOOKA, H., A. OOTSUYAMA, T. SHIROISHI, and K. MORIWAKI, 1995  Distribution of the p53 pseudogene among mouse species and subspecies. Mamm. Genome 6:360-362[Medline].

TCHERNOV, E., 1984 Commensal animals and human sedentism in the Middle East, pp. 91–115 in Animals and Archaeology: 3. Early Herders and Their Flocks, edited by J. CLUTTON-BROCK and C. GRIGSON. Brit. Arch. Rep. Int. Ser. 202, Oxford, UK.

TCHERNOV, E., 1986 The rodents and lagomorphs from `Ubeidiya Formation: systematics, paleoecology and biogeography, pp. 235–350 in Les Mammifères du Pléistocène Inférieur de la Vallée du Jourdain à Oubeidiyeh. Mémoires et Travaux du Centre de Recherche Français de Jerusalem, No. 5, edited by E. TCHERNOV. Association Paléorient, Paris, France.

TUCKER, P. K., B. K. LEE, and E. M. EICHER, 1989  Y chromosome evolution in the subgenus Mus (genus Mus). Genetics 122:169-179[Abstract/Free Full Text].

VRBA, E. S., G. H. DENTON, T. C. PARTRIDGE and L. H. BURCKLE (Editors), 1995 Paleoclimate and Evolution, with Emphasis on Human Origins. Yale University Press, New Haven, CT.

WEGHORST, C. M., G. S. BUZARD, R. J. CALVERT, J. E. HULLA, and J. M. RICE, 1995  Cloning and sequence of a processed p53 pseudogene from rat: a potential source of false `mutations' in PCR fragments of tumor DNA. Gene 166:317-322[Medline].

YONEKAWA, H., K. MORIWAKI, O. GOTOH, N. MIYASHITA, and Y. MATSUSHIMA et al., 1988  Hybrid origin of Japanese mice "Mus musculus molossinus": evidence from restriction analysis of mitochondrial DNA. Mol. Biol. Evol. 5:63-78[Abstract].

This article has been cited by other articles:

				J. B Searle, C. S Jones, I. Gunduz, M. Scascitelli, E. P Jones, J. S Herman, R. V. Rambau, L. R Noble, R.J Berry, M. D Gimenez, et al. Of mice and (Viking?) men: phylogeography of British and Irish house mice Proc R Soc B, January 22, 2009; 276(1655): 201 - 207. [Abstract] [Full Text] [PDF]

				J. B Searle, P. M Jamieson, I. Gunduz, M. I Stevens, E. P Jones, C. E.C Gemmill, and C. M King The diverse origins of New Zealand house mice Proc R Soc B, January 22, 2009; 276(1655): 209 - 217. [Abstract] [Full Text] [PDF]

				K. C. Teeter, B. A. Payseur, L. W. Harris, M. A. Bakewell, L. M. Thibodeau, J. E. O'Brien, J. G. Krenz, M. A. Sans-Fuentes, M. W. Nachman, and P. K. Tucker Genome-wide patterns of gene flow across a house mouse hybrid zone Genome Res., January 1, 2008; 18(1): 67 - 76. [Abstract] [Full Text] [PDF]

				R. Rottscheidt and B. Harr Extensive Additivity of Gene Expression Differentiates Subspecies of the House Mouse Genetics, November 1, 2007; 177(3): 1553 - 1567. [Abstract] [Full Text] [PDF]

				J. F. Storz, M. Baze, J. L. Waite, F. G. Hoffmann, J. C. Opazo, and J. P. Hayes Complex Signatures of Selection and Gene Conversion in the Duplicated Globin Genes of House Mice Genetics, September 1, 2007; 177(1): 481 - 500. [Abstract] [Full Text] [PDF]

				J. F. Baines and B. Harr Reduced X-Linked Diversity in Derived Populations of House Mice Genetics, April 1, 2007; 175(4): 1911 - 1921. [Abstract] [Full Text] [PDF]

				C. H. Tipper, C. E. Bencsics, and J. M. Coffin Characterization of Hortulanus Endogenous Murine Leukemia Virus, an Endogenous Provirus That Encodes an Infectious Murine Leukemia Virus of a Novel Subgroup J. Virol., July 1, 2005; 79(13): 8316 - 8329. [Abstract] [Full Text] [PDF]

				F. Y. Ideraabdullah, E. de la Casa-Esperon, T. A. Bell, D. A. Detwiler, T. Magnuson, C. Sapienza, and F. P.-M. de Villena Genetic and Haplotype Diversity Among Wild-Derived Mouse Inbred Strains Genome Res., October 1, 2004; 14(10a): 1880 - 1887. [Abstract] [Full Text] [PDF]

				A. Reyes, E. Nevo, and C. Saccone DNA Sequence Variation in the Mitochondrial Control Region of Subterranean Mole Rats, Spalax ehrenbergi Superspecies, in Israel Mol. Biol. Evol., April 1, 2003; 20(4): 622 - 632. [Abstract] [Full Text] [PDF]

				C. Smadja and G. Ganem Subspecies recognition in the house mouse: a study of two populations from the border of a hybrid zone Behav. Ecol., May 1, 2002; 13(3): 312 - 320. [Abstract] [Full Text] [PDF]

				R. C. Karn, A. Orth, F. Bonhomme, and P. Boursot The Complex History of a Gene Proposed to Participate in a Sexual Isolation Mechanism in House Mice Mol. Biol. Evol., April 1, 2002; 19(4): 462 - 471. [Abstract] [Full Text] [PDF]

				J. Mizutani, T. Chiba, M. Tanaka, K. Higuchi, and M. Mori Unique Mutations in Mitochondrial DNA of Senescence-Accelerated Mouse (SAM) Strains J. Hered., July 1, 2001; 92(4): 352 - 355. [Abstract] [Full Text] [PDF]