Genetics, Vol. 150, 687-697, October 1998, Copyright © 1998

P-Element Insertion at the polyhomeotic Gene Leads to Formation of a Novel Chimeric Protein That Negatively Regulates yellow Gene Expression in P-Element-Induced Alleles of Drosophila melanogaster

Tatiana Belenkaya1,a,b, Alexey Soldatov1,a,b,c, Elena Nabirochkinaa,c, Inna Birjukovaa, Sofia Georgievaa,b,c, and Pavel Georgieva,c
a Department of the Control of Genetic Processes, Russian Academy of Sciences, Moscow 117334, Russia,
b Unit of Oslo University, Institute of Gene Biology, Russian Academy of Sciences, Moscow 117334, Russia
c International Centre of Genetic Engineering and Biotechnology, 34012 Trieste, Italy

Corresponding author: Pavel Georgiev, Institute of Gene Biology, Russian Academy of Sciences, 34/5 Vavilov St., Moscow 117334, Russia., pgeorg{at}biogen.msk.su (E-mail).

Communicating editor: J. A. BIRCHLER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Polyhomeotic is a member of the Polycomb group (Pc-G) of homeotic repressors. The proteins encoded by the Pc-G genes form repressive complexes on the polycomb group response element sites. The phP1 mutation was induced by insertion of a 1.2-kb P element into the 5' transcribed nontranslated region of the proximal polyhomeotic gene. The phP1 allele confers no mutant phenotype, but represses transcription of P-element-induced alleles at the yellow locus. The phP1 allele encodes a chimeric P-PH protein, consisting of the DNA-binding domain of the P element and the PH protein lacking 12 amino-terminal amino acids. The P-PH, Polycomb (PC), and Posterior sex combs (PSC) proteins were immunohistochemically detected on polytene chromosomes in the regions of P-element insertions.


THE polyhomeotic (ph) gene is a member of a class of at least 30 genes with similar functions that are required for normal segmental specification in Drosophila and that are referred to as the Polycomb group (Pc-G) genes (JURGENS 1985 Down). The Pc-G genes act in normal development as repressors of BX-C and ANT-C genes (STRUHL 1981 Down; DURA et al. 1985 Down; STRUHL and AKAM 1985 Down; DURA and INGHAM 1988 Down; SIMON et al. 1992 Down). The finding of a protein motif common to the Polycomb protein (PC) and the heterochromatin-associated HP1 protein led to the supposition that the PC-G proteins might keep the homeotic genes inactivated by generating heterochromatin-like repressive structures (GAUNT and SINGH 1990 Down; PARO 1990 Down; PARO and HOGNESS 1991 Down). The PC protein was shown to cover large chromosomal domains of the homeotic bithorax complex BX-C, when it is in the inactive state (ORLANDO and PARO 1993 Down; STRUTT et al. 1997 Down). Several Pc-G members were found to be associated in a multiprotein complex (FRANKE et al. 1992 Down; RASTELLI et al. 1993 Down; PLATERO et al. 1996 Down; STRUTT and PARO 1997 Down). Cis-regulatory elements necessary for maintaining the repressed state of homeotic genes have been identified (MULLER and BIENZ 1991 Down; SIMON et al. 1993 Down; CHAN et al. 1994 Down; CHIANG et al. 1995 Down) and designated as Pc-G response elements (PREs) (SIMON et al. 1993 Down).

The ph gene forms a direct tandem repeat on the X chromosome and comprises two genetic and molecular units, one of which can largely compensate for a mutation of the other (DURA et al. 1987 Down; DEATRICK et al. 1991 Down). The PH protein contains a possible zinc finger motif, a serine/threonine-rich region, and glutamine repeats. It has been localized to ~80 sites on polytene chromosomes, and an extensive overlap in the localization of these sites has been found between PH and other PC-G proteins, PC, PSl, SU(Z)2, and PSC (DE CAMILLIS et al. 1992 Down; FRANKE et al. 1992 Down; MARTIN and ADLER 1993 Down; RASTELLI et al. 1993 Down; LONIE et al. 1994 Down).

In this article, we describe a new P-element-induced mutation in the ph gene, phP1, which represses yellow (y) gene expression in P-element-induced y alleles. This mutation has been derived via the insertion of a 1.2-kb-defective P element to the 5' transcribed noncoding region of the ph gene. The 1.2-kb P element encodes a truncated transposase protein that possesses a DNA-binding domain and leucine zipper (ANDREWS and GLOOR 1995 Down). The phP1 allele produces a chimeric protein containing the DNA-binding domain of the P element and the PH protein lacking 12 amino-terminal amino acids. Immunostaining of polytene chromosomes of the phP1 strain with antibodies to the PH protein shows new sites of PH protein localization that coincide with P-element sites. The Polycomb (PC) and Posterior sex combs (PSC) proteins are also bound to the chromatin at the sites of P-element localization. The phP1 mutation has a dominant effect, and the level of yellow repression directly correlates with the number of P-element copies inserted at the yellow locus. The phP1 mutation also mediates the pairing-dependent repressive interaction between different y alleles. Thus, in the phP1 background, the chimeric P-PH protein binds to P-element sequences and recruits other Pc-G proteins, leading to the formation of a repressive complex.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila strains and genetic crosses:
All flies were maintained at 25° in a standard yeast medium. Genetic symbols of the yellow alleles and their origin have been previously described (GEORGIEV et al. 1992 Down, GEORGIEV et al. 1997 Down). The w; Sb P(ry+{Delta}2–3) 99B e/TM1, e stock providing a stable source of transposase (ROBERTSON et al. 1988 Down) was obtained from the Bloomington stock center. The P(ry+{Delta}2–3)99B strain is referred to as {Delta}2–3 for abbreviation. The Pc-G mutations used in this study are described in LINDSLEY and ZIMM 1992 Down.

To induce mutagenesis in any y* allele, y* females were crossed to w; Sb {Delta}2–3 e/TM1, e males to produce dysgenic males with the y*/Y; Sb {Delta}2–3 e/+ genotype. In each vial, from 2 to 3 y*/Y; Sb {Delta}2–3 e/+ males were mated to 10–12 C(1)RM,y f females. The F2 progeny were analyzed for mutagenesis. All males with a new yellow phenotype were individually mated to virgin C(1)RM,y f females and the phenotype of the males was examined in the next generation.

For determination of the yellow phenotype, the levels of pigmentation in different tissues of adult flies were estimated visually in 3- to 5-day-old males and females developing at 25°. In every case 20–50 flies were scored. The pigmentation of six regions of the adult cuticle and its derivative structures, i.e., body, wings, thoracic, leg, wing, and abdomen bristles, was analyzed. The level of pigmentation was measured on a scale from 0 to 5. Flies with previously characterized y alleles (GEORGIEV et al. 1992 Down) were used as standards to determine levels of pigmentation, and new combinations of alleles were examined side by side with those used as standards. For example, a value of 0 corresponds to the pigmentation of the y- ac- strain that carries a deletion of the yellow gene. A value of 1 for body and wing pigmentation corresponds to that of the y2 allele (NASH and YARKIN 1974 Down), and a value of 3 corresponds to that of the partial revertant y2PR1 (GEORGIEV and KOZYCINA 1996 Down). Levels of pigmentation intermediate between y2 and y2PR1 were assigned a value of 2, and levels intermediate between y2PR1 and y+ (Canton-S) were assigned a value of 4.

Combinations of phP1 with different y alleles were obtained according to the following scheme:

F0: {female}y1scD1phP1wa/y1scD1phP1wa x {male}y*/Y;

F1: {female}y1scD1phP1wa/y* x {male}y1scD1phP1wa/Y;

F2: Selection of y*phP1wa males (sc+ phenotype and orange eyes).

The introduction of phP1 was confirmed by Southern blot hybridization. The wa mutation was used as the closest marker for the ph gene.

DNA manipulations:
DNA from adult flies was isolated using the protocol described in ASHBURNER 1989 Down. Genomic DNA was digested with restriction enzymes according to the supplier's instructions and separated in standard agarose gels (SAMBROOK et al. 1989 Down). The DNA was transferred to Hybond N+ membrane and probed according to the supplier's instructions. The DNA fragments used as probes were separated in agarose gels and purified using Gene Clean II (BIO 101, Inc., Vista, CA) according to the supplier's instructions.

For preparing genomic libraries, the DNAs of the mutant strains were restricted with BamHI endonuclease and subjected to agarose gel electrophoresis. Bands of the appropriate size were cut from the gel, and the DNA was extracted by electroelution. The DNA was ligated to the arms of the lambda DASH II vector (BamHI) provided by Stratagene (La Jolla, CA). The DNA was packaged in the Gigapack II Gold packaging extract (Stratagene). Plating and screening of the DNA libraries were done according to the standard method (SAMBROOK et al. 1989 Down). Subcloning and purification of plasmid DNA and mapping of restriction sites were performed by standard techniques (SAMBROOK et al. 1989 Down).

Genomic DNAs were subjected to PCR to amplify sequences from the derivative alleles (SAIKI et al. 1985 Down; MULLIS and FALOONA 1987 Down). The primers used in DNA amplification were as follows: ACTTCCACTTACCATCACGCCAC (y1), ATGCATTCTATGCACGAGCCTCC (y2), TCTGTGGACCGTGGCGCGGTAAC (y3), and CAGCGAAAGGTGATGTCTGACTC (y4) for the y gene; TCGCGTGCACAGGTGCTT (ph1), GTATGTAACGTGGAACGCAAGA (ph2), AGTTGAGTGCGTGCCTTA (ph3), GGGCGTGCCACATCGTAT (ph4), and AAGTGCCTGCAGCCAGCG (ph5) for the ph gene. The products of amplification were fractionated by electrophoresis in 1–2% agarose gels in TAE.

DNA sequencing was performed by the dideoxy chain-termination methodology. The PCR products were directly sequenced using a Sequenase II DNA sequencing kit for PCR product (Amersham, Buckinghamshire, UK) according to the manufacturer's instructions.

RNA manipulations:
Total cellular RNA was isolated from Drosophila embryos, larvae, pupae, or adult flies according to MAES and MESSENS 1992 Down. Poly(A), RNA was selected on oligo(dT)-cellulose columns, and 1.5 µg of poly(A), RNA was loaded per lane of agarose gel. After electrophoresis, RNA was transferred to Hybond-N, membrane (Amersham). The hybridization was performed at 50° in high SDS-formamide buffer (7% SDS, 50% formamide, 5x SSC, 2% blocking reagent (Boehringer Mannheim, Mannheim, Germany), 50 mM sodium phosphate, 0.1% sarcosyl) overnight. The 32P-labeled DNA probes were obtained in random priming reaction. Membranes were washed twice in 0.1% SDS, 1x SSC at room temperature for 10 min and in 0.1% SDS, 0.2x SSC at 65° for 20 min, and exposed to Kodak BioMaxMS film with Kodak BioMaxMS intensification screen for 2–4 hr.

The first cDNA strand was synthesized using 0.5 µg of mRNA from phP1 with the AGTTGAGTGCGTGCCTTA (ph3) primer by Superscript II reverse transcriptase (GIBCO BRL, Gaithersburg, MD). The product was purified in an agarose gel and two-step PCR was performed. For the first step the following primers were used: TCGCGTGCACAGGTGCTT (ph1) and AGTTGAGTGCGTGCCTTA (ph3). Then nested PCR with the GGGCGTGCCACATCGTAT (ph4) and AAGTGCCTGCAGCCAGCG (ph5) nested primer was performed. The PCR products were cloned in the pGEM-T vector (Promega, Madison, WI).

In situ hybridization to polytene chromosomes:
For in situ hybridization, Drosophila polytene chromosome spreads were prepared from salivary glands of third-instar larvae grown at 17°. Preparation of spreads, fixation, denaturation, and hybridization were done as described by FAUVARQUE and DURA 1993 Down. Labeling was performed with a[3H]dATP and a [3H]dUTP in a random priming reaction.

Immunostaining of polytene chromosomes:
Fixation and squashing of salivary glands and antibody staining were performed as described by PLATERO et al. 1996 Down. The polyclonal antibodies to the PH, PC, and PSC proteins were a gift of Dr. R. Paro. Polyclonal antibodies to PH were diluted 1:500; to PC, 1:20; and to PSC, 1:100 with TBS, 0.05% Tween-20, and 10% goat serum, and added to the slide. Cy3-conjugated anti-rabbit antibodies (1:300, Sigma, St. Louis) were used as secondary antibodies. Incubation with the primary antibodies was carried out for 2 hr at room temperature. A minimum of five slides containing squashes from two glands were examined and the results observed were highly reproducible.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Genetic observations on a modifier of P-element-induced mutations:
Previously we have described a mutation in the yellow locus, y2s14 (GEORGIEV et al. 1997 Down), which was induced by the insertion of a defective copy of the P element at position -69 bp of the yellow gene in the background of the y2 mutation, i.e., gypsy insertion 700 bp upstream of the yellow cap site (GEYER et al. 1986 Down; PARKHURST and CORCES 1986 Down). Flies carrying y2s14 have the same phenotype as the original y2 mutation, i.e., yellow color of the body and wings and normal pigmentation of the bristles (Table 1). The inserted P-element copy is 1.2-kb long, it contains 829 bp from the 5' end and 347 bp from the 3' end (from 2560 to 2907 bp), and the non-P-element sequence TAGCTACAAA is inserted in between. Its orientation is opposite to the direction of yellow transcription (GEORGIEV et al. 1997 Down).


 
View this table:
In this window
In a new window

 
Table 1. The effect of phP1 on P-induced y mutations

After mobilization of P-element transposition, a derivative of y2s14 that was characterized by a mutant yellow color of the thoracic and leg bristles was obtained. Southern blot hybridization showed no difference in the structure of the yellow locus between the parental y2s14 strain and its derivative. A modifier located on the X chromosome may have been responsible for the new mutant phenotype. This modifier was mapped by recombination analysis with the y2scD1waGct6g and y1z1 strains to the 0.5- to 0.6-cM region. The modifier has a dominant effect on y2s14/y2s14 and y2s14/y1 females but does not influence the y2, y2s, ytd, and y+ alleles induced by mobile elements other than the P element (LINDSLEY and ZIMM 1992 Down).

In situ hybridization showed that the modifier strain contained a P-element insertion in the 2D (1–0.5) region, where the modifier gene was mapped genetically by recombination. Several revertants of the modifier mutation were obtained in the progeny from a cross with the {Delta}2–3 strain. Southern blot analysis of DNA from flies of the mutant and revertant strains restricted with BamHI and hybridized with a P-element probe showed that a band with a molecular weight of ~0.5 kb disappeared in the revertants. These results suggested that the modifier mutation might be induced by a P insertion.

The 10.5-kb band hybridizing with the P element was cloned and the region surrounding the P element was sequenced. Homology searching using the GenBank database was performed using the BLASTN program (ALTSCHUL et al. 1990 Down), and the search showed 100% identity of the cloned region to the ph gene. Therefore, the modifier mutation was designated as phP1.

The structure of the phP1 mutation:
Restriction mapping and sequencing of the cloned fragments was performed. The phP1 mutation is induced by the insertion of a defective 1.2-kb P element into the untranslated leader sequence of the proximal ph gene at 109 bp, according to the cDNA clone map described by DEATRICK et al. 1991 Down (Figure 1). The direction of P-element transcription coincides with that of ph. The 1.2-kb P element has exactly the same structure as the P-element copy present at the yellow locus, i.e., sequences between 829 and 2560 bp are deleted, and the filler sequence TAGCTACAAA is inserted at the breakpoint.




View larger version (85K):
In this window
In a new window
Download PPT slide
 
Figure 1. Schematic representation of the structure and expression of the ph gene in the phP1 mutant. (A) The physical map of the proximal ph gene and its transcripts in the phP1 mutation. The ph coding region is indicated by black boxes, the transcribed untranslated region is indicated by a thick black line, and the intron and nontranscribed regions of ph are denoted by a thin line. The P-element coding region is shown by white boxes, the 5' nontranslated part by a thick white line, and other regions of the P element by thin white lines. Restriction enzymes are abbreviated as follows: H, HindIII; S, SacI; X, XhoI; B, BamHI; V, EcoRV; P, SphI. Below is shown the schematic structure of ph transcripts in the phP1 allele. e, exon of ph gene; 1.0-kb transcript; 6.4-kb major transcript; 6.7 kb identified by PCR minor transcript; 10.1-kb major transcript. (B) Northern blot analysis of transcripts from the proximal ph region in a wild-type Oregon strain. Northern blot hybridization of the BamHI-SacI fragment of the ph gene with mRNA isolated at different stages of development. 1, 3-day-old females; 2, 3-day-old males; 3, late pupae; 4, middle pupae; 5, early pupae; 6, late third-instar larva; 7, early third-instar larva; 8, second-instar larva; 9, first-instar larva; 10, embryo. (C) Northern blot analysis of transcripts from the proximal ph region in phP1 and wild-type Oregon strains during middle pupal stage of development. Northern blot hybridization of the BamHI-SacI (1, 2) and SacI-EcoRV fragments (3, 4) of the ph gene, and HindIII-XhoI fragment of the P element (5) with mRNA isolated from phP1 (1, 3, 5) and wild-type Oregon (2, 4) strains. The same blot was hybridized with a fragment containing the ras2 gene (1.6-kb transcript) that is expressed at an approximately constant level during Drosophila development.

Transcription of the ph gene in the phP1 strain:
Two major transcripts of 6.4 and 6.1 kb were earlier described, hybridizing with restriction fragments within the 28.6 kb of genomic DNA sequences containing the ph genes (DURA et al. 1987 Down). The proximal transcription unit encodes two embryonic mRNAs of 6.4 and 6.1 kb, and the distal transcription unit encodes a 6.4-kb embryonic mRNA (HODGSON et al. 1997 Down).

The subcloned BamHI-SacI and SacI-EcoRV DNA fragments of the proximal ph gene were used as probes for Northern blot hybridization (Figure 1A). The BamHI-SacI DNA fragment has no strong homology to the distal ph region and includes untranslated leader sequences, a small part of coding region and a part of the first intron of the proximal ph gene (DEATRICK et al. 1991 Down; DE CAMILLIS et al. 1992 Down). In the ph+ strain, the BamHI-SacI DNA fragment hybridizes to one major transcript of 6.4 kb and two minor transcripts of 6.1 and 9.0 kb at all stages of development from embryo to adult (Figure 1B). To understand the nature of the 9.0-kb transcript, we hybridized the Northern blot with the SacI-EcoRV DNA fragment that includes part of the ph first intron (Figure 1A). The probe hybridized only to the 9.0-kb transcript, confirming that the 9.0-kb transcript is a result of alternative splicing and leaving the first intron nonexcised (Figure 1B). This ph transcript has not been described, and its role is unknown.

In the mutant phP1 strain, the BamHI-SacI DNA fragment hybridized to three major bands, 1.0, 6.4, and 10.1 kb (Figure 1B), expressed at the middle pupal stage, i.e., at the time of yellow gene expression (GEYER et al. 1986 Down). The HindIII-XhoI DNA fragment (Figure 1A) subcloned from the P element hybridized to the same three bands, suggesting that all transcripts contained P-element sequences and the 5' nontranslated region of the ph gene. The 1.0-kb transcript can be explained by transcription termination within the P element, because it did not hybridize to the probe from the 3' terminus of the P element located beyond the signal for polyadenylation (Figure 1A). The 6.4-kb transcript did not hybridize to the DNA fragments from the 3' terminus of the P element and from the first ph intron, but hybridized to the XhoI DNA fragment (Figure 1A), covering the region from the second to the fifth exon and to the BamHI-SacI DNA fragment (the 5' nontranslated region of ph).

Part of the 6.4-kb transcript, including P-element sequences, was cloned by PCR using primers located within the 5' untranslated region and the second exon of the ph gene. Two different PCR products were obtained and subsequently sequenced. The first one contains the 5' untranslated region of the ph gene and the 5' terminus of the P element up to the end of the first exon combined in a correct frame with the second exon of the ph gene (Figure 1A). The calculated length of this transcript coincides with that of the wild-type transcript (6.4 kb). The predicted protein from this transcript is translated from the ATG codon of the P element and contains the DNA-binding region of the P element and an almost complete PH protein sequence lacking only 12 amino-terminal amino acids. We designated it as the P-PH protein. The chimeric P-PH protein encoded by the 6.4-kb transcript binds to sequences within the P element located at the yellow locus and is responsible for the repression of its transcription due to the presence of an almost complete PH sequence.

The second PCR product has the same 5' terminus, but the first exon of the P element is normally spliced to the second exon eliminating the first P-element intron. It appears that a new donor splice site is available in the P element at position 880 bp of the defective copy, which corresponds to position 2580 bp numbered according to the published complete P-element sequence (O'HARE and RUBIN 1983 Down). The second exon of the P element is fused at this site to the second exon of the ph gene with conservation of the correct open reading frame. A protein formed from this transcript is expected to include the DNA-binding domain and two protein-protein-binding regions of the P-element transposase (LEE et al. 1996 Down) followed by the PH protein sequence lacking the same 12 amino acids as the P-PH protein. The amount of this transcript seems to be low, as the band with the predicted 6.7-kb size was not identified on the Northern blot.

The 10.1-kb transcript hybridized to the probe from the first ph intron and to the probe from the 3' terminus of the P element. This transcript is more abundant than the 6.4-kb transcript, in contrast to the 9.0-kb transcript of the ph+ strain (Figure 1B). It is possible that the P-element insertion interferes with the splicing of the first intron of the ph gene. The 10.1-kb transcript contains almost all P-element sequences, including the 3' terminus, part of the first ph exon, the first intron, and all other exons of the ph gene. The protein translated from this mRNA is believed to be nonfunctional.

Molecular analysis of phP1 revertants:
To check the role of the chimeric P-PH proteins in the repression of P-induced yellow alleles, we obtained revertants of the phP1 mutation. For this purpose y z phP1; {Delta}2–3/+ males were crossed to y2s14 females. As a result, 36 independent ph+P derivative strains were established. All of them were analyzed by Southern blot hybridization.

Nineteen revertants were found to be caused by an almost complete deletion of the P element located at the ph locus. Two revertants, ph+P11 and ph+P27, cloned by PCR and sequenced, contained 16–18 bp from both P-element terminal inverted repeats (Table 2). Four revertants with partial deletion of the P element were also cloned by PCR and sequenced. Three of them had the 5'-deletion breakpoint within the 31-bp terminal inverted repeat and the 3'-deletion breakpoint inside the P-element body at positions ranging from 209 to 472 bp. In the ph+P18 revertant, the deletion was located between 130 and 701 bp (Table 2). Thus, all studied revertants were associated with deletions of sequences from the first exon of the P element, which encoded the DNA-binding domain of the transposase. This result confirms the role of the P-element DNA-binding domain in the effect of the phP1 mutation. According to results of Southern blot hybridization, the P-element sequences were deleted together with the proximal ph gene in seven phP1 revertants. Finally, three phP1 revertants were induced by the deletion of a 1- to 3-kb sequence of the 5' regulatory region, including the promoter of the ph gene (data not shown).


 
View this table:
In this window
In a new window

 
Table 2. Analysis of deletion breakpoints in revertants of the phP1 mutation

Immunolocalization of the P-PH protein in the distal region of the X chromosome:
If P-PH represses yellow by binding, then the P-PH protein should bind to the 1A region, where the yellow gene is located. To test this, immunostaining of polytene chromosomes from salivary glands of the y2s14 and y2s14phP1 larvae was performed with antibodies to the PH protein (gift of Dr. R. Paro). In agreement with literature data, PH-binding sites were detected in 1A, 2D, 4C, 5A, and 5D (DE CAMILLIS et al. 1992 Down) of the distal part of the X chromosome. The presence of a PH-binding site in the 1A region of the wild-type X chromosome did not permit us to analyze the possibility of formation of a new site in the yellow locus.

However, three new sites for PH protein in the 2C, 3A, and 3B regions of the distal part of the X chromosome were detected in the y2s14phP1 strain when compared to the y2s14 one (Figure 2). In situ hybridization experiments with the y2s14 and y2s14phP1 strains showed that the same regions had P-element copies. Thus, P-element-containing regions have acquired the ability to bind the PH protein in the phP1 mutant chromosome, confirming that the chimeric protein is able to interact with P-element sequences.



View larger version (57K):
In this window
In a new window
Download PPT slide
 
Figure 2. Immunohistochemical localization of PH, PSC, and PC proteins on the distal region of the X chromosome in wild-type (A) and phP1 (B, C, and D) strains. In the wild-type strain, PH binding was detected in 1A and 2D regions. The PC and PSC proteins were detected in the same 1A and 2D regions. The additional PSC- (B), PH- (C), and PC- (D) binding sites appearing in the phP1 strain were detected in the same regions: 2C, 3A, and 3B.

Effect of the phP1 mutation on different yellow alleles:
The next step of our work was to combine the phP1 mutation with different P-element-containing y alleles. The majority of y alleles used for this purpose originated from strains with super unstable P-induced mutations in the yellow locus raised in the y2 background (GEORGIEV et al. 1992 Down, GEORGIEV et al. 1997 Down). The effect of phP1 on yellow gene expression was different and depended on the molecular structure of the y alleles.

We first analyzed whether the orientation of the P element in the yellow locus contributed to the observed level of P-PH-mediated inactivation of yellow expression. The P element in the y2sA3 allele has the same structure as in the y2s14 or the y2s20 mutations, but its direction of transcription is inverted and coincides with the direction of yellow transcription (Figure 3). The phP1 mutation enhanced the mutant phenotype of the y2s14, y2s20, and y2sA3 alleles to the same extent: the thoracic and leg bristles became yellow (Table 1). Thus, P-element orientation did not influence the effect of the phP1 mutation.



View larger version (22K):
In this window
In a new window
Download PPT slide
 
Figure 3. Structure of y alleles. Exons of the yellow gene and direction of transcription are indicated by arrows. Transcriptional enhancers and the su(Hw)-binding region of gypsy are marked by ovoid structures. En-w, enhancer for the wing blade; En-b, enhancer for the body cuticle; En-br, enhancer for bristles. Insertions responsible for different alleles are represented by arrows indicating their direction. The gypsy element is inserted in the 5' region of the yellow gene in the y2 allele and its derivatives. Arrows flanking gypsy are LTRs. Deleted DNA sequences are shown by dotted lines. Restriction enzymes are abbreviated as follows: H, HindIII; G, BglII; X, XhoI; K, KpnI; B, BamHI.

The y76d28 allele is of special interest because the P element has inserted in the 5' transcribed nontranslated portion of the yellow gene (GEYER et al. 1988 Down). In y76d28 flies, pigmentation of all adult cuticular structures is tan (Table 1). The phP1 mutation further enhanced the mutant phenotype of y76d28 flies to approximately the null level, suggesting that the P-element position relative to the yellow promoter was not critical for the repression effect of the phP1.

Two previously described y2s14 revertants, y+s7 and y+s8 (T. BELENKAYA and P. GEORGIEV, unpublished data), were induced by the excision of gypsy with one of the long terminal repeats (LTRs) remaining at the insertion site (Figure 3). These alleles were used to test the possibility of an almost normally transcribed gene to be affected by the phP1 mutation. The effect of the phP1 mutation on the bristle pigmentation was less pronounced and the pigmentation of body and wings was only slightly decreased (Table 1).

Some of the y alleles in our collection have two or even three tandemly inserted P-element copies (GEORGIEV et al. 1997 Down) that allowed us to study the role of P-element copy number in the ability of phP1 mutation to repress yellow expression. Two y alleles, y2s7 and y2s11, possessed a pair of 1.2-kb P elements in the inverted head-to-head orientation (Figure 3). The P-element duplication on its own did not influence the y phenotype (Table 1), but the combination of y2s11 or y2s7 with phP1 completely inactivated yellow expression: the flies became unpigmented. Another previously obtained allele, yds62, was cloned and shown to be induced by the insertion of three 1.2-kb P elements (Figure 3). Although yds62 flies have darker pigmentation than y2 flies, the phP1 mutation also completely repressed yellow expression (Table 1). These findings indicate that the presence of two or three P elements strongly enhances the repressive effect of the phP1 mutation on yellow expression.

Pairing-dependent repressive effect of the phP1 mutation:
To determine whether the repressive effect of the phP1 mutation depends on allelic pairing, we studied the effect of the phP1 mutation on phenotypes of females that have different combinations of y alleles.

In the presence of the phP1 mutation, females homozygous for y alleles with one P-element copy (y2s14, y+s7) show stronger mutant phenotypes than heterozygous females having the same y alleles in combination with y1, which is induced by a point mutation in the yellow coding region (LINDSLEY and ZIMM 1992 Down). In combination with the y1s8 mutation, which contains a P-element insertion and, simultaneously, a deletion of the yellow gene from -69 to +118 bp, the repressive effect of phP1 on yellow is enhanced. It appears that single P-element copies induce a weak cooperative repression of yellow transcription in the presence of phP1.

The y2s11 mutation is caused by a double P-element insertion (Figure 3). y2s11/y2s14 females in the presence of phP1 had a phenotype similar to that of y1 flies (Table 3). We studied heterozygotes containing y2s11 with the described above y+s7 allele carrying one P-element copy. yellow gene expression in y2s11/y+s7 females with the phP1 mutation was also significantly reduced (Table 3). When the yds62 allele (three copies of the P element) is used instead of y2s11 in combination with the y+s7 allele, further enhancement of the phP1 effect on yellow expression occurs (Table 3). Thus, the level of the pairing-dependent repression of yellow transcription directly correlates with the number of P-element copies.


 
View this table:
In this window
In a new window

 
Table 3. phP1-mediated transrepression of transcription in females heterozygous for y alleles

The phP1 mutation fails to affect the pigmentation of the y2/y2s11 or y2/yds62 heterozygous females, indicating that the presence of P-element sequences in both homologues is necessary. To test the minimal P-element sequences required for transinhibition, we used derivatives of the y+s7 and y2s14 alleles resulting from P-element excisions (T. BELENKAYA and P. GEORGIEV, unpublished data). P-element excisions in the y+s7 strain have led to the appearance of y+ews derivative alleles. The y+ews flies are characterized by a weak reduction of the body cuticle and bristle pigmentation compared to the parental y+s7 flies (Table 3). Molecular analysis of the y+ews alleles has shown that they can be divided into two classes (Figure 4). Two y+ews alleles of the first class resulted from an almost complete deletion of the P element, only 14–18 bp being retained at each terminus. The phP1 mutation did not influence the pigmentation of flies homozygous for y+ews alleles or their combination with either y2s11 or y2s62 alleles (Figure 4; Table 3). Thus, the terminal 18 bp of P-element sequences are not sufficient for the repression of yellow transcription by the phP1.



View larger version (27K):
In this window
In a new window
Download PPT slide
 
Figure 4. Schematic presentation of the phP1 effect on deletion derivatives of the P element in y alleles. Above is a structure of the 1.2-kb P element. The double line in the center of this box indicates the internal deletion breakpoint of this P element. IR, 31-bp inverted repeat; TPS, transposase-binding site. Below are the P-element sequences present in the alleles indicated at the left. The empty boxes represent maximal P-element sequences remaining in the deletion derivatives; the black boxes represent the minimal sequences. The figures below the boxes are the numbers of base pairs remaining in the P-element sequences from the corresponding end to the breakpoint. The thin lines between the boxes represent deleted P-element sequences. The arrows show the direction of the P element in the corresponding alleles. The number of black and white circles indicates the level of pigmentation in 1, the body; 2, wings; 3, thoracic bristles; 4, leg bristles; 5, wing bristles; 6, abdominal bristles. The number of black circles shows the inhibitory effect of the phP1 mutation in y*/y2s11 females. One circle represents one point as in Table 1.

Four y+ews alleles of the second class have a partial P-element deletion with one breakpoint in the 5' inverted repeat, while the 3' terminus retains from 198 to 971 bp (Figure 4). The phP1 mutation also failed to influence the pigmentation of males or homozygous females with any of these y+ews mutations. This result suggests that at least 971 bp from the 3' part of the P element are not enough to mediate repression of yellow transcription by the P-PH protein. In contrast, the presence of the phP1 mutation strongly reduced the pigmentation of flies with heterozygous combinations of y+ews and either y2s11 or yds62 alleles. Thus, 198 bp of the P-element sequence adjacent to the 3' terminus, including the transposase-binding region, are sufficient for the phP1-mediated pairing-dependent inhibition of yellow expression.

Three derivatives of the y2s14 allele (Figure 4) designated as y+ls (the pigmentation of body cuticle and wings is intermediate between y1 and y+) have internal deletions, with one breakpoint within the 31-bp terminal inverted repeat at the 3' end and the 5' breakpoint inside the P-element body at positions 108–404 bp. The phP1 mutation failed to affect the pigmentation of the y+ls males and females, suggesting that both P-element termini are important for repression (Table 3).

The y+ls alleles, in combination with y2s11 (two P-element copies) and especially with yds62 (three P-element copies), are strongly affected by phP1 (Table 3). Thus, it can be concluded that 108 bp from the 5' end of the P element are enough for transrepression of yellow transcription by the phP1 mutation.

The phP1 mutation induces the formation of PC-G protein complex on P-element sequences:
As it has been shown above, when the P-element insertion is present in the yellow locus, the P-PH protein bound to P-element sequences induces inhibition of yellow transcription. This raises the question of whether other PC-G proteins are involved in this process.

In order to answer this question, immunostaining of polytene chromosomes from salivary glands of y2s14 and y2s14 phP1 larvae was performed with antibodies to the PC and PSC proteins (gift of Dr. R. Paro). In both strains, y2s14 and y2s14phP1, PC and PSC sites were detected in the same regions as for P-PH: 1A, 2D, 4C, 5A, and 5D (ZINK and PARO 1989; DE CAMILLIS et al. 1992 Down; RASTELLI et al. 1993 Down). In the y2s14phP1 strain, the same additional sites were identified as for P-PH protein: 2C, 3A, and 3B, which coincide with the regions of P-element localization (Figure 2). Thus, in the phP1 mutant, the P-element-containing regions acquire the ability to bind not only the P-PH protein but also other PC-G proteins, in particular PC and PSC, obviously through their interaction with P-PH. This conclusion is supported by the fact that at least in the case of the y2s14 and y+s7 alleles induced by a single P-element insertion, the repressive effect of phP1 on yellow transcription can be diminished by mutations in the Pc (Pc1 and Pc3) and the Psc (Psc1) genes (Table 4). In contrast, null mutations (BREEN and DUNCAN 1986 Down; WU et al. 1989 Down; BORNEMANN et al. 1996 Down) in some other Pc-G genes, such as Scm (ScmXF24 and ScmD1) and E(z) [E(z)S1 and E(z)1], have no distinct effect on the phP1-mediated repression of yellow transcription. None of the mutations influenced the inhibitory effect of the phP1 mutation on the y alleles derived by a double or triple P-element insertion (data not shown).


 
View this table:
In this window
In a new window

 
Table 4. Suppression of phP1 effect by mutations in Pc-G


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The experiments described here demonstrate that the chimeric P-PH protein consisting of the P-element transposase-binding domain and a major portion of the PH protein acts as a transcriptional silencer and establishes Pc-G-dependent repression of a yellow gene containing a P-element insertion.

LOCKE et al. 1988 Down proposed that the PC-G proteins might form a multimeric complex. Support for this idea has come from observations that PC and PH bind to identical sites on polytene chromosomes and coimmunoprecipitate (FRANKE et al. 1992 Down). The PSC and SU(Z) binding sites on polytene chromosomes also substantially overlap with those of PC and PH (MARTIN and ADLER 1993 Down; RASTELLI et al. 1993 Down). The recruiting mechanism for assembling a Pc-G complex in Drosophila has been shown by the use of a PC protein fused to the GAL4 DNA-binding domain (MULLER 1995 Down) or of the chimeric HP1-PC protein, which binds both heterochromatic and euchromatic sites (PLATERO et al. 1996 Down). Immunoprecipitation experiments using in vivo cross-linked chromatin indicate that PC, PSC, and PH proteins are associated with identical regulatory elements of the selector gene engrailed in tissue culture cells (STRUTT and PARO 1997 Down). Recently it was found that PSC protein contacts PH and PC through specific conserved domains (KUBA and BROCK 1998 Down).

Analysis of the amino acid sequence showed that the PH protein contained glutamine repeats, a single putative zinc finger, and the SPM domain in the carboxy terminus (DE CAMILLIS et al. 1992 Down). However, the PH protein on its own does not exhibit a sequence-specific DNA-binding activity in vitro (FRANKE et al. 1992 Down; RASTELLI et al. 1993 Down). In contrast, the chimeric P-PH protein has acquired the ability to bind specifically to the DNA independently of the other PC-G proteins. The 1.2-kb P-element inserted in the phP1 allele has a deletion between 829 and 2560 and resembles the previously described KP element, which lacks amino acids within interval 800–2560 bp (BLACK et al. 1987 Down). The truncated transposase produced by the KP element contains the intact DNA-binding domain and two regions providing protein-protein interactions that are important for effective binding of truncated transposase to P-element sequences (LEE et al. 1996 Down). The major 6.4-kb mRNA of the phP1 gene expected to encode the chimeric P-PH protein contains only 119 N-terminal amino acids of the P transposase that include the DNA-binding domain and a part of a putative leucine zipper dimerization domain (ANDREWS and GLOOR 1995 Down). It is possible that the protein-protein interaction region, which is important for dimerization and high-affinity DNA binding, is supplied by the SPM domain of the PH protein. The minor mRNA identified by PCR encodes a chimeric protein that has 199 amino acids of the transposase amino terminus, including the DNA-binding region and both protein-protein interaction regions. Thus, this P-PH protein can bind the P-element termini with high affinity using only the P-element domains.

The P-PH protein bound to P-element sequences is able to recruit at least two other PC-G proteins as suggested by the coincident sites of immunolocalization of the P-PH, PC, and PSC proteins with the P-element insertion sites on polytene chromosomes. The effect of mutations in the Pc-G genes on the phP1-mediated inhibition of yellow transcription does not exclude the possibility that other PC-G proteins also participate in organization of this complex.

Our genetic observations suggest that both P-element termini enclosing the transposase-binding sites are necessary for the repression of yellow transcription by phP1. The degree of repression directly correlates with the number of P-element copies at the yellow locus. These data suggest a cooperative mechanism for phP1-mediated assembly of repressive complexes on P-element sequences. Thus, the P-element sequences function as known PREs in the phP1 backround.

Transposons containing PRE sites often show an enhancement of silencing when the fly is homozygous for a transposon insertion, indicating that the homologously paired PREs interact to produce a more stable and more repressive Pc-G complex (FAUVARQUE and DURA 1993 Down; CHAN et al. 1994 Down; KASSIS 1994 Down; PIRROTTA 1997 Down; SIGRIST and PIRROTTA 1997 Down). We have also found a transinteraction between y alleles exhibiting weak and strong phP1-mediated repression. However, a y allele in the homologous chromosome requires at least some of the transposase-binding sequences of the P-element termini for this effect to take place. These regions can play the role of "weak PRE" that can induce repression in the presence of another "strong PRE" in the homologue.

In this article we describe a novel mechanism for the action of a mobile element insertion on the control of gene expression. This is the formation of chimeric genes encoding the functional domains of both a mobile element protein and a protein encoded by a target gene. The insertion of a truncated P element, like our 1.2-kb element or KP, into leader sequences or introns of regulatory genes may generate chimeric transcriptional proteins with an altered DNA-binding activity. Such proteins are able to bind to any P-element copy present in the genome and also to other sequences with homology to those recognized by the P-element transposase. As a consequence, new regulatory regions may appear in this way. We are now carrying out selective screens to obtain such mutations for other regulatory genes.


*  FOOTNOTES

1 These authors contributed equally to this work. Back


*  ACKNOWLEDGMENTS

The authors appreciate the help of anonymous reviewers for suggestions improving the manuscript. The authors are greatly indebted to Dr. R. Paro for providing us with PH, PSC, and PC antibodies and to Dr. P. K. Geyer and Dr. Ting Wu for several fly strains and plasmids. This work was supported by the INTAS-94-3801 grant, by the International Research Scholar's award from the Howard Hughes Medical Institute, and by a Human Frontier Science Program grant (to P.G.) and by a grant from the University of Oslo (to A.S. and T.B.).

Manuscript received March 23, 1998; Accepted for publication June 19, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADLER, P. N., J. CHARLTON, and B. P. BRUNK, 1989  Genetic interactions of the Suppressor 2 of zeste region genes. Dev. Genet. 10:249-260[Medline].

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990  Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].

ANDREWS, J. D. and G. B. GLOOR, 1995  A role for the Kp leucine zipper in regulating P element transposition in Drosophila melanogaster. Genetics 141:587-594[Abstract].

ASHBURNER, M., 1989 Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BLACK, D. M., M. S. JACKSON, M. G. KIDWELL, and G. A. DOVER, 1987  KP elements repress P-induced hybrid dysgenesis in Drosophila melanogaster. EMBO J. 6:4125-4135[Medline].

BORNEMANN, D., E. MILLER, and J. SIMON, 1996  The Drosophila Polycomb group gene Sex comb on midleg (Scm) encodes a zinc finger protein with similarity to polyhomeotic protein. Development 122:1621-1630[Abstract].

BREEN, T. R. and I. M. DUNCAN, 1986  Maternal expression of genes that regulate the bithorax complex of Drosophila melanogaster. Dev. Biol. 118:442-456[Medline].

BRUNK, B. P., E. C. MARTIN, and P. N. ADLER, 1991  Molecular genetics of the Posterior sex comb/Suppressor 2 of zeste region of Drosophila: aberrant expression of the Suppressor 2 of zeste gene results in abnormal bristle development. Genetics 128:119-132[Abstract].

CHAN, C.-S., L. RASTELLI, and V. PIRROTTA, 1994  A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression. EMBO J. 13:2553-2564[Medline].

CHIANG, A., M. B. O'CONNOR, R. PARO, J. SIMON, and B. BENDER, 1995  Discrete Polycomb binding sites in each parasegmental domain of the bithorax complex. Development 121:1681-1689[Abstract].

DEATRICK, J., M. DALY, N. B. RANDSHOLT, and H. W. BROCK, 1991  The complex genetic locus polyhomeotic in Drosophila melanogaster potentially encodes two homologous zinc-finger proteins. Gene 105:185-195[Medline].

DE CAMILLIS, M., N. CHENG, D. PIERRE, and H. W. BROCK, 1992  The polyhomeotic gene of Drosophila encodes a chromatin protein that shares polytene chromosome-binding sites with Polycomb. Genes Dev. 6:223-232[Abstract/Free Full Text].

DURA, J.-M. and P. INGHAM, 1988  Tissue- and stage-specific control of homeotic and segmentation gene expression in Drosophila embryos by the polyhomeotic gene. Development 103:733-741[Abstract/Free Full Text].

DURA, J.-M., H. W. BROCK, and P. SANTAMARIA, 1985  polyhomeotic: a gene of Drosophila melanogaster required for correct expression of segment identity. Mol. Gen. Genet. 198:213-220[Medline].

DURA, J.-M., N. B. RANDSHOLT, J. DEATRICK, I. ERK, and P. SANTAMARIA et al., 1987  A complex genetic locus, polyhomeotic, is required for segmental specification and epidermal development in D. melanogaster. Cell 51:829-839[Medline].

FAUVARQUE, M.-O. and J.-M. DURA, 1993  polyhomeotic regulatory sequences induce developmental regulator-dependent variegation and targeted P-element insertions in Drosophila. Genes Dev. 7:1508-1520[Abstract/Free Full Text].

FRANKE, A., M. DE CAMILLIS, D. ZINK, N. CHENG, and H. W. BROCK et al., 1992  Polycomb and polyhomeotic are constituents of a multimeric protein complex in chromatin of Drosophila melanogaster. EMBO J. 11:2941-2950[Medline].

GAUNT, S. J. and P. B. SINGH, 1990  Homeogene expression patterns and chromosomal imprinting. Trends Genet. 6:208-212[Medline].

GEORGIEV, P. G., V. A. YELAGIN, E. M. BUFF, and N. P. KOLYAGIN, 1992  Properties of super unstable mutations in the Drosophila melanogaster yellow locus. Genetica (in Russian) 28:98-107.

GEORGIEV, P. and M. KOZYCINA, 1996  Interaction between mutations in the suppressor of Hairy wing and modifier of mdg4 genes of Drosophila melanogaster affecting the phenotype of gypsy-induced mutations. Genetics 142:425-436[Abstract].

GEORGIEV, P., T. TIKHOMIROVA, V. YELAGIN, T. BELENKAYA, and E. GRACHEVA et al., 1997  Insertions of hybrid P elements in the yellow gene of Drosophila cause a large variety of mutant phenotype. Genetics 146:583-594[Abstract].

GEYER, P. K., C. SPANA, and V. G. CORCES, 1986  On the molecular mechanism of gypsy-induced mutations at the yellow locus of Drosophila melanogaster. EMBO J. 5:2657-2662[Medline].

GEYER, P. K., K. L. RICHARDSON, V. G. CORCES, and M. M. GREEN, 1988  Genetic instability in Drosophila melanogaster: P-element mutagenesis by gene conversion. Proc. Natl. Acad. Sci. USA 85:6455-6459[Abstract/Free Full Text].

HODGSON, J. W., N. N. CHENG, D. A. SINCLAIR, M. KYBA, and N. B. RANDSHOLT et al., 1997  The polyhomeotic locus of Drosophila melanogaster is transcriptionally and post-transcriptionally regulated during embryogenesis. Mech. Dev. 66:69-81[Medline].

JURGENS, G., 1985  A group of genes controlling the spatial expression of the bithorax complex in Drosophila. Nature 316:153-155.

KASSIS, J. A., 1994  Unusual properties of regulatory DNA from the Drosophila engrailed gene: three "pairing-sensitive" sites within a 1.6 kb region. Genetics 136:1025-1038[Abstract].

KUBA, M. and H. W. BROCK, 1998  The Drosophila Polycomb Group Protein Psc contacts ph and Pc through specific conserved domains. Mol. Cell. Biol. 18:2712-2720[Abstract/Free Full Text].

LEE, C. C., Y. M. MUL, and D. C. RIO, 1996  The Drosophila P-element KP repressor protein dimerizes and interacts with multiple sites on P-element DNA. Mol. Cel. Biol. 16:5616-5622[Abstract].

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, New York.

LOCKE, J., M. A. KOTARSKI, and K. D. TARTOF, 1988  Dosage-dependent modifiers of position-effect variegation in Drosophila and mass action model that explains their effect. Genetics 120:181-198[Abstract/Free Full Text].

LONIE, A., R. D'ANDREA, R. PARO, and R. SAINT, 1994  Molecular characterization of the Polycomblike gene of Drosophila melanogaster, a trans-acting negative regulator of homeotic gene expression. Development 120:2629-2636[Abstract/Free Full Text].

MAES, M. and E. MESSENS, 1992  Phenol as grinding material in RNA preparations. Nucleic Acids Res. 20:4374[Free Full Text].

MARTIN, E. C. and P. N. ADLER, 1993  The Polycomb group gene Posterior sex combs encodes a chromosomal protein. Development 117:641-655[Abstract].

MULLER, J., 1995  Transcriptional silencing by the Polycomb protein in Drosophila embryos. EMBO J. 14:1209-1220[Medline].

MULLER, J. and M. BIENZ, 1991  Long range repression conferring boundaries of Ultrabithorax expression in the Drosophila embryo. EMBO J. 10:3147-3155[Medline].

MULLIS, K. B. and F. A. FALOONA, 1987  Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155:335-350[Medline].

NASH, W. G. and R. J. YARKIN, 1974  Genetic regulation and pattern formation: a study of the yellow locus in Drosophila melanogaster. Genet. Res. 24:19-26[Medline].

O'HARE, K. and G. M. RUBIN, 1983  Structure of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-35[Medline].

ORLANDO, V. and R. PARO, 1993  Mapping Polycomb-repressed domains in the bithorax complex using in vivo formaldehyde cross-linked chromatin. Cell 75:1187-1198[Medline].

PARKHURST, S. M. and V. G. CORCES, 1986  Interactions among the gypsy element and the yellow and suppressor of Hairy-wing loci in Drosophila melanogaster. Mol. Cell. Biol. 6:47-53[Abstract/Free Full Text].

PARO, R., 1990  Imprinting a determined state into the chromatin of Drosophila. Trends Genet. 6:416-421[Medline].

PARO, R. and D. HOGNESS, 1991  The Polycomb protein shares a homologous domain with a heterochromatin-associated protein of Drosophila. Proc. Natl. Acad. Sci. USA 88:263-267[Abstract/Free Full Text].

PIRROTTA, V., 1997  Pc-G complexes and chromatin silencing. Curr. Opin. Genet. Dev. 7:249-258[Medline].

PLATERO, J. S., E. J. SHARP, P. N. ADLER, and J. C. EISSENBERG, 1996  In vivo assay for protein-protein interactions using Drosophila chromosomes. Chromosoma 104:393-404[Medline].

RASTELLI, L., C. S. CHAN, and V. PIRROTTA, 1993  Related chromosome binding sites for zeste, suppressors of zeste and Polycomb group proteins in Drosophila and their dependence on Enhancer of zeste function. EMBO J. 12:1513-1522[Medline].

ROBERTSON, H. M., C. R. PRESTSON, R. M. PHILLIPS, D. JOHNSON-SCHLITZ, and W. K. BENZ et al., 1988  A stable genomic source of P element transposase in Drosophila melanogaster. Genetics 118:461-470[Abstract/Free Full Text].

SAIKI, R. K., S. SCHARF, F. FALOONA, K. B. MULLIS, and G. T. HORN et al., 1985  Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354[Abstract/Free Full Text].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SIGRIST, C. J. and V. PIRROTTA, 1997  Chromatin insulator elements block the silencing of a target gene by the Drosophila polycomb responsible element (PRE) but allow trans interactions between PREs on different chromosomes. Genetics 147:209-221[Abstract].

SIMON, J., A. CHIANG, and W. BENDER, 1992  Ten different Polycomb group genes are required for spatial control of the AbdA and AbdB homeotic products. Development 114:493-505[Abstract].

SIMON, J., A. CHIANG, W. BENDER, M. J. SHIMELL, and M. O'CONNOR, 1993  Elements of the Drosophila bithorax complex that mediate repression by Polycomb group products. Dev. Biol. 158:131-144[Medline].

STRUHL, G., 1981  A gene product required for correct initiation of segmental determination in Drosophila. Nature 293:36-41[Medline].

STRUHL, G. and M. AKAM, 1985  Altered distributions of Ultrabithorax transcripts in extra sex combs mutant embryos of Drosophila. EMBO J. 4:3259-3264[Medline].

STRUTT, H. and R. PARO, 1997  The polycomb group protein complex of Drosophila melanogaster has different compositions at different target genes. Mol. Cell. Biol. 17:6773-6783[Abstract].

STRUTT, H., G. CAVALLI, and R. PARO, 1997  Co-localization of Polycomb protein and GAGA factor on regulatory elements responsible for the maintenance of homeotic gene expression. EMBO J. 16:3621-3632[Medline].

WU, C.-T., R. S. JONES, P. F. LASKO, and W. M. GELBART, 1989  Homeosis and interaction of zeste and white in Drosophila. Mol. Gen. Genet. 218:559-564[Medline].

ZINK, D. and R. PARO, 1995  Drosophila Polycomb-group regulated chromatin inhibits the accessibility of a trans-activator to its target DNA. EMBO J. 14:5660-5671[Medline].




This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
D. V. Kopytova, A. N. Krasnov, M. R. Kopantceva, E. N. Nabirochkina, J. V. Nikolenko, O. Maksimenko, M. M. Kurshakova, L. A. Lebedeva, M. M. Yerokhin, O. B. Simonova, et al.
Two Isoforms of Drosophila TRF2 Are Involved in Embryonic Development, Premeiotic Chromatin Condensation, and Proper Differentiation of Germ Cells of Both Sexes.
Mol. Cell. Biol., October 1, 2006; 26(20): 7492 - 7505.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Muratoglu, S. Georgieva, G. Papai, E. Scheer, I. Enunlu, O. Komonyi, I. Cserpan, L. Lebedeva, E. Nabirochkina, A. Udvardy, et al.
Two Different Drosophila ADA2 Homologues Are Present in Distinct GCN5 Histone Acetyltransferase-Containing Complexes
Mol. Cell. Biol., January 1, 2003; 23(1): 306 - 321.
[Abstract] [Full Text]


Home page
GeneticsHome page
L. Marin, M. Lehmann, D. Nouaud, H. Izaabel, D. Anxolabéhère, and S. Ronsseray
P-Element Repression in Drosophila melanogaster by a Naturally Occurring Defective Telomeric P Copy
Genetics, August 1, 2000; 155(4): 1841 - 1854.
[Abstract] [Full Text]


Home page
GeneticsHome page
I. Biryukova, T. Belenkaya, H. Hovannisian, E. Kochieva, and P. Georgiev
The P-Ph Protein-Mediated Repression of yellow Expression Depends on Different cis- and trans-Factors in Drosophila melanogaster
Genetics, August 1, 1999; 152(4): 1641 - 1652.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
A. Soldatov, E. Nabirochkina, S. Georgieva, T. Belenkaja, and P. Georgiev
TAFII40 Protein Is Encoded by the e(y)1 Gene: Biological Consequences of Mutations
Mol. Cell. Biol., May 1, 1999; 19(5): 3769 - 3778.
[Abstract] [Full Text] [PDF]