- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Shoresh, M.
- Articles by Segal, D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Shoresh, M.
- Articles by Segal, D.
Overexpression Beadex Mutations and Loss-of-Function heldup-a Mutations in Drosophila Affect the 3' Regulatory and Coding Components, Respectively, of the Dlmo Gene
Michal Shoresha, Sara Orgada, Orit Shmuelia, Ruth Werczbergera, Dana Gelbauma, Shirly Abiria, and Daniel Segalaa Department of Molecular Microbiology and Biotechnology, Tel-Aviv University, Tel-Aviv 69978, Israel
Corresponding author: Daniel Segal, Department of Molecular Microbiology and Biotechnology, Tel-Aviv University, Tel-Aviv 69978, Israel., dsegal{at}ccsg.tau.ac.il (E-mail).
Communicating editor: T. C. KAUFMAN
| ABSTRACT |
|---|
LIM domains function as bridging modules between different members of multiprotein complexes. We report the cloning of a LIM-containing gene from Drosophila, termed Dlmo, which is highly homologous to the vertebrate LIM-only (LMO) genes. The 3' untranslated (UTR) of Dlmo contains multiple motifs implicated in negative post-transcriptional regulation, including AT-rich elements and Brd-like boxes. Dlmo resides in polytene band 17C1-2, where Beadex (Bx) and heldup-a (hdp-a) mutations map. We demonstrate that Bx mutations disrupt the 3'UTR of Dlmo, and thereby abrogate the putative negative control elements. This results in overexpression of Dlmo, which causes the wing scalloping that is typical of Bx mutants. We show that the erect wing phenotype of hdp-a results from disruption of the coding region of Dlmo. This provides molecular grounds for the suppression of the Bx phenotype by hdp-a mutations. Finally, we demonstrate phenotypic interaction between the LMO gene Dlmo, the LIM homeodomain gene apterous, and the Chip gene, which encodes a homolog of the vertebrate LIM-interacting protein NLI/Ldb1. We propose that in analogy to their vertebrate counterparts, these proteins form a DNA-binding complex that regulates wing development.
LIM domains constitute a novel subclass of cysteine-rich motifs and are found in various proteins involved in key processes during development and differentiation (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The nuclear localization of many LIM proteins and the fact that they often contain known transcriptional activation domains prompted the suggestion, and subsequently the demonstration, that the LIM domains play a role in modulation of the activity of the transcriptional activation domains associated with them. For example, the transcriptional activation capability of the amphibian LIM homeodomain protein Xlim-1 is relieved when its LIM domains are either deleted (![]()
![]()
![]()
![]()
![]()
LIM domains can also mediate binding of two LIM proteins resulting in homodimers, as in the case of the cysteine-rich protein (CRP; ![]()
![]()
![]()
![]()
LMO proteins serve to link different transcription factors that either contain or lack LIM domains. For example, two transcription factors, the zinc finger GATA-1 protein and the bHLH Tal1 protein, synergize in activating transcription from a target gene when they are bridged by the LIM domains of LMO2 (![]()
![]()
![]()
![]()
Certain LIM proteins are cytoplasmic (e.g., Zyxin, CRP, CRIP, Paxillin, MLP; ![]()
![]()
![]()
-actinin-binding domain (![]()
![]()
Taken together, these in vitro studies demonstrate a role for LIM domains in the assembly of different proteins into functional transcription complexes or into higher-order components of the cytoskeleton.
Drosophila offers a unique opportunity to study the role of LIM proteins in the context of the whole organism and to identify by genetic means the proteins they interact with. Here we report the isolation of a LMO gene from Drosophila. The gene has been independently isolated by ![]()
| MATERIALS AND METHODS |
|---|
Drosophila stocks:
Strains were maintained and crosses were conducted on cornmeal-molasses medium at 25°. For egg collection, flies were transferred to bottles attached to egg-laying plates (3% Bacto-agar, 2% sugar, 1.5 g/liter methylparaben) supplemented with live yeast paste at 25°. Description of balancer chromosomes and markers can be found in ![]()
2 and C(1)DX, yf;
2 (kindly provided by W. R. ENGELS), Bx1, Bx3, Inscy w BxM, Inscy w and Df(1)N19/FM6 (provided by the Bloomington Stock Center), Bx2, and Dp(1:1)Bxr, B Bxr,car/C(1)DX, yf and C(1)DX, ywf (provided by the Mid America Stock Center). Deficiency Df(1)N19 deletes 17C1-2 to 18A1 and the cytology of Dp(1;1)Bxr is 17A1-17A4; 17E1-17F3 (![]()
P-element-induced mutagenesis:
Males from the
2 strain (![]()
2, to establish a stable stock. To avoid clusters, only one line from each bottle of the cross was subsequently used for further analysis.
Classification of the scalloped wing phenotype:
Wing margin abnormalities were routinely classified according to the number of notches at the anterior and posterior margins of the wing: rank 1, normal wings; rank 2, one to two notches at the posterior margin; rank 3, more than two notches at the posterior margin; rank 4, more than two notches at the posterior margin plus one to two notches at the anterior margin; rank 5, more than two notches at the posterior and anterior margin; rank 6, notches as in rank 5 plus blisters on the wing blade; rank 7, strap wings; rank 8, club wings (see Figure 5).
|
|
|
|
|
Standard DNA techniques:
Restriction site mapping, Southern blotting, subcloning, library screening with 32P-labeled probes, and isolation of genomic DNA were carried out essentially as described by ![]()
FIX II (Stratagene, La Jolla, CA).
PCR screen for LIM-containing genes:
Genomic DNA, a cDNA library constructed from 04-hr-old embryos (courtesy of N. BROWN), as well as cDNA generated from Canton-S embryos, larvae, pupae, or adults, were used as templates.
Partially degenerate primers were designed according to conserved amino acid sequences from the LIM domains of the Drosophila apterous gene and other LIM domain-containing proteins from vertebrates and plants (![]()
P1: 5'AGACACTGCAGCAGAAGCAGTTGACGTGAAAAAC 3'
P2: 5'AACAAGAATTCTGGCGCGCATGAC 3'
P3: 5'TGCGGCGAGCTCATC/ACAGGAC/TCGCTA/TT/CC/TTCCTC 3'
P4: 5'GCTAACCTCGAGGTAA/GTCCCGT/CTTGCA 3'
P5: 5'CGAATTCTGCG/TCCGGCTGCGGC 3'
The designed primers had the potential to amplify a single LIM domain (primer pairs P3 + P4 or P5 + P4) or tandem LIM domains (primer pairs P3 + P1, P5 + P1, P2 + P3, or P5 + P2). A variety of temperature ranges were used for annealing (37, 42, or 55°). Amplified fragments were subcloned in pBluescript and sequenced at the sequencing unit of Tel-Aviv University.
Northern analysis:
PolyA+ RNA was prepared from 04-hr-old embryos of different genotypes using the mRNA purification kit of Pharmacia (Piscataway, NJ). 32P-labeled riboprobes were synthesized using the 1.8-kb cDNA of Dlmo and rp49 as templates. Northern blots were quantified using ImageMaster DTS and ImageMaster 1D software (Pharmacia).
In situ hybridization:
In situ hybridization to larval imaginal discs was performed according to the method of ![]()
PCR analysis of mutants:
Genomic DNA was used for long and short PCR reactions. Long PCR was performed using the Expand Long Template PCR System (Boehringer Mannheim), and short PCR was performed using Taq polymerase (Appligene) according to the manufacturer's instructions. The following set of 17 primers was designed according to the sequence of the 1.8-kb cDNA of Dlmo and of adjacent genomic sequences: primer 1, nt 426; primer 2, nt 173186; primer 3, nt 360383; primer 4, nt 40114033; primer 5, nt 79101; primer 6, nt 275295; primer 7, nt 518540; primer 8, nt 649661; primer 9, nt 841860; primer 10, nt 938960; primer 11, nt 10271046; primer 12, nt 10411061; primer 13, nt 13281350; primer 14, nt 15491568; primer 15, nt 20982117; primer 16, nt 32303253; primer 17, nt 64016425.
For each primer, the position of the corresponding sequence is given according to the numbering in Figure 2 of ![]()
![]()
Two primers were designed according to 5' and 3' ends of the P element:
5' P element: 5'ATACTTCGGTAAGCTTGCGCTATC3'
3' P element: 5'CATACGTTAAGTGGATGTCTCTTG3'
PCR fragments were cloned into the pGEM-T-vector (Promega, Madison, WI), when deemed necessary, and were sequenced.
| RESULTS |
|---|
Isolation of Dlmo and the structure of its 3'UTR:
Various combinations of partially degenerate PCR primers, designed according to conserved LIM sequences, were used to amplify single or tandem LIM domains from templates of either genomic DNA, an embryonic cDNA library, or cDNA of different developmental stages of Drosophila melanogaster. One PCR-amplified fragment, produced from an embryonic cDNA template using primers P3 and P4 (see MATERIALS AND METHODS), was found upon sequencing to contain a novel LIM consensus motif. This PCR fragment was used as a probe to isolate cDNA clones from a 312-hr-old embryonic cDNA library. A 1.8-kb embryonic cDNA clone was isolated and sequenced. It was found to comprise 1798 nucleotides capable of encoding a 266-amino acids-long protein with two tandem LIM motifs and no homeodomain or any other known domain. Thus, it is a LMO protein. While this work was in progress, the same sequence was reported by ![]()
![]()
The structure of the 776-nucleotide-long 3'UTR of Dlmo has particular bearing on the analysis of mutants in this gene (described below). It contains four AT3-5A boxes, seven AT3 motifs, and several stretches of Ts, the longest of which is T12, collectively referred to as ARE (see Figure 1), which in various eukaryotic genes increase destabilization of the transcript (![]()
![]()
Bx mutations affect the 3'UTR of Dlmo:
The 1.8-kb Dlmo cDNA was used as a probe to isolate genomic clones from a
FIX Drosophila genomic library. Three partially overlapping clones were isolated. In situ hybridization to polytene chromosomes using the 1.8-kb Dlmo cDNA as a probe indicated that the gene maps to band 17C on the X chromosome (data not shown). This is in accord with the mapping by ![]()
![]()
![]()
![]()
Several genes are known to reside in the 17BC region (FlyBase; ![]()
![]()
![]()
The inserts in the Bx mutations analyzed disrupt the 3'UTR of Dlmo. We hypothesize that these mutations may exert their phenotypic effect by interfering with the function of the putative negative regulatory motifs present in the 3'UTR, resulting in overexpression of the Dlmo transcript. A critical prediction of this hypothesis is that removal of these motifs from the 3'UTR of Dlmo would result in a mutant phenotype characteristic of insertional Bx mutations.
To produce deletions in Dlmo that might result in Bx-like wing scalloping, and in the hope of generating new hdp-a mutations, we mobilized P elements in the wild-type
2 strain by hybrid dysgenesis. This strain contains multiple copies of P element, one of which maps to 17C2-3 (![]()
2 has been shown to be an effective means for producing Bx and heldup mutants (![]()
![]()
![]()
2 resides 707 bp downstream of the 3' end of our cDNA, suggesting that deletions extending into Dlmo could be generated by imprecise excision of this P element.
Generation and characterization of new Bx mutants:
Males from the
2 strain were crossed to M cytotype C(1)DX, y w f females. The resulting dysgenic sons were crossed to Df(1)N19/FM6 females (Figure 4, Cross A), and the ~60,000 FM6-bearing female progeny were screened for wing scalloping. To identify which of these may be Bx mutants, we used the following two criteria: (1) Wing scalloping in Bx mutants is suppressed when combined with a deletion of the 17BC chromosomal region. Flies heterozygous for such a deletion, e.g., Df(1)N19, have normal wings. (2) Bx wing scalloping is augmented when combined with a chromosome carrying a duplication of the normal 17BC region. Flies heterozygous for such a duplication, e.g., Dp(1;1)Bxr, have normal wings and rarely display very mild scalloping (![]()
|
All 17 new Bx mutants are homozygous viable. The degree of wing scalloping varied between the different mutants, and they are listed in Table 1 in their order of severity. In each mutant, scalloping was more pronounced in the homozygotes than in the heterozygotes. We have classified scalloping according to its severity, where rank 1 is normal wing and rank 8 is a nearly strap-like wing (Figure 5; Table 1). We find that a population of flies carrying any Bx allele displays a characteristic distribution of severity ranks of wing scalloping. Suppression of scalloping in Bx/Df(1)N19 was therefore recognizable as a shift in the distribution of the wing phenotypes toward the less severe ranks, as compared to Bx/+ (Figure 6). The suppressed phenotype appeared to be directly correlated to the severity of scalloping caused by the original Bx mutation. The milder the original scalloping was, the closer the suppressed phenotype was to wild-type wings (Table 1; Figure 6). Suppression was therefore barely noticeable for the mildest mutants, such as Bx120-4-1, but was very conspicuous in more severe mutants, such as Bx3, Bx10-5-2, and Bx4-5 (Figure 6). Likewise, augmentation of any Bx allele by Dp(1;1)Bxr was evident as a shift of the wing phenotypes toward the more severe ranks (Table 1; Figure 6). Here, too, the resulting phenotype appeared to be directly correlated to the severity of scalloping caused by the original mutation, and augmentation of scalloping was readily observed, even in the mildest mutants. For example, marked augmentation of wing scalloping is seen for Bx3 and the newly induced Bx alleles Bx120-4-1 and Bx4-5, but it is less evident for Bx10-5-2.
|
These observations suggest that Bx mutations are hypermorphs and that the degree of severity of the Bx-engendered wing scalloping depends on the quantity of a certain gene product (see also ![]()
Molecular analysis of Bx mutants:
PCR and Southern analyses were performed on genomic DNA of 11 out of the 17 newly induced Bx mutants. Genomic DNA from the
2 strain, used for generating these mutants, served as a control. The primers used for these reactions were designed according to sequences from the cDNA of Dlmo and from genomic sequences flanking the site of insertion of the 17C2-3 P element in
2 (see Figure 2B and MATERIALS AND METHODS for exact location of the primers).
Interestingly, this analysis provides evidence that 8 of the 11 newly induced Bx mutants examined have lesions confined to the 3'UTR of Dlmo and the downstream flanking genomic sequences. For example, the mutants Bx4-5 and Bx110-4-1 amplified fragments that are 1 and 0.6 kb long, respectively, when using primer pair 14 + 16, while the
2 control gave a 4.5-kb fragment, suggesting they have deletions in the region delimited by these primers (Figure 7). Likewise, the mutant Bx10-5-2 amplified a fragment 0.8 kb long when using primer pair 11 + 16, as compared to 5.2 kb in the control, suggesting it has a deletion in the region between their corresponding genomic sequences (Figure 7). In the mutants Bx17-8-1 and Bx113-4-1, the primer pair 14 + 17 amplified fragments 2.5 and 1.8 kb long, respectively, while the corresponding control fragment is 7.7 kb long. Given that the
2 strain has a 2.9-kb P element inserted 0.7 kb downstream of Dlmo (Figure 2A; ![]()
|
To get a more accurate estimate of the extent of the deletions, we cloned and sequenced the PCR fragments of the mutants Bx4-5 and Bx110-4-1 amplified using primer pair 14 + 16, and the fragment of Bx10-5-2 amplified using primer pair 11 + 16 (Figure 7). Sequence analysis has confirmed that the deletion in each of these mutants extends from the site of the P-element insertion in the
2 strain, removing the P element entirely, into the 3'UTR of Dlmo. The portion of the 3'UTR sequences deleted is different in the three mutants. In Bx4-5, the last 226 bp of the 3'UTR of Dlmo are missing, including one ATTTA motif, the T stretch, and one Brd-like box (Figure 1). In Bx110-4-1, an additional 126 bp have been deleted from the 3'UTR, removing all ARE motifs and four Brd-like boxes (Figure 1). In Bx10-5-2, the deletion is larger, leaving only the first 107 bp of the 3'UTR and removing all the putative negative regulatory elements present in the 3'UTR of Dlmo (Figure 1). Taken together, the PCR and sequence analyses of these Bx mutants support the hypothesis that the Bx mutant phenotype results from abrogation of the 3'UTR of Dlmo. Interestingly, the extent of the deleted segment from the 3'UTR of Dlmo in these mutants is directly correlated with the severity of their wing scalloping, where Bx10-5-2 has the most severe phenotype, Bx110-4-1 is less severe, and Bx4-5 is the mildest of the three (Table 2). In addition, the 3'UTR DNA lesions in Bx110-4-1 and Bx10-5-2 differ only in that the former lacks an additional Brd-like box. This may provide functional evidence that Brd-like boxes in Dlmo have a negative regulatory role.
|
The PCR products amplified from the mutants Bx122-3-1 and Bx120-4-1 using primer pair 11 + 15 (8 and 4 kb, respectively) were longer than the corresponding fragment in
2 (1 kb, Figure 7), indicating that sequences ~7 and 3 kb long, respectively, have inserted into the fifth exon of the Dlmo gene in each of these mutants. Because the PCR product of primer pairs 14 + 15 and 11 + 13 in these mutants has the same size as in the control (Figure 7), we deduce that the inserts in these two mutants are localized to the 179-bp region between the sequences corresponding to primers 13 and 14, in the 5'-most portion of the 3'UTR of Dlmo (Figure 1 and Figure 2C).
To further characterize the insertions in these two mutants, we used primers designed according to the 5' and 3' ends of the P-element sequences, in combination with primer 11 (Figure 2B; see MATERIALS AND METHODS). The combination using the 5' primer of the P element yielded fragments of 2 kb in the mutant Bx122-3-1 and of 0.5 kb in the mutant Bx120-4-1. These findings support the conclusion that in both mutants, the insertion was in the interval mentioned above. In the mutant Bx122-3-1, the insertion consists of an excised P element with 1.7 kb of flanking genomic sequences at its 5' end and 2.5 kb of flanking genomic sequences at its 3' end (Figure 2C). In mutant Bx120-4-1, the insertion consists of the P-element sequences only (Figure 2C).
In addition, no fragment was amplified using primer pair 14 + 16 in these two mutants. On the other hand, normal size fragments were amplified from their DNA using either primer pair 14 + 15 or the primer pairs located upstream to them. This suggests that in addition to the insertion, they have lesions removing sequences downstream of Dlmo, leaving its coding region intact (Figure 2C).
The mutants Bx3-5-4, Bx16-7, and Bx111-1-8 had no visible difference from the control
2 strain in all primer pairs used. Because of the limited resolution of the PCR technique, we cannot exclude the possibility that they have small lesions in the Dlmo gene that are responsible for their wing scalloping. This should be resolved by sequencing.
Dlmo expression is affected in Bx mutants:
Northern analysis of poly(A)+ RNA extracted from 04-hr-old embryos of several Bx mutants (Bx1, Bx2, Bx3, and BxM) and a control strain (Canton-S) was performed using the 1.8-kb cDNA of Dlmo as a probe. A 2.0-kb transcript exists in the control strain, while all Bx mutants examined have a truncated transcript that is ~0.5 kb shorter (Figure 8A). The longer transcript in Bx2 may be the result of transcription termination within the gypsy element (see DISCUSSION).
|
To correct for the amounts of poly(A)+ RNA loaded in each lane, the membrane was rehybridized with a probe of the ribosomal protein RP49. Scanning for quantification of the Dlmo RNA and the rp49 RNA and normalizing for RNA loading indicated that the Dlmo transcript is overexpressed (two- to fourfold) in the Bx mutants as compared to the wild-type strain (Figure 8B).
Because the Bx phenotype is manifested in the wing, we compared the expression of Dlmo in the wing imaginal discs of Bx3/Bx3 and the wild-type Canton-S. The overexpression of Dlmo observed in the mutant embryos (Figure 8A and Figure B) is also evident in their discs (Figure 8C), which display stronger staining.
Generation and characterization of hdp-a mutants:
All hdp-a mutants that have been generated previously were lost. The fact that hdp-a mutants suppress the wing scalloping phenotype of Bx mutants (![]()
Two phenotypic criteria were used to identify recessive hdp-a mutants: (1) uncovering of the hdp-a mutation by Df(1)N19 and (2) the ability of hdp-a mutants to suppress the dominant wing scalloping of Bx. These two strategies were used to screen for hdp-a mutants.
Strategy 1: Approximately 30,000 Df(1)N19-carrying female offspring from Cross A were screened for the erect wing phenotype (Figure 4). Six such independent mutants were recovered, and they were subsequently confirmed to be X-linked, recessive, and homozygous viable. We crossed the six erect wing mutants to Bx3 and observed amelioration of wing scalloping in the female offspring of four (hdp-a7-5-4, hdp-a115-5-1, hdp-a19-4-1, and hdp-a13-7-13, Table 3). These four mutants do not complement each other, and all transheterozygous combinations of them display erect wings. These results suggest that these four mutants represent lesions in the hdp-a gene.
|
Strategy 2: Dysgenic males were crossed to Bx3/Bx3 females, and their female offspring were scored for suppression of the dominant wing scalloping (Figure 4, Cross B). Approximately 10,500 chromosomes were screened, and 20 such independent, X-linked Bx suppressors were isolated. These could correspond to lesions in hdp-a or in other second-site Bx-suppressor genes. Four of the Bx suppressors (hdp-a32-4-14, hdp-a26-3-7, hdp-a128-1-5, and hdp-a28-3-3) also have a recessive erect wing phenotype that is uncovered by Df(1)N19. These results suggest that they have lesions in hdp-a. All four mutants do not complement each other for the erect wing phenotype, nor do they complement the four hdp-a mutants generated in strategy 1. We conclude that these four Bx suppressors are hdp-a alleles, comparable to the hdp-a mutants generated in strategy 1.
Ranking the severity of the erect wing phenotype in these eight hdp-a mutants was difficult. The severity of the hdp-a mutants was easier to measure by determining the extent of their suppression of the wing scalloping of Bx mutants. The different degrees of severity of the eight hdp-a mutants, using this criterion, are depicted in Table 3. These hdp-a mutants also suppress the wing scalloping of the 17 newly generated Bx mutants (see Table 1 for suppression of the new Bx alleles by hdp-a32-4-14), supporting the conclusion that they are indeed new Bx alleles.
Based on the degree of suppression of Bx3, the hdp-a32-4-14 allele is the most severe hdp-a allele in our collection.
hdp-a mutants represent loss of function of Dlmo:
Given the close proximity of Bx and hdp-a mutations on the genetic map (0.0045 map units, ![]()
PCR analysis was performed on the hdp-a32-4-14 allele, which was shown to suppress completely the wing scalloping phenotype of Bx3 using primer pairs covering the entire Dlmo transcript (Figure 2B). All primer pairs corresponding to exons Ia, II, Ib, III, and IV amplified fragments identical in size to those amplified in the parental strain
2 (data not shown). When primer pairs designed according to sequences corresponding to exon V were used, however, no amplified fragments were obtained. These results indicate that exon V was entirely absent in this hdp-a mutant, resulting in the loss of approximately half of the coding sequence of Dlmo, including part of the second LIM domain (Figure 2C). Another PCR reaction using primer 16, which is located downstream of the insertion site of the P element, in combination with primer 9, located in exon IV, indicated that the deletion in this mutant extends beyond the insertion site of the P element (Figure 2C).
Additional evidence supporting this conclusion was obtained from Southern analysis of hdp-a32-4-14 using either the 1.8-kb cDNA of Dlmo or a genomic 5.9-kb SacI fragment as a probe (Figure 2A).
Thus, the loss-of-function nature of the hdp-a32-4-14 mutation results from disruption of the coding region of Dlmo. This result, combined with the overexpression of Dlmo in Bx mutants, provides molecular grounds for explaining the phenotypic interaction between Bx and hdp-a mutations.
Dlmo interacts genetically with ap and Chip:
The LIM motifs in LIM proteins function in protein-protein binding and, in some cases, mediate LIM-LIM interaction between different LIM proteins (![]()
![]()
![]()
|
Double heterozygotes for overexpression mutations of Dlmo and for loss-of-function mutations of ap exhibit abnormal wing morphology markedly different from the phenotype of either of the two mutants alone. For example, slight overexpression of Dlmo combined with an ap mutation results in conspicuous augmentation of wing scalloping (Dp(Dlmo)/+; ap56f/+, rank 3, vs. Dp(Dlmo)/+, rank 12). Further increase in overexpression of Dlmo in ap heterozygotes leads to dramatic enhancement of wing scalloping (Bx3/+; ap56f/+, rank 56). The synergistic effect of Bx and ap mutations suggests that Dlmo and ap interact during wing development.
We further examined how manipulation of the levels of these gene products affects the wings. Heterozygotes for loss of function of both Dlmo and ap have normal wings (Df(Dlmo/+; ap56f/+, rank 1). Likewise, elevated levels of ap+ [e.g., three doses in Dp(ap+)/+ or four doses in Dp(2;Y)C; Dp(2;2)41A/+] do not affect wing morphology (rank 1, Table 4; M. SHORESH and D. SEGAL, unpublished observations, respectively). However, when combined with slight or marked overexpression of Dlmo, the elevated levels of ap+ augment the wing scalloping of Bx [e.g., Dp(Dlmo)/+; Dp(ap+)/+, rank 6, and Bx3/+; Dp(ap+)/+, rank 67]. These results corroborate the conclusion that Dlmo and ap interact during wing development, and they imply that this interaction is sensitive to the dosage of their gene products.
In vertebrates, the NLI protein (also called Ldb1) has been shown to mediate the binding of LIM proteins to various transcription factors (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
These phenotypic interactions indicate that ap, Dlmo, and Chip share a role in the regulation of wing margin development in Drosophila. The in vitro binding of AP and CHIP and the analogy to their vertebrate counterparts collectively suggest that these three proteins form a DNA-binding complex regulating wing-specific genes.
| DISCUSSION |
|---|
LIM-containing genes in Drosophila:
The Dlmo gene belongs to a growing family of animal and plant genes encoding LIM proteins. LIM proteins have key roles in diverse processes during development and differentiation (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Dlmo is the sole LMO gene identified so far in Drosophila (![]()
![]()
![]()
![]()
![]()
Negative regulatory elements in the 3'UTR of Dlmo:
The 3'UTR of Dlmo contains multiple AREs and five Brd-like boxes. AREs are found in the 3'UTR of many mRNAs that code for proto-oncogenes, nuclear transcription factors, and cytokines (for reviews see ![]()
![]()
![]()
![]()
![]()
In addition to the AREs, the 3'UTR of Dlmo contains five heptanucleotide AGTTTTA sequence motifs that are closely related to the AGCTTTA motif, termed Brd box, found in the 3'UTR of the Bearded (Brd) gene and in many genes involved in Notch signaling during cell fate specification in the adult peripheral nervous system of Drosophila (![]()
![]()
![]()
Bx lesions abrogate negative regulatory elements in the 3'UTR of Dlmo:
The results presented in this article demonstrate that the genetically defined Bx locus corresponds to the 3'UTR of Dlmo. Insertion of a P element or a retrotransposon in the 3'UTR of Dlmo can result in a dominant wing scalloping phenotype similar to that caused by removal of most or all the AREs and Brd-like boxes in the 3'UTR. We therefore surmise that the insertions into the 3'UTR of Dlmoby retrotransposons or P elements or by deletion of parts of the 3'UTR of Dlmosimilarly abrogate the negative regulatory effect of the ARE and Brd-like motifs. Consequently, the level of the Dlmo transcript in the Bx alleles examined is two- to fourfold higher than that of the wild type, as expected if the ARE and Brd-like boxes had an RNA-destabilizing effect (![]()
![]()
Similar effects of transposon insertions on 3'UTR negative regulatory motifs have been reported for two other mutants in Drosophila. The dominant gain-of-function mutation SerD in the Serrate (Ser) gene results from insertion of the Tirant retrotransposon in the 3'UTR of Ser, causing termination of the transcript in SerD within the transposon's long terminal repeat, at a AAUAAA hexanucleotide that probably serves as a polyadenylation signal (![]()
![]()
A second example is the insertion of the blood retrotransposon in the 3'UTR of the Brd gene, which causes a dominant gain-of-function phenotype (![]()
![]()
The Dlmo transcript in Bx1, Bx2, Bx3, and BxM is ~0.5 kb shorter than in the wild type. Insertion of various retrotransposons, including copia and gypsy, in different genes in Drosophila causes premature termination of transcription of the host gene (for a review see ![]()
![]()
![]()
2 strain, it is possible that Dlmo transcription terminates in sequences that are centromere proximal to this site. Indeed, we find that a polyadenylation signal resides 380 nucleotides downstream of the P-insertion site in
2.
Overexpression of Dlmo causes wing scalloping:
The Bx wing scalloping can be brought about by supernumerary copies of the normal 17BC chromosomal region, each likely having the normal Dlmo gene along with its control regions. This suggests that the abnormal wing morphology results from overexpression of the gene in those cells in which it is normally expressed, albeit at lower levels, rather than from spatial or temporal misexpression. A similar wing scalloping is brought about by Bx mutations that cause overexpression of the Dlmo gene. Therefore, we assume that Dlmo is expressed under its normal spatial-temporal control in these mutants also. This assumption is corroborated by the similar pattern of distribution of the Dlmo transcript in wild-type and Bx mutant imaginal discs, except that in the latter, the level of the transcript appears elevated. Thus, the scalloped wing phenotype is exclusively the result of disruption or deletion of the 3'UTR of the gene. Because wing scalloping is the only overt mutant phenotype in Bx mutants, whether heterozygous or homozygous, the overexpression of Dlmo apparently does not interfere with functions in which the Dlmo product may participate in cells, other than those at the wing margin. It will be interesting to examine the consequences of directed misexpression of Dlmo in cells or stages where it is not normally expressed because LMO proteins serve as bridges between different proteins (![]()
![]()
![]()
heldup-a mutations correspond to loss-of-function of Dlmo and interact with Bx:
Recessive hdp-a mutations have been genetically mapped to close proximity (0.0045 map units) centromere distal of Bx mutations. Furthermore, hdp-a mutations have been reported to suppress in one dose the dominant wing scalloping of Bx mutations either in cis or in trans (![]()
![]()
![]()
![]()
2, removing the 0.4-kb fragment to which Bx mutations have been mapped and extending upstream of it. Comparison to the map of Dlmo suggests that the deletion in hdp-aD30r has removed part of the coding region of Dlmo. Loss of function of Dlmo could be also caused by mutations disrupting the promoter region of the gene.
Assuming that hdp-a mutations cause loss of the functional Dlmo product, we can explain in molecular terms the suppression of the Bx dominant wing scalloping by recessive hdp-a mutations. We propose that in Bx mutants, the Dlmo product is overexpressed because of abrogation of the negative control elements in its 3'UTR. Likewise, duplications of the normal 17BC region result in excess of the Dlmo protein, causing in turn a scalloping phenotype comparable to that of Bx mutants. When either of these duplications or Bx mutations are combined with a deletion of the chromosomal 17BC region or with hdp-a mutations, which likely cause loss of function of Dlmo protein, the net amount of the Dlmo product is reduced to approximately the wild-type level, resulting in normal wing morphology.
The anatomical cause for the erect wings in hdp-a mutants is unknown at this time. Mutations in many genes in Drosophila affect wing posture. Most of them affect either components of the wing muscles or their innervation (reviewed in ![]()
![]()
![]()
![]()
The mutant phenotypes of lesions in the Dlmo gene involving wing margin defects and abnormal wing posture, as well as the limited information we have about the spatial distribution of its transcript in the wing imaginal discs and embryonic CNS, suggest that this LMO protein participates in diverse processes during development and differentiation of Drosophila. In this respect, it resembles its vertebrate homologs, which are expressed in the embryonic CNS and in the hematopoietic system and are involved in a multitude of processes during animal development (![]()
![]()







