IDT. Quality oligos. Every time.

Genetics, Vol. 150, 129-155, September 1998, Copyright © 1998

Two Pleiotropic Classes of daf-2 Mutation Affect Larval Arrest, Adult Behavior, Reproduction and Longevity in Caenorhabditis elegans

David Gems1,a, Amy J. Suttona, Mark L. Sundermeyera, Patrice S. Alberta, Kevin V. Kinga, Mark L. Edgleya, Pamela L. Larsena,b, and Donald L. Riddlea
a Molecular Biology Program and Division of Biological Sciences, University of Missouri, Columbia, Missouri 65211
b Division of Neurogerontology and Molecular Biology Program, University of Southern California, Los Angeles, California 90089

Corresponding author: Donald L. Riddle, Molecular Biology Program, 311 Tucker Hall, University of Missouri, Columbia, MO 65211., riddled{at}missouri.edu (E-mail).

Communicating editor: I. GREENWALD


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The nematode Caenorhabditis elegans responds to overcrowding and scarcity of food by arresting development as a dauer larva, a nonfeeding, long-lived, stress-resistant, alternative third-larval stage. Previous work has shown that mutations in the genes daf-2 (encoding a member of the insulin receptor family) and age-1 (encoding a PI 3-kinase) result in constitutive formation of dauer larvae (Daf-c), increased adult longevity (Age), and increased intrinsic thermotolerance (Itt). Some daf-2 mutants have additional developmental, behavioral, and reproductive defects. We have characterized in detail 15 temperature-sensitive and 1 nonconditional daf-2 allele to investigate the extent of daf-2 mutant defects and to examine whether specific mutant traits correlate with each other. The greatest longevity seen in daf-2 mutant adults was approximately three times that of wild type. The temperature-sensitive daf-2 mutants fell into two overlapping classes, including eight class 1 mutants, which are Daf-c, Age, and Itt, and exhibit low levels of L1 arrest at 25.5°. Seven class 2 mutants also exhibit the class 1 defects as well as some or all of the following: reduced adult motility, abnormal adult body and gonad morphology, high levels of embryonic and L1 arrest, production of progeny late in life, and reduced brood size. The strengths of the Daf-c, Age, and Itt phenotypes largely correlated with each other but not with the strength of class 2-specific defects. This suggests that the DAF-2 receptor is bifunctional. Examination of the null phenotype revealed a maternally rescued egg, L1 lethal component, and a nonconditional Daf-c component. With respect to the Daf-c phenotype, the dauer-defective (Daf-d) mutation daf-12(m20) was epistatic to daf-2 class 1 alleles but not the severe class 2 alleles tested. All daf-2 mutant defects were suppressed by the daf-d mutation daf-16(m26). Our findings suggest a new model for daf-2, age-1, daf-12, and daf-16 interactions.


THUS far, C. elegans is the only metazoan organism in which a number of single gene mutations causing large increases in life span have been identified. These genes include daf-2 (KENYON et al. 1993 Down) and age-1 (FRIEDMAN and JOHNSON 1988 Down), formerly also known as daf-23 (MALONE et al. 1996 Down; MORRIS et al. 1996 Down; TISSENBAUM and RUVKUN 1998 Down). These mutations result in mean life spans of up to 250 and 300% of wild type, respectively (LARSEN et al. 1995 Down). Both genes also control dauer larva formation (RIDDLE 1988 Down; GOTTLIEB and RUVKUN 1994 Down).

Dauer larvae are nonfeeding, developmentally arrested, alternative third-stage larvae, which form in response to crowding and reduced food supply (CASSADA and RUSSELL 1975 Down; GOLDEN and RIDDLE 1984A Down). A constitutively released dauer-inducing pheromone serves as a measure of population density. A low pheromone:food ratio and low temperature promote continuous development through four larval stages (L1–L4) to the adult, but high pheromone levels and higher temperatures promote dauer formation and inhibit exit from the dauer state. Under the latter conditions, L1 larvae molt to a predauer (d) L2d stage, which lasts longer than the L2 (GOLDEN and RIDDLE 1984A Down). L2ds retain the developmental potential to molt to the L3 should conditions improve, but if they do not, they molt into the dauer stage, shrink radially, and become resistant to detergent treatment and other environmental insults.

Dauer larvae are long lived relative to the adult, with maximum life spans of around 70 days (KLASS and HIRSH 1976 Down) and 30 days (JOHNSON and WOOD 1982 Down), respectively, in liquid culture. Dauer larvae are considered nonaging because the length of time spent in the dauer stage has no effect on postdauer life span (KLASS and HIRSH 1976 Down). The basis for the enhanced longevity of dauer larvae is unknown. However, evidence suggests that a reduction in metabolic activity occurs, consistent with long-term survival in the absence of food (O'RIORDAN and BURNELL 1989 Down; WADSWORTH and RIDDLE 1989 Down), and although capable of rapid movement, dauer larvae are largely inactive. Dauer longevity may also be enhanced by increased resistance to stress. Dauer larvae show enhanced resistance to thermal injury (ANDERSON 1978 Down) and to oxidative damage-inducing chemicals (LARSEN 1993 Down). They also show increased activities of superoxide dismutase (ANDERSON 1982 Down; LARSEN 1993 Down) and catalase (VANFLETEREN and DE VREESE 1995 Down) relative to adults.

Over 30 genes controlling dauer larva formation have been identified. Mutations in these daf genes result in either the inability to form dauer larvae in response to crowding and starvation (dauer-defective, or Daf-d), or the constitutive formation of dauer larvae in the presence of abundant food (dauer-constitutive, or Daf-c). Studies of the phenotypes resulting from combinations of daf-c and daf-d mutations have allowed the daf genes to be ordered into complex, branched pathways (reviewed by RIDDLE and ALBERT 1997 Down). Mutations in one branch of the pathway (age-1, daf-2, daf-16, and daf-18) affect both dauer larva formation and adult life span (KENYON et al. 1993 Down; LARSEN et al. 1995 Down; DORMAN et al. 1995 Down). All daf-2 and most age-1 mutants are Daf-c and may be involved in transduction of environmental information via the nervous system or by some other route. The age-1 gene encodes a putative phosphatidylinositol 3-OH kinase catalytic subunit (MORRIS et al. 1996 Down). PI 3-kinases typically transmit signals from cell-surface receptor tyrosine kinases into the cell (KAPELLER and CANTLEY 1994 Down). The daf-2 gene encodes a receptor tyrosine kinase similar to the vertebrate and Drosophila insulin receptors (KIMURA et al. 1997 Down).

Adult expression of functions normally expressed in the dauer stage may account for the increased longevity (Age) of daf-2 (KENYON et al. 1993 Down) and age-1 adults. The Age phenotype requires daf-16 activity because a daf-d mutation in this gene suppresses the enhanced longevity resulting from mutations in daf-2 (KENYON et al. 1993 Down) or age-1 (LARSEN et al. 1995 Down; DORMAN et al. 1995 Down). The daf-16 gene encodes a Fork head-related transcription factor (OGG et al. 1997 Down; LIN et al. 1997 Down). The establishment of a causal link between misexpression of a particular dauer trait in the adult and extension of adult life span would be illuminating with respect to the nature of the biological determinants of life span.

Previous comparisons between the canonical allele, daf-2(e1370), and other daf-2 alleles have revealed considerable variation in the daf-2 mutant phenotype. For example, the phenotypes of daf-2(e1370) and daf-2(m41) differ with respect to temperature dependence of the Age phenotype, effects on fecundity, and interactions with mutations in the daf-d gene daf-12 (LARSEN et al. 1995 Down). The daf-2(e979) mutation results in embryonic and L1 arrest (VOWELS and THOMAS 1992 Down).

To better understand daf-2 function, we have conducted a detailed phenotypic study of 16 mutant alleles. We have focused, in particular, upon the range of effects on life span, how the severity of other mutant traits correlates with the degree of life span extension, and how different daf-2 alleles interact with daf-12 to affect both dauer larva formation and life span. Our results reveal the existence of two overlapping classes of daf-2 allele, differing both in their mutant phenotypes and in their interactions with daf-12. Class 1 mutants display Daf-c, Age, and increased intrinsic thermotolerance (Itt) phenotypes. Class 2 mutants are more pleiotropic, exhibiting the class 1 defects, in addition to other developmental and behavioral defects, and resembling severe age-1 mutants with respect to their larval arrest phenotype and interactions with daf-12 (GOTTLIEB and RUVKUN 1994 Down; LARSEN et al. 1995 Down). Defects resulting from both mutant classes are suppressed by daf-d mutations in daf-16, whereas mutations in daf-12 suppress the class 1 Daf-c and Age phenotype but not the class 2 mutants we tested. Our findings clarify the relationship between daf-2, age-1, daf-12, and daf-16 in the genetic pathway controlling dauer formation and life span.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Culture methods and strains:
Animals were maintained monoxenically in 60-mm Petri dishes containing 10 ml NG agar seeded with Escherichia coli OP50 as the food source (BRENNER 1974 Down). The daf-2 mutations used in this study were e979, e1365, e1368, e1369, e1370, e1371, e1391, m41, m65, m120, m212, m577, m579, m596, m631, m632, sa193, and sa223. Other mutations used were LG I, daf-16(m26); LG III, dpy-1(e1), mec-12(e1605), unc-32(e189), unc-93(e1500); LG V, dpy-11(e224); and LG X, daf-12(m20). The daf-2(sa193) and daf-2(sa223) strains were provided by J. H. THOMAS. In VOWELS and THOMAS 1992 Down, daf-2(e979) was referred to as daf-2(e1286) (J. H. THOMAS, personal communication).

All alleles were backcrossed to the Caenorhabditis Genetics Center wild-type (N2) male stock at least three times to remove possible second-site mutations. Because most strains had previously been backcrossed once or twice, it was necessary to perform one or two further backcrosses. The twice backcrossed sa223 strain was backcrossed two more times only after its detailed characterization, but tests on dauer larva formation and life span indicated that the four-times backcrossed strain was indistinguishable from the strain originally received.

Construction of daf-2; daf-12 double mutants:
In the case of ts daf-2 alleles, daf-2; daf-12 double mutants were constructed as previously described (LARSEN et al. 1995 Down). The daf-2(m65) III mutation results in nonconditional dauer larva formation. Consequently, the construction of the double mutant carrying daf-12(m20) X used qC1 [dpy-19(e1259ts) glp-1(q339)] III to balance m65. daf-2(m65)/qC1 males were mated with daf-12(m20) hermaphrodites at 20°, and the F1 males were backcrossed with balanced daf-2 hermaphrodites. F1 hermaphrodites were selfed individually at 15° to identify cross progeny of genotype m65/qC1; m20/+ based on the segregation of dauer larvae (m65), sterile adults defective in germline proliferation (Glp) (qC1), and longer animals (some m20 homozygotes are longer than wild type). Also observed among the segregants were dark-bodied animals that exhibited a novel developmental arrest phenotype (see RESULTS). A long segregant was used to establish the daf-2(m65)/qC1; daf-12(m20) strain.

Construction of daf-2(m65) unc-32(e189)/qC1 strain:
dpy-1(e1) unc-32(e189)/++ males were crossed with daf-2(m65)/qC1 hermaphrodites, and F1 hermaphrodites were selfed. Two of 12 F1s segregated dauer larvae and Dpy Unc (dumpy, short body; uncoordinated movement) animals. Ten Unc non-Dpy F2s were selfed, seven of which segregated Unc dauer larvae and Dpy Uncs (i.e., were + daf-2 unc-32/dpy-1 + unc-32). Unc non-Dpy F3 hermaphrodites were crossed with N2 males, progeny males were crossed with daf-2(m65)/qC1, hermaphrodite progeny were selfed, and a daf-2 unc-32/qC1 strain was identified as one segregating Unc dauer and Dpy Glp progeny at 20°.

Construction of heteroallelic strains:
To test the possible dominance of daf-2(e979), a daf-2(e979)/daf-2(m577) strain was constructed as follows. e979/+ males were crossed with m577 hermaphrodites at 22.5°, at which temperature m577 homozygotes do not form dauer larvae. Dauer progeny were picked and allowed to recover at 15°. Approximately half proved to be male, confirming that such dauer progeny resulted from crossing. For progeny testing at 25.5°, dauer larvae that recovered to adult hermaphrodites were allowed to lay eggs for 24 hr, then removed. Progeny were scored after 72 hr of development (measured from the middle of the 24-hr egg-laying period).

Animals heteroallelic for different combinations of ts daf-2 alleles and nonconditional daf-2 alleles were constructed to examine the 25° phenotype of nonconditional segregants in the absence (or severe reduction) of maternal rescue. To construct daf-2(m65) unc-32(e189)/daf-2(m577) +, daf-2(m65) unc-32/qC1 males were crossed with daf-2(m577) hermaphrodites at 22.5°. Since m577 does not result in dauer formation at 22.5°, dauer progeny were necessarily daf-2(m65) unc-32/daf-2(m577) +. They were induced to resume development by transfer to 15°.

The phenotypes of daf-2(m65)/daf-2(e979), mDf12/daf-2(e979), and mDf12/mDf11 at 25.5° were determined by scoring brooded cross plates 2, 3 and, if necessary, 4 days after the parental animals were transferred to fresh plates. daf-2(m65)qC1 or mDf12/qC1 males were mated to either daf-2(e979) or mDf11/qC1 hermaphrodites at 25.5°. The number of self-progeny was minimized by mating 10 adult males with two L4 hermaphrodites on plates with a 1-cm-diameter spot of bacteria.

Dauer formation, predauer arrest, and brood size assays:
The effects of daf-2 mutations on brood size, dauer formation, and early larval arrest were examined at 15°, 20°, 22.5°, and 25°. Gravid adults (10–20) grown at 15° were allowed to lay eggs for 1 hr, then removed. The resulting synchronous population was raised at 15° until the late L4 stage. Ten animals were placed singly on plates and shifted to the assay temperature. These P0 animals were transferred to new plates every 24 hr until the end of the reproductive period. Each brood plate was examined daily to follow development to a terminal phenotype. Any adults or L4 larvae were counted and removed. The number of dauer progeny was scored 72 hr after the midpoint of egg laying at 25.5°, 80 hr at 22.5°, 96 hr at 20°, and 120 hr at 15°. Samples compromised by fungal or bacterial contaminants were excluded. In the case of daf-2(sa223), maternally rescued adults were picked from among progeny of daf-2(sa223)/qC1 hermaphrodites. Although these sa223 progeny often arrested development as L3s, L4s, or adults (exhibiting darkness of body, reduced motility, and reduced gonad development), a number of adult sa223 homozygotes developed gonads, and these were picked for brood-size analysis.

In studies of larval development of daf-2; daf-12 strains, groups of gravid hermaphrodites raised at 15° were allowed to lay eggs overnight (5–6 animals, 22.5°) or for 4 hr (10–15 animals, 25.5°), then removed. At 22.5°, the appearance of larvae was checked 60 hr after the midpoint of egg laying and scored after 80 hr. At 25.5°, the appearance of larvae was checked after 50 hr. Progeny were intermittently observed and scored between 50 and 100 hr after the midpoint of egg laying.

Life span determination:
L4 larvae grown at 15° were placed at 15° and 22.5°, typically at a density of 15–30 animals per plate. These were transferred daily to fresh plates during the egg-laying period and subsequently at approximately weekly intervals. Death was scored as the absence of any movement and failure to move at all after several light pokes with a platinum wire. The zero time point was the time of L4 transfer. Samples compromised by bacterial contaminants were excluded. Life span was assayed at 22.5° rather than the usual nonpermissive temperature of 25.5°, at which a high level of mortality is seen throughout adult life in some daf-2 mutants due to internal hatching of eggs and other unknown causes that may not be related to senescence. It was expected that at 22.5°, population survival curves would be more rectangular and show less variation between trials, facilitating comparisons between strains.

Intrinsic thermotolerance assays:
Young adult hermaphrodites grown at 15° were transferred to prewarmed (35°) 60-mm NG agar plates (not spread with bacteria) and maintained at that temperature. The number of worms dead and alive was recorded at 2-hr intervals until all were dead. Any worms that died as the result of crawling up the wall of the plate were excluded from the analysis.

Intrinsic thermotolerance of selected daf-2(class 2); daf-12 double mutants was determined in the same manner. However, to test the effect of daf-12 on certain class 1 alleles, the procedure was modified to increase the thermotolerance of the daf-2 adults. Synchronous populations were raised to adult at 20°, then transferred to fresh plates at 25° for 2 days before testing, as described above. To compensate for the slower development of the class 1 m41 mutant and the class 2 e1391 mutant, populations of strains containing these alleles were started 1 day earlier.

Adult behavior and morphology:
During the course of life span assays, behavior and appearance of adult animals were examined at 1- to 3-day intervals through a dissecting microscope. At higher temperature several alleles resulted in some shrinkage of the adult body, clearly discernible at x25 magnification, and gonadal abnormalities, which were easily visible at x50 magnification as clear regions against the otherwise dark body characteristic of daf-2 adults. The onset of an obvious reduction in motility and the appearance of coiling behavior was generally rapid (occurring over a 1- to 2-day period), such that motility was readily classified as normal or reduced. Reproducibility of scoring was confirmed by consistency in classification in blind trails on successive days and by independent classification by two observers.

Pharyngeal pumping rate:
Worms were raised at 15°, then transferred singly at the L4 stage to fresh plates at 22.5°. The mean pumping rate did not include nonpumping animals. Pumping was scored over a 15-sec interval or at 30-sec or 1-min intervals where pumping rate was reduced. In graphs of pumping rate as a function of percentage of maximum life span, the latter was calculated by dividing the ages at which pumping rate was measured by maximum life spans (shown in Table 3).


 
View this table:
In this window
In a new window

 
Table 1. Prior phenotypic analysis of daf-2 alleles


 
View this table:
In this window
In a new window

 
Table 2. Percentage larval arrest by daf-2 mutants


 
View this table:
In this window
In a new window

 
Table 3. Adult life span

Male mating efficiency:
Six daf-2 alleles were tested for their effects on male fertility at 20° and 25.5°. These alleles (e1370, e1371, e1391, m41, m120, and m577) were selected as a representative sample of the range of severity and variation in mutant phenotypes. Male stocks were established with males obtained by heat shock (SULSTON and HODGKIN 1988 Down) or from males occurring spontaneously in hermaphrodite populations maintained at 15°. A standard quantitative mating test was employed (HODGKIN 1983 Down), in which six late L4 daf-2 males (raised at 15°) and six late L4 dpy-11(e224) hermaphrodites were placed together on a 60-mm plate spread with bacteria and incubated for 24 hr at 20°, after which the males were removed. Total cross-progeny (non-Dpy F1) were counted. Tests of mating efficiency at 25.5° were performed in a manner similar to those at 20° except that early (rather than late) L4 males were used, such that the entire period of spermatogenesis occurred at the higher temperature.

Isolation and characterization of daf-2 deficiencies:
Two {gamma}-radiation-induced deficiencies were isolated in a noncomplementation screen. Mixed-stage N2 populations containing many males were exposed to 1500 R. Irradiated young adult males were immediately crossed to dpy-1(e1) daf-2(e1370) unc-32(e189) hermaphrodites at 20° then shifted to 25° after 24 hr. Three days later the F1 progeny were screened by visual inspection and SDS selection for the presence of wild-type or Dpy dauer larvae. Four of seven wild-type larvae that failed to recover spontaneously at 25° recovered to the L4 stage after 2 days at 15°, and these four were crossed individually with daf-2(m65) unc-32(e189)/qC1[dpy-19(e1259) glp-1(q339)] males at 20°. All four crosses were shifted to 25° after egg laying began (approximately 24 hr). Two of the crosses gave progeny. From each, wild-type nondauer L4 hermaphrodites of putative genotype mDf[daf-2]/qC1 or dpy-1 daf-2 unc-32/qC1 were placed individually on plates. Those issuing Dpy Unc progeny were discarded. The remainder for both isolates gave only wild-type and qC1 progeny, indicating that the new mutations were lethal when homozygous. The two putative deficiencies were named mDf11 and mDf12. Complementation testing showed that neither deficiency deleted unc-93; tests against mec-12 were inconclusive. Thus, the putative deficiency endpoints lie between dpy-1 and unc-93. Progeny counts confirmed that both strains gave approximately 25% embryonic lethal progeny. The mDf12/qC1 animals, but not mDf11/qC1, grow slowly relative to qC1 homozygotes.

Both deficiencies were shown by PCR analysis to lack daf-2 sequences encoding portions of the extracellular domain and the tyrosine kinase domain. The sequence of the daf-2 cDNA was obtained from GenBank (accession no. AF012437) and compared to the C. elegans sequence database to identify genomic YAC clones corresponding to daf-2 (KIMURA et al. 1997 Down). Two pairs of oligonucleotide primers were designed for PCR, one pair each from genomic sequence encoding the extracellular and intracellular domains of the protein. Primers CTCTCGAACAAAACAGTGCCTATC and AATGAGGGCCAACTAAAGAAGACC amplified a 659-bp wild-type fragment encoding a portion of the extracellular domain, whereas primers TTCGGACCGTGTGCTATTAAGATT and CTCGGACCTCCACTATGATTCATC amplified a 1082-bp fragment encoding a portion of the kinase domain. Another primer pair (AGCAGCACCAGCAACAGGAGTAAC and TTTCAAACCCCCAACTCATACCTC) from the lin-31 region of chromosome II (cosmid K10G6) was used as an internal positive control to confirm that amplifiable DNA from the deficiency homozygotes was present in the reaction. This primer pair amplified a 523-bp product.

To identify and isolate deficiency homozygotes (dead eggs), newly starved plates of mDf/qC1 bearing large numbers of unhatched eggs were washed free of gravid adults and most larvae by two gentle rinses with sterile M9 buffer, leaving most eggs still adhering to the agar surface. Washed plates were incubated at 20° for 24 hr and washed again to remove larvae that hatched after the initial rinse. Deficiency homozygotes were identified as eggs that appeared abnormal in shape and remained unhatched after a further 24–48 hr of incubation at 20°. These were picked individually or in groups of up to 15 using a pulled-out 20-µl pipette filled with chitinase solution (WILLIAMS et al. 1992 Down).

PCR reactions (25 µl final volume) were performed according to WILLIAMS et al. 1992 Down, except that Taq polymerase (Fisher Scientific) was used at 0.5 unit per reaction, and "master mix" was added to each reaction in 18.5-µl volumes to allow for separate addition of daf-2 and lin-31 control primers. Test reactions on N2 DNA using a mix of control and daf-2 primers resulted in production of both predicted products, whereas parallel reactions with putative Df DNA gave only the control product. For each strain and primer pair, assays were performed in duplicate on purified N2 DNA, deionized water blanks, and worm extracts (Df/qC1 heterozygotes) and in quadruplicate on eggs (Df homozygotes). All reactions were brought to 95° rapidly and held for 3 min, cycled 30 or 50 times (95°/30 sec, 58°/30 sec, 72°/60 sec), then held for 7 min at 72°. Amplification products were resolved on 1–2% agarose minigels.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Selection of alleles for study:
Most previous studies of daf-2 used the canonical allele, e1370. We selected 15 additional alleles to cover a wide range of severity of the Daf-c phenotype. Fourteen alleles, including e1370, were selected from the 40 currently in the Riddle lab collection (of which 28 are conditional and 12 nonconditional). Two other alleles, sa193 and sa223, were provided by J. H. THOMAS. All are recessive. Some phenotypic characterization had previously been reported for 8 of the 16 alleles (including 2, m65 and sa223, that are recessive lethal and are maintained in heterozygous stocks) as listed in Table 1. The remaining 8 are previously undescribed, temperature-sensitive (ts) Daf-c mutants and were isolated from mutant screens over the last 25 years in the MRC Laboratory of Molecular Biology, Cambridge, United Kingdom (1973–1975) or subsequently in the Riddle laboratory. All alleles were backcrossed to N2 at least three times to avoid possible phenotypic variation due to differences in genetic background.

Characterization of alleles:
We focused on the phenotypic effects of hypomorphic daf-2 alleles, although analysis of daf-2(e979), nonconditional daf-2 alleles, and daf-2 deficiencies suggested that the null [daf-2(0)] phenotype has an embryonic and L1 arrest component as well as a nonconditional Daf-c component (see below). By focusing on weaker alleles we have been able to examine the role of daf-2 in later larval development and in the biology of the adult.

Examination of the phenotypes of 16 daf-2 mutants revealed two types of daf-2 allele, class 1 and class 2. The following sections on the phenotypic analysis begin with descriptions of the major traits common to the class 1 and class 2 alleles: Daf-c, Age, and Itt. Next, L1 arrest is described, which results from all daf-2 alleles but at a greatly elevated frequency in two class 2 alleles. Then follow descriptions of the diverse class 2-specific traits, with an overview and more refined classification of the 16 alleles.

Constitutive dauer larva formation:
The percentage of the mutant population that constitutively entered the dauer stage in abundant food was measured at 15°, 20°, 22.5°, and 25.5° for all ts alleles (Table 2). These alleles largely formed a continuous series in severity, from the weakest, e1365 and m577, to the strongest, e1369. Although the five weakest alleles with respect to Daf-c are class 1, some class 1 alleles exhibited a stronger Daf-c phenotype than most class 2 alleles. Differences in the severity of most alleles were revealed at 22.5°; the majority formed no dauer larvae at 15° but formed all dauer larvae at 25.5°.

At 22.5° most alleles resulted in the rapid development of larvae either into L3 or dauer larvae (either transient or persistent). The sa193 and e1371 alleles were ranked in severity on the basis of the percentage of dauer larvae that recovered spontaneously within 80 hr after eggs were laid (Table 2). However, in two instances (e1370 and m579) all larvae arrested initially at the predauer L2d stage, followed by slow development either into dauer larvae or into stages apparently intermediate between the L2d and L3 or L4 stages. These dauer-like animals resembled L2ds in their darkness of body yet resembled L3s or L4s in size and gonadal development (Figure 1B).



View larger version (39K):
In this window
In a new window
Download PPT slide
 
Figure 1. Morphology of daf-2 mutant larvae and adults. (A) daf-2(e1370) L3, raised in abundant food at 15°; (B) e1370 dauer-like L3, raised at 22.5°; (C) 5-day-old e1370 hermaphrodite maintained at 15°; (D) daf-2(sa193) hermaphrodite transferred to 25.5° at the L4 stage and incubated for 3 days; (E) e1370 hermaphrodite transferred to 25.5° at the L4 stage and incubated for 3 days; (F) e1370 dauer larva raised at 25.5°. (A–F) Scale bar, 0.2 mm.

Two exceptional alleles were e979, which at 25.5° arrested as embryos, L1s, or rarely at a stage resembling L2d larvae (as previously reported by VOWELS and THOMAS 1992 Down), and sa223, which formed dauer larvae at 25.5° but at lower temperatures largely arrested development as L2ds (MALONE and THOMAS 1994 Down). At 25.5°, three of the daf-2 mutants (e1368, e1371, and sa193) formed dauer larvae that displayed sporadic pharyngeal movement resembling the pumping of feeding animals. Normal dauer larvae do not feed, the buccal cavity is closed, and pharyngeal pumping is not observed.

To examine maintenance of the dauer stage, dauer larvae from all ts Daf-c strains were maintained at 25.5° for 8 days after hatching and examined daily for the presence of adults. A high proportion of e1371 and sa193 dauer larvae resumed development. Occasional adults were seen among e1368 and m212 dauer larva populations (all population sizes >200). Thus, in the cases of e1368, e1371, and sa193, pharyngeal movement in dauer larvae corresponded with some degree of recovery from developmental arrest.

To determine whether nondauer development was affected by daf-2 mutations, we tested the effect of 14 daf-2 alleles on the subsequent development of animals raised at 15° and transferred to 25.5° as early L3s. Only in the case of e1371 did all the animals grow to gravid adults within 24 hr. In most other cases, the majority of animals developed into gravid adult hermaphrodites, with a minority (5–20%) of pregravid adults. In three cases, e979, e1370, and e1391, abnormal development occurred; 24 hr after upshift, most animals were abnormally dark and thin, with underdeveloped gonads, and in many cases a protruding vulva. After 48 hr, some gonadal development was observed in most of the e979 and e1391 adults and in all of the e1370 adults.

Hermaphrodite life span:
The effect of 15 daf-2 alleles on adult hermaphrodite life span was measured at 15° and 22.5° (Figure 2, Table 3). All mutations increase adult life span. The alleles exhibited a gradient of increasing longevity at 15°, but the relative extensions of median and maximum life span were similar in most cases (Figure 2A, Table 3). The greatest increases in maximum life span were approximately 300% of the N2 control. At 15°, increases in life span were only marginal for e1365, m41, and m577.




View larger version (98K):
In this window
In a new window
Download PPT slide
 
Figure 2. Effect of daf-2 mutations on median and maximum hermaphrodite life span. Median and maximum life span are expressed as a percentage of that of the wild-type control. Bars represent standard error. (A) Life span at 15°; (B) life span at 22.5°. Alleles are in order of increasing severity of the L2d and dauer arrest phenotype within each class.

At 22.5° all 15 mutants had clearly extended life spans (Figure 2B, Table 3). Most weaker alleles showed greater extensions in life span relative to N2 at 22.5° than at 15°. However, the five alleles with the largest increases in median and maximum life span at 15°, e979, e1369, e1391, m212, and sa223, at 22.5° generally showed similar or reduced extension of median life span and similar extensions in maximum life span (Figure 2, Table 3). The greatest percentage increases in life span at 22.5° did not exceed those seen at 15°, suggesting that the limit of adult life span extension that may result from loss of daf-2(+) function has been reached in these cases. At either temperature, this longevity ceiling represents a 2.5-fold increase in median life span and a 3-fold increase in maximum life span relative to wild type.

In some class 2 alleles, the extension of maximum life span at 22.5° greatly exceeded that of median life span (Figure 2B). This suggests either that these mutations have a deleterious effect on adults, resulting in some premature deaths, or conceivably that they cause individuals in the population to age at different rates.

Intrinsic thermotolerance:
Mutations in daf-2 and age-1 also result in increased tolerance to thermal stress, and it has been suggested that increased Itt, as measured by time of survival at 35°, is a necessary condition for the Age phenotype (LITHGOW et al. 1995 Down). Because mutant daf-2 alleles result in a range of Age phenotypes at 15°, the Itt phenotype of populations of young adults raised to the age of onset of egg laying at 15° was tested (Figure 3, Table 4). Increased Itt was observed in all alleles tested except m41 and m577. Seven of the most severely Age alleles at 15° (e979, e1369, e1370, e1391, m212, m579, and m596) showed similarly high values for Itt, suggesting that, as in the case of life span, the limit of adult thermotolerance that can result from loss of daf-2(+) function has been reached in these cases. The severely Age allele sa223 was also strongly Itt (data not shown). This suggests that loss of daf-2 function in mutants that can grow to the adult at 15° may result in, at most, approximately a 75% increase in median survival at 35° (Table 4).



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 3. Intrinsic thermotolerance assays. A representative sample of 35° survival curves for daf-2 adult hermaphrodite populations, raised at 15°, is shown.


 
View this table:
In this window
In a new window

 
Table 4. Intrinsic thermotolerance of daf-2 hermaphrodites

Embryonic and L1 arrest:
daf-2(e979) exhibits almost 100% embryonic or L1 arrest at 25°. This phenotype was examined in all 15 ts alleles at 15°, 20°, and 25.5° (Table 5). Some embryonic and L1 arrest (mostly the latter), higher than that observed in N2 controls, was observed in all daf-2 alleles tested at 25.5° (except sa193) but in most cases not at 15° or 20° (Table 5). The frequency of such arrest was generally low or undetectable at the temperatures tested (mean, <6%). However, at 25.5° the e1391 and e979 mutations resulted in 10.5 ± 2.8 and 100% embryonic and L1 arrest, respectively. A high level of sa223 embryonic arrest (14/29 total progeny) was seen at 15°.


 
View this table:
In this window
In a new window

 
Table 5. Embryonic and L1 arrest in daf-2 mutants

Brood size:
Fecundity of daf-2 mutant hermaphrodites was assayed at 15°, 20°, 22.5°, and 25.5° (Table 6). In self-fertilizing Caenorhabditis elegans hermaphrodites, maximum brood size normally reflects the fixed number of sperm produced before the switch from spermatogenesis to oogenesis. When averaged over all temperatures tested, class 1 mutants have broods ranging from 85 to 100% that of N2, and class 2 mutants (except sa223) have broods ranging from 60 to 93% of N2. Two class 1 alleles (e1368 and e1369) were cold sensitive, showing 35–40% reductions in brood size only at 15°. These were the only class 1 alleles where significant brood size reductions (P < 0.01) were seen, whereas most class 2 alleles resulted in significant reductions in brood size, which were generally more severe at higher temperatures (Table 6).


 
View this table:
In this window
In a new window

 
Table 6. Brood sizes of daf-2 mutants

The largest reductions in brood size resulted from sa223. In this case, brood sizes of maternally rescued animals were measured because progeny of sa223 homozygotes do not develop to adulthood. Mean sa223 brood size did not exceed 4% of wild type at any of the four temperatures tested (Table 6). At all temperatures, some sa223 adults were sterile, even though adults in which some gonad development was evident were selected (see MATERIALS AND METHODS).

Late progeny:
Production of progeny by N2 hermaphrodites at 25.5° ceases after 3–5 days, but e1370 hermaphrodites continue to produce occasional progeny for at least 50 days (LARSEN et al. 1995 Down). All 15 ts daf-2 alleles were examined for late progeny production at 15°, 22.5°, and 25.5° (Table 7). Of these, only the 7 class 2 alleles resulted in this trait.


 
View this table:
In this window
In a new window

 
Table 7. Late progeny production by daf-2 hermaphrodites

Because late progeny generally appeared after the transfer of hermaphrodites to fresh plates, and often produced in bursts by a single individual, it is possible that a cue present in fresh bacterial lawns might stimulate late reproduction in these mutants. At least some late progeny were released by their mothers as L1 larvae rather than as eggs. Late eggs were never observed.

Late progeny could result from a delay in production of oocytes or from renewal of spermatogenesis later in life, after depletion of the sperm produced during the L4 stage. To test this latter possibility, the laying of unfertilized oocytes at the end of the egg-laying period, an indicator of sperm depletion (WARD and CARREL 1979 Down), was monitored at 22.5° (Table 8). All daf-2 mutant alleles resulted in a reduction in the number of oocytes laid relative to the N2 control, although this reduction was not significant in many class 1 alleles. The seven class 2 mutants, which exhibited late progeny production, also laid the fewest oocytes. Hence, stored sperm may be present in hermaphrodites of the late progeny-producing strains at the end of the normal egg-laying period, and late progeny may result from fertilization of oocytes that are not produced until late in life. That daf-2(e1370) hermaphrodites are defective in oocyte production is also suggested by the abnormal appearance of the gonad. Microscopic examination with Nomarski optics of adult daf-2(e1370) hermaphrodites 19 hr after shifting from 15° to 25.5° revealed that, instead of the usual 8–10 oocytes stacked in the proximal arm and loop of each gonad arm, only 2–4 oocytes were present (J. MCCARTER, personal communication).


 
View this table:
In this window
In a new window

 
Table 8. Production of unfertilized oocytes by daf-2 hermaphrodites at 22.5°

Maternal rescue of larval arrest:
To test for maternal rescue of the Daf-c trait, hermaphrodites from the 15 ts daf-2 strains were crossed with N2 males at 25.5°, and F1 heterozygotes were selfed at the same temperature. Their progeny were scored after 48 hr. Because at 25.5° all, or almost all, homozygous daf-2 mutants form dauer larvae, 25% of F2 animals were expected to form dauer larvae in the absence of maternal rescue. The ratio of nondauer-to-dauer larva progeny was approximately 3:1, except for m41 heterozygotes, which segregated only 12 ± 8% dauer larvae, indicating that the Daf-c phenotype was maternally rescued in approximately half of the m41 homozygous progeny (Table 9; data not shown for ts alleles where no maternal rescue was seen). Repeating the m41 test at 25.5°, + m41 +/ dpy-1 + unc-32 parents issued 8% dauer larvae, 66% wild-type L4-adult and 25% DpyUnc progeny (N = 185). The e979 embryonic and L1 arrest phenotype was found to be fully maternally rescued such that e979 homozygotes arrested development at the dauer stage or, occasionally, the L2d stage (Table 9).


 
View this table:
In this window
In a new window

 
Table 9. Maternal rescue of developmental arrest

The m65 mutation results in nonconditional dauer larva formation, and sa223 results in formation of L2ds, dauer larvae, and sterile or near-sterile adults. Both these alleles are maintained in trans to the balancer chromosome qC1[dpy-19(e1259) glp-1(q339)]III. No maternal rescue of m65 was detected at 25.5° when assayed by scoring the progeny of m65/qC1 hermaphrodites (Table 9). Homozygous sa223 progeny of sa223/qC1 either arrested permanently at a stage resembling late L2d or developed to adulthood via dauer-like third and fourth stages. These adults were sometimes thin and dark bodied, and when gonads were present, they often appeared abnormal.

Comparison of progeny of homozygous sa223 and heterozygous sa223/qC1 hermaphrodites (Table 2 and Table 9, respectively) revealed maternal rescue of the L2d-like arrest but no rescue of the Daf-c phenotype. Animals homozygous for the sa223 allele formed dauer larvae at 25.5° but very few at 22.5°, whether they were progeny of sa223 homozygotes (Table 2) or of sa223/qC1 (Table 9). These results suggest that, whereas the Daf-c phenotype is not normally maternally rescued (with the exception of m41), the L2d arrest phenotype resulting from certain alleles may be.

Death from internal hatching (matricide):
Animals that died as the consequence of internal hatching of eggs were excluded from measurements of life span. In most daf-2 mutants, matricide, resulting in a "bag of worms" phenotype (TRENT et al. 1983 Down), was observed at a low frequency (<20%), occurring more readily at 22.5° than 15° (data not shown). At 22.5°, a higher frequency of matricide (over 30%) resulted from four class 2 alleles: e979, e1370, e1391, and sa223.

Adult morphology and behavior:
Certain daf-2 alleles (e.g., e1370) resulted in progressive changes in adult hermaphrodite appearance and behavior during the 3 days after shifting L4s from 15° to 22.5° or 25.5°. Such changes were generally not seen at 15° (Figure 1C), and some alleles (e.g., sa193) did not produce such changes at any temperature (Figure 1D). One day after transfer, e1370 adults were egg-laying defective (Egl), their bodies swollen with retained eggs. Over subsequent days, overall body darkening and shrinkage in diameter were seen. The gonad and intestine, viewed in the stereomicroscope at x50 magnification, appeared to become squeezed by the contracting body, the intestine becoming reduced to a narrow, longitudinal strip. In such animals, the gonad had an abnormal, clear appearance (Figure 1E). These animals also displayed an uncoordinated phenotype, comprising reduced movement, coiling behavior, and frequent adoption of a kinked posture similar to that seen in dauer larvae (Figure 1E and Figure F).

Appearance and behavior of the 15 ts daf-2 mutants was monitored during the first 2 weeks of adulthood at 15°, 22.5°, and 25.5°. Morphological and behavioral abnormalities similar to those seen in e1370 mutants resulted from 11 of the 15 alleles in a temperature-sensitive manner (Table 10), whereas sa223 exhibited these defects at all temperatures. At 22.5°, only 8 of the 15 alleles resulted in reduced motility. Timing and rate of onset of this Unc trait showed considerable variation among alleles (Table 10). Interestingly, in several alleles adult motility appeared normal for an extended period before becoming reduced.


 
View this table:
In this window
In a new window

 
Table 10. Reduced movement in adult daf-2 hermaphrodites

The e1370 allele was tested for reversibility of the morphological and behavioral abnormalities. Twenty-six late L4 larvae that were shifted to 25.5° for 3 days became fully Unc. They were then shifted back to 15°. Two days later, wild-type motility and morphology returned, and >200 progeny were produced. Twelve control hermaphrodites of the same age left at 25.5° produced only two progeny and no unfertilized oocytes. The 24 survivors of the shift were returned to 25.5°, and by day 8 all animals were once again Unc and morphologically abnormal. Twenty survivors were again downshifted to 15°. These animals again recovered wild-type motility and appearance by day 10, at which time they were shifted up to 25.5° for the third time. By day 12, all 15 survivors were Unc and morphologically abnormal. These were shifted to 15°, and by day 13, most animals had again recovered wild-type appearance and behavior. Thus, the behavioral and morphological abnormalities displayed by e1370 hermaphrodites at higher temperatures are reversible at least three successive times in the same animals. To our knowledge, this is the only case of a reversible ts adult Unc phenotype in C. elegans.

Male fertility:
The effect of six mutant daf-2 alleles on male mating efficiency was measured using a standard quantitative mating test (HODGKIN 1983 Down). Males were raised at 15° and tested at 20° and 25.5°. At 20° mating efficiency and fertility were reduced to 31–45% of wild-type controls, except for e1391, where it was reduced to 10% of wild-type controls (Table 11). At 25.5°, the class 1 (e1371, m41, and m577) males were as fertile as N2 males or even more so, whereas the class 2 males (e1370, e1391, and m120) males produced no progeny at all. The latter three alleles also resulted in greatly reduced male motility, suggesting that, as in the case of many uncoordinated mutant males (HODGKIN 1983 Down), their failure to sire offspring is the result of their inability to copulate.


 
View this table:
In this window
In a new window

 
Table 11. Mating efficiency of mutant daf-2 malesa

Pharyngeal pumping rate:
KENYON et al. 1993 Down compared the rate of pharyngeal pumping, an indicator of the rate of ingestion of food, in wild-type and daf-2(e1370) adult hermaphrodites at 20°. They found that although the rate of pumping declines with time at a similar rate in both strains, it is greatly reduced throughout the extended phase of the e1370 life span. Our examination of pharyngeal pumping in three class 1 and three class 2 mutants indicated that class 2 but not class 1 mutations depress the rate of pharyngeal pumping.

We examined the effect of daf-2 alleles e1371 (class 1) and e1391 (class 2) on the rate of pharyngeal pumping at 22.5° from early adulthood onward. e1391 mutants exhibited a rapid decline in the rate of pumping with advancing age (Figure 4A), whereas the rate of pumping slowed down more gradually with advancing age in e1371 animals.




View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 4. Variation of daf-2 mutant pharyngeal pumping with age at 22.5°. (A) Pharyngeal pumping rate plotted against age in days; (B) pumping rate plotted against age expressed as percentage of maximum life span; animals in which pumping was not observed in a 1-min interval were excluded from pumping rate calculations.

From day 6 onward, the rate of pumping was greater in e1371 animals than in wild type. Does this signify that e1371 results in higher rates of pumping in older animals or that e1371 animals are biologically younger at later chronological ages? To clarify this issue, pumping rate was plotted against age expressed as percentage of maximum life span (Figure 4B). The decline in pumping rate with percentage maximum life span was similar in N2 and e1371 animals; that is, the decline in pumping rate scaled with life span. This indicates that e1371 has little effect on the rate of pharyngeal pumping relative to biological or developmental (as opposed to chronological) age and also that, in e1371 mutants, pharyngeal pumping rate provides a biomarker for developmental age. Conversely, in the case of e1391, pumping is a poor indicator of developmental age. This is also true of e1370 (data not shown).

Animals in which no pumping was observed in a 1-min interval were excluded from pumping rate measurements. In the case of class 2 alleles (e1370, e1391, and m596), the majority of animals exhibited greatly reduced pumping during the first 40% of the life span, but in class 1 (e1371, m41, and sa193) mutants, as in wild-type populations, the majority of animals exhibited greatly reduced pumping only in the second half of the life span (data not shown).

Classification of daf-2 alleles:
On the basis of the above phenotypic descriptions, daf-2 alleles fell broadly into two types (Table 12). Class 1 alleles resulted in constitutive dauer larva formation (Table 2), increased longevity (Table 3), increased intrinsic thermotolerance (Table 4), a low level of embryonic and L1 arrest (mean, less than 6%) at 25.5° (Table 5), and a reduction in the number of unfertilized oocytes laid (Table 8). Class 2 mutants exhibited all of the above traits plus some or all of the following: a higher level of embryonic or L1 arrest (mean, greater than 6%) at 25.5° (Table 5), formation of dauer-like L3 and dauer-like L4 larvae (Figure 1B), reduced adult motility (Table 10), shrinkage of the adult body and gonad abnormalities at 22.5° and 25.5° (Table 10), reduced brood size (Table 6), increased frequency of internal hatching at 25.5° and production of late progeny (Table 7), greatly reduced (less than 10% that of wild type) number of oocytes laid (Table 8), and a reduction in the extension of median life span as compared to that of maximum life span (Table 3).


 
View this table:
In this window
In a new window

 
Table 12. Phenotypes of ts daf-2 alleles

The class 1 alleles (except m41) can be ranked into an allelic series defined by the severity of Daf-c and Age, where the latter is expressed as maximum life span at 15° (Table 2 and Table 3). This allelic series is as follows, in order of increasing severity:

This allelic series also approximately describes the ranking in severity of Itt. The class 1 allele m41 is among the weakest alleles with respect to Age and Itt when grown at 15° (Table 3 and Table 4), whereas with respect to its Daf-c phenotype at higher temperatures it is more severe than e1368 (Table 2).

The class 1 alleles can be subdivided into four subclasses, 1A–1D (Table 12). Class 1A mutants (e1368, e1371, and sa193) do not exhibit any reduced motility at any of the temperatures tested (Table 10) and differ from other class 1 mutants in that dauer larvae display slight pharyngeal movement at 25.5° 72 hr after the egg stage and may eventually recover into adults at 25.5°. The single class 1B allele, m41, resembles a class 1A allele, except that no pharyngeal movement or dauer larva recovery occurs at 25.5°. m41 is also unique in that the Daf-c phenotype is maternally rescued, and although moderately severe with respect to Daf-c at 22.5° (Table 2), it is almost entirely ts for Age and Itt (Table 3 and Table 4). The class 1C mutants e1365, e1369, and m577 exhibit reduced motility after 7 days at 25.5° (Table 10). The single class 1D mutant, m212, exhibits reduced motility at both 22.5° and 25.5°. This allele may be considered a borderline class 2 allele.

If both class 1 and class 2 traits are considered, no consistent ranking of allele severity may be achieved. However, on the basis of the severity of the class 2-specific mutant traits alone, the class 2 alleles may be ranked in severity as

The seven class 2 alleles constitute five subclasses, 2A–2E, based on severity and extent of pleiotropy (Table 12). The class 2A allele m596 results in late progeny production only at 25.5° (Table 7), whereas the class 2B alleles m120 and m579 do so at 22.5° as well. m120 and m579 also result in slight gonad defects. In addition to these defects, the class 2C allele e1370 and all the more severe alleles in this series also result in severe gonad defects at 22.5° and 25.5°, a mean brood size of less than 60% that of wild type at 25.5° (Table 6), over 30% mean death due to internal hatching of larvae at 22.5°, and a reduction in unfertilized oocytes laid to less than 5% of wild type at 22.5° (Table 8). Furthermore, e1370 and some of the more severe alleles in the class 2 series also cause a significant reduction in median life span relative to maximum life span at 22.5° (Figure 2B). The class 2D alleles e1391 and e979 resemble e1370 but additionally result in 11 and 100% mean predauer arrest at 25.5°, respectively (Table 5). e1391 animals also do not lay unfertilized eggs at 22.5° (Table 8). Almost all of the class 2 defects are most severe in the case of sa223, which exhibits gonad defects and reduced motility even at 15° (Table 10), and a brood size reduced to less than 5% of wild type (Table 6). However, with respect to embryonic and L1 arrest, sa223 is not more severe than e979. On the whole, with respect to class 2-specific defects, alleles may be ranked such that all the defects of weaker alleles are present or more severe in stronger alleles. The overall severity ranking of class 2 alleles given above is the most parsimonious, taking all the data into consideration.

The class 2 alleles e1370, e1391, and m596 caused a reduction in the proportion of older animals pumping at 22.5°, and in the case of e1370 and e1391, a severe reduction occurred in the rate of pharyngeal pumping (Figure 4A, and Figure 4B). Conversely, the class 1 alleles e1371, m41, and sa193 had only slight effects on pharyngeal pumping. This suggests that suppression of pharyngeal pumping may be a general feature of class 2 but not class 1 alleles. Similarly, the class 2 but not the class 1 alleles tested resulted in males that could not sire progeny at 25.5° (Table 11).

Correlation between mutant traits:
Examining correlations between severities of different mutant traits may reveal which daf-2 pleiotropic effects may be manifestations of the same underlying physiological defect. With the exception of certain alleles, daf-2 mutant traits fall broadly into two clusters of apparently linked phenomena: first, Age, Daf-c, Itt, and minor traits common to all alleles; second, the class 2-specific defects. The severity of the Age/Daf-c/Itt cluster and the class 2 defects appears largely unconnected. Thus, for example, e1369 ranks among the four most severe alleles with respect to Age and Daf-c yet displays almost no class 2 defects. Of the six most severe Daf-c alleles, three are in class 1.

We examined further the correlations between Age, Daf-c, and Itt traits. Plotting maximum life span at 15° against dauer larva formation at 22.5° shows a positive correlation in severity among most alleles (Figure 5A). One exception is m41, which is short lived (at 15°) relative to the severity of its 22.5° Daf-c phenotype. The sa223 mutant is long lived relative to dauer formation at 22.5°, but it exhibits an extreme predauer arrest phenotype. Also, e1391 may be somewhat long lived relative to its Daf-c phenotype (Table 2), suggesting that, in this case, class 2 defects are associated with either an enhancement of Age or a depression of Daf-c.





View larger version (62K):
In this window
In a new window
Download PPT slide
 
Figure 5. Plots of Daf-c, Age, and Itt phenotype severities, derived from data displayed in Table 2, Table 3, and Table 4, respectively. Bars represent standard errors. (A) Age versus Daf-c. Note that although sa223 results in only 3.3% dauer formation at 22.5°, the remaining 96.7% arrest development as L2ds; (B) Age versus Itt; (C) Itt versus Daf-c. Note that Itt was measured for animals grown at 15°, a temperature at which m41 is wild type.

If Age is plotted against Itt (Figure 5B), a positive correlation is also seen. When the Daf-c (22.5°) and the Itt phenotypes of animals raised at 15° were plotted against one another (Figure 5C), the nine most severe alleles with respect to Daf-c showed a similar level of Itt, with the exception of m41. This suggests that in mutants exhibiting greater than 10% dauer formation at 22.5°, Itt in animals raised at 15° is maximally penetrant.

Interactions between daf-2 and daf-12—Dauer formation:
Previous attempts to establish the epistasis relationship between daf-2 and the daf-d gene daf-12 have been complicated by differences between daf-2 alleles. Whereas daf-2(m41); daf-12(m20) animals develop into adults at 25.5°, daf-2(e1370); daf-12(m20) animals arrest development either as embryos or L1s, or near the L2 molt (YEH 1991 Down; VOWELS and THOMAS 1992 Down; LARSEN et al. 1995 Down). To test the hypothesis that phenotypes in combination with daf-12 will be class specific, the phenotypes of six class 1 and four class 2 alleles were examined in combination with daf-12(m20). Comparing developmental phenotypes of the 10 daf-2; daf-12 strains, two components of the Daf-c phenotype, developmental arrest and dauer larva morphogenesis, may be distinguished. daf-12(m20) prevents dauer larva morphogenesis in both class 1 and 2 alleles, and it suppresses developmental arrest in class 1 but not severe class 2 alleles (Table 13). Developmental arrest was suppressed in the case of the weakest class 2 allele, m596.


 
View this table:
In this window
In a new window

 
Table 13. Dauer larva formation in daf-2 and daf-12(m20) strains

The effect of each daf-2; daf-12(m20) combination on dauer formation was assayed (Table 13). In combination with daf-12(m20), all six class 1 alleles behaved similarly. At 22.5°, all animals developed into L4s or adults by 60 hr. At 25.5°, development was slightly retarded such that L3s and L4s were seen instead of adults at 50 hr, but all animals subsequently developed into adults. At 22.5°, the three daf-2; daf-12 strains containing class 2 alleles behaved similarly to one another. All permanently arrested development at a stage resembling L3 or L4 in size but with an underdeveloped gonad. At 25.5° daf-2(e1370); daf-12(m20) resulted in either embryonic or L1 arrest, or arrest at a stage apparently intermediate between an L2 or L3 and an L2d. Almost all daf-2(e1391); daf-12(m20) animals arrested as the L2- and L3-like forms seen among daf-2(e1370); daf-12(m20) populations. At 25.5°, the daf-2(e979); daf-12(m20) strain developed as in the absence of the daf-12(m20) mutation (i.e., embryonic lethality and L1 arrest).

The daf-2(m65); daf-12(m20) progeny of daf-2(m65)/qC1[dpy-19 glp-1]; daf-12(m20) animals were also examined. The m65 mutation alone results in nonconditional dauer formation. The m65; daf-12 homozygotes were developmentally arrested and resembled daf-2(e1370); daf-12 and daf-2(e1391); daf-12 arrested larvae. By 3 days at 25.5°, m65; daf-12 segregants arrested development as dark-bodied, somewhat thin, L3-sized individuals, which comprised 27 ± 3% of the total population (N = 866). At 15°, they became larger, arresting development at approximately the size of L4s. No dauer larvae were seen. These observations suggest that m65 is a class 2 allele.

Interactions between daf-2 and daf-12—Life span:
The effect of eight daf-2 alleles in combination with daf-12(m20) on adult life span was measured (Figure 6, Table 3). As in dauer formation, class 1 alleles behaved similarly to one another with respect to the effects of daf-12(m20) on the Age phenotype. Some suppression, but not enhancement, of the Age phenotype by daf-12(m20) was observed. In the case of the class 2 alleles, daf-12(m20) generally had no effect on the Age phenotype at 15° but enhanced it at 22.5°.




View larger version (79K):
In this window
In a new window
Download PPT slide
 
Figure 6. Effect of daf-2 and daf-12(m20) mutations on median and maximum life span. Median and maximum life span is expressed as a percentage of the respective wild-type controls. Bars represent standard error. (A) Life span at 15°; (B) life span at 22.5°. Alleles are arranged in order of increasing severity of Daf-c, within each daf-2 class.

In a daf-2(+) genetic background, the daf-12 mutation reduced median and maximum life span at both temperatures (Table 3). At 15°, the weaker class 1 alleles e1365, m41, m577, and sa193 resulted in marginal increases in life span, whereas the strong class 1 allele m212 doubled both median and maximum life span (Figure 6A). At this temperature, the addition of daf-12(m20) resulted in a slight reduction in the median life span of the sa193 strain and a marked reduction in the median life spans of the e1365 and m212 strains. Significant shortening of life span was not seen in m41 and m577. At 22.5°, e1365, m41, m577, and sa193 resulted in large increases in life span, and addition of daf-12 resulted in some depression of the enhanced longevity (Figure 6B, Table 3). In daf-2(e1365); daf-12 strains, median and maximum life spans were depressed relative to e1365. In the daf-2(m577); daf-12 and daf-2(sa193); daf-12 strains, the extension of median life span was marginally reduced, and in the daf-2(m41); daf-12 strain, clear reduction of the extension of median (but not maximum) life span was seen. Conversely, the daf-12 mutation did not reduce the daf-2(m212) Age phenotype at 22.5°. Thus, daf-12(m20) appears to act as a weak suppressor of Age, at least with respect to median life span, more readily suppressing the weaker class 1 daf-2 alleles.

In the cases of the class 2 alleles e979, e1370, and e1391 at 15°, addition of daf-12(m20) had no significant effect on life span except for e979; daf-12, where maximum life span was enhanced (Figure 6A, Table 3). At 22.5°, addition of daf-12 generally enhanced median and maximum life spans (Figure 6B, Table 3). Addition of daf-12 increased e1391 median and maximum life span to 441% and 453% of N2, respectively, at 22.5°. One e1391; daf-12 animal lived to the age of 102 days.

Interactions between daf-2 and daf-12—Thermotolerance:
The effects of daf-12(m20) on thermotolerance did not parallel the effects on larval development and life extension. Although daf-12(m20) suppressed the class 1 Daf-c phenotype, and in some cases reduced class 1-enhanced longevity, daf-2(m41); daf-12 and daf-2(m577); daf-12 were more thermotolerant than the single mutants (percent increase in median survival 31.5 ± 0.5% and 27.8 ± 6.1%, respectively). Maximum survival was also enhanced (data not shown). Survival of daf-2(e1365); daf-12 was no different from that of e1365.

Class 2 alleles e1370 and e1391 interacted with daf-12(m20), resulting in arrested larval development at 25.5°; both double-mutant strains displayed increased maximum life spans at 22.5°. With regard to thermotolerance, the e1370 double mutants were slightly less tolerant than e1370, whereas the e1391 double mutants were slightly more tolerant (data not shown).

Interactions between daf-2 and daf-12—Internal hatching, late progeny, adult behavior, and morphology:
The late progeny and reduced motility traits were slightly enhanced by daf-12(m20). In combination with e979, e1370, e1391, and m212, daf-12(m20) resulted in a somewhat earlier onset of motility reduction, with full onset beginning 16, 4, 5, and 4 days after upshift of L4s to 22.5°, respectively. Conversely, death by internal hatching was strongly suppressed by daf-12(m20) in the class 2 alleles e1370 and e1391 but not e979 (data not shown). Internal hatching in the five class 1 alleles tested was unaffected by the presence of daf-12(m20). In all four cases, the presence of daf-12(m20) caused no clear enhancement or suppression of the adult body shrinkage or abnormal gonad phenotypes seen at 22.5° and 25.5°.

Of the eight daf-2 alleles tested in combination with daf-12(m20), three, e979, e1370, and e1391, resulted in late progeny at 22.5° and 25.5° in a daf-12(+) genetic background (Table 7). Addition of daf-12(m20) resulted in most cases in a marginal increase in the severity of the phenotype (data not shown). Thus, a very small number of late progeny were produced at 15° (0.15–0.4 late progeny per animal), whereas none were seen in the daf-2 single mutants at that temperature. An exception was e1391, where addition of daf-12(m20) reduced late progeny production at 22.5°, from 8.2 to 1.8 late progeny per worm.

The daf-2 null phenotype:
The deficiencies mDf11 and mDf12 fail to complement daf-2 (see MATERIALS AND METHODS). Although neither deletes the leftward or rightward markers, dpy-1 or unc-93, both deficiencies were shown by PCR analysis to lack daf-2 sequences encoding portions of the extracellular and protein kinase domains. Furthermore, mDf11/mDf12 animals exhibit an egg/L1 arrest phenotype, not the maternally rescued daf-2 null phenotype, indicating that the deficiencies include at least one essential gene in common, in addition to daf-2. Crosses of mDf12/qC1 males with mDf11/qC1 hermaphrodites, in which 88% of the adults were cross-progeny, 32% of the F1 were egg/L1 lethal but there were no dauer progeny.

At 25.5° m65/mDf11 and m65/mDf12 animals formed dauer larvae nonconditionally without detectable embryonic or L1 arrest. However, the latter phenotype could have been maternally rescued. The relative severity of m65, mDf11, and mDf12 were compared by examining the Daf-c phenotype of each in trans to e1370 at 20°. At 20°, e1370 results in less than 1% dauer formation. In two trials, 4.7 ± 2.9% (N = 490) and 2.2 ± 0.7% (N = 1351) of m65/e1370 animals formed dauer larvae, whereas mDf11/e1370 and mDf12/e1370 resulted in 5.8 ± 5.8% (N = 579) and 13.0 ± 6.2% (N = 943) dauer formation, respectively. Thus, neither deficiency results in a phenotype significantly more severe than m65, supporting the view that m65 is a null [daf-2(0)] allele.

The daf-2(0) phenotype is complicated by the fact that the daf-2 egg-L1 lethal phenotype is maternally rescued, but the Daf-c phenotype is not. At 15°, daf-2(e979) results in 20% dauer formation, whereas daf-2(m65) results in 100% dauer formation, indicating that m65 is the more severe allele. Yet at 25.5°, e979 (but not m65) results in 100% embryonic or L1 arrest, a more severe phenotype. Which is the more severe allele? Because the embryonic and L1 arrest phenotype of e979 is maternally rescued, but the Daf-c phenotype is not (Table 9), we hypothesize that in the absence of maternal rescue, m65 homozygotes would exhibit 100% embryonic and L1 arrest. Because m65 homozygotes never develop into adults, it was not possible to test this possibility directly. Instead, we examined the homozygous m65 progeny of daf-2(m65)/daf-2ts heteroallelic animals to determine whether reducing the maternal contribution of daf-2(+) resulted in an egg-L1 lethal phenotype. Progeny of daf-2(m65) unc-32(e189)/daf-2(m577) + adults were examined at 25.5°. m577 is a relatively weak ts allele. The progeny consisted of 71% non-Unc dauer larvae, 17% Unc dauer larvae, 6% unhatched eggs, and 5% L1s (N = 628). Because 25% of these progeny should be homozygous for daf-2(m65) unc-32, but only 17% Unc dauer progeny were seen, 32% of daf-2(m65) unc-32 homozygotes arrest development as embryos or L1s. Less than 2% of unc-32 progeny arrest development at 25.5°.

Using other ts daf-2 alleles in trans to m65 or other nonconditional daf-2 alleles, no greater proportion of embryonic or L1 arrest was seen. However, testing animals carrying strong ts alleles (e.g., e1369 or e1391) in trans to m65 or m632 was not successful due to very poor recovery of dauer larvae during strain construction or sterility upon testing at 25.5°.

Since we were able to increase the amount of egg-L1 lethality by constructing animals containing ts alleles in trans to nonconditional alleles, it is possible that an adult hermaphrodite with no daf-2(+) activity would produce only progeny that arrest as embryos or L1 larvae. However, such parents may be sterile, or they may arrest irreversibly in the dauer stage. The above results are consistent with the ts e979 egg-L1 lethal phenotype representing a complete loss of function at restrictive temperature.

The daf-2(e979) embryonic and L1 arrest phenotype was tested for dominance. daf-2(e979)/daf-2(m577) heteroallelic animals were selfed at 25.5°, and the phenotypes of resulting progeny were scored. A total of 25 ± 6% of progeny were dead eggs or L1s (presumably mostly e979 homozygotes), and the remainder were dauer larvae (total sample size: 270). From this, it may be inferred that e979/m577 animals largely arrest development as dauer larvae rather than embryos or L1s; that is, e979 is recessive for the egg-L1 lethal trait. Furthermore, residual daf-2(+) activity from the m577 allele is sufficient to compensate for e979 loss of function and prevent L1 arrest in e979/m577 animals yet insufficient to allow maternal rescue of L1 arrest in e979 homozygous siblings. This implies that in e979/m577 animals zygotic expression of m577 prevents L1 arrest. Thus, both maternal and zygotic DAF-2 promote embryonic and L1 development in wild-type animals.

daf-2(e979)/daf-2(m577) adult hermaphrodites were also examined. Median and maximum life spans at 15° were 30 and 35 days, respectively (N = 18). This compares to median and maximum life spans of 26 and 34 days, respectively for m577, and 50 and 69 days, respectively, for e979. Thus, in life span, e979/m577 adults more closely resemble m577 than e979. Again, e979 shows no clear dominant effect, consistent with loss of function rather than gain of function.

If e979, m65, and mDf12 are all daf-2(0) at 25.5°, then the phenotypes of m65/e979 and mDf12/e979 animals should exhibit the e979 lethal phenotype in the absence of maternal rescue. Crosses of m65/qC1 males with e979 hermaphrodites at 25.5°, in which virtually all the F1 were cross-progeny, produced 51 ± 0.4% growing progeny, 36 ± 1.2% dauer progeny, and 13 ± 1.6% egg/L1 arrested progeny. Similarly, crosses of mDf12/qC1 males with e979 hermaphrodites produced 53 ± 3% growing progeny, 39 ± 2% dauer progeny, and 8 ± 2% egg/L1 arrested progeny. These results are consistent with the proposition that both m65 and mDf12 are daf-2 nulls. Production of dauer progeny from these crosses is either the result of parental rescue or the reduction of a negative activity of a slightly neomorphic e979 allele. e979 hermaphrodites raised to the L4 stage at 15° then shifted to 25.5° do not exhibit such rescue. We conclude that the absence of both parental and zygotic daf-2 activity results in a phenotype within the range between e979 and approximately 33% egg/L1 arrest [the result from the most severe heteroallelic animals that could be tested, daf-2(m212ts)/daf-2(m632)].

Suppression of daf-2 class 2 defects by daf-16(m26):
Mutations in the daf-d gene daf-16 suppress several daf-2-associated mutant phenotypes including Daf-c (RIDDLE et al. 1981 Down), Age (KENYON et al. 1993 Down), embryonic and L1 arrest, and reduced brood size (GOTTLIEB and RUVKUN 1994 Down). We examined the effect of daf-16(m26) on the reduced motility, adult body shrinkage, and gonad morphology defects resulting from daf-2(e1370) at 25.5°. All three abnormalities were suppressed by daf-16(m26). It was not possible to look for late progeny production by daf-16(m26); daf-2(e1370) hermaphrodites because they died of old age before the ages at which late progeny are typically produced by daf-16(m26)(+); daf-2(e1370) animals. However, numerous unfertilized oocytes were laid by daf-16(m26); daf-2(e1370) hermaphrodites, indicating that sperm had become depleted, as in the wild type. The daf-16 mutation fully suppresses the Daf-c phenotype of the putative null allele daf-2(m65), but the double-mutant adults are sterile (LARSEN et al. 1995 Down).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Our aims in the present study were (1) to characterize the full range of phenotypes that may result from mutation of the daf-2 gene; (2) to understand the relationship between different daf-2 mutant traits, in particular to establish which are linked to the Age phenotype; and (3) to discover the nature of the null [daf-2(0)] phenotype. Our results suggest that daf-2(0) mutations result in nonconditional dauer larva formation (in the presence of maternal rescue) or embryonic and L1 arrest, as in the case of the ts allele e979. To investigate the numerous roles of daf-2 in later development, ts mutations have been examined, and it is with the analysis of their phenotypes that the greater part of this study is concerned. Fifteen ts daf-2 alleles, isolated on the basis of their Daf-c phenotype, were characterized with respect to a range of mutant traits.

Two overlapping classes of daf-2 allele:
daf-2 alleles can be grouped into two overlapping classes based on pleiotropy (Table 12). Although class 1 contains the five weakest Daf-c alleles, it also includes three of the six most severe Daf-c alleles (Table 2). Thus, the severity of Daf-c and the class 2 pleiotropic defects show little correspondence. This suggests that the daf-2 gene specifies two distinct functions. We designate these daf-2A and daf-2B, where daf-2A affects only those phenotypes common to class 1 and 2 alleles, and daf-2B affects the class 2-specific defects. The behavior of daf-2; daf-12 mutants suggests that daf-2B also affects Age and third-stage larval arrest. In this scheme, all 15 ts alleles are defective with respect to daf-2A function, whereas only the seven class 2 alleles are markedly defective with respect to daf-2B function. The class 2 mutants are daf-2A(-)daf-2B(-). The two functions may represent a role for the DAF-2 receptor in two different pathways, such that some mutations affect one pathway more than another and/or they may correspond to different functional domains within the DAF-2 protein. Alternatively, daf-2A and daf-2B could correspond to alternately spliced transcripts containing different numbers and/or combinations of exons, as in the case of vab-3 (CHISHOLM and HORVITZ 1995 Down) and mab-18 (ZHANG and EMMONS 1995 Down).

Alleles of the type daf-2A(-)daf-2B(+), which display no class 2-specific traits, have been identified, whereas alleles of the type daf-2A(+)daf-2B(-), displaying class 2-specific traits alone, were not. Such alleles might be expected to display only class 2-specific traits (i.e., reduced adult motility, abnormal gonad) without being Daf-c, Itt, or Age. The absence of daf-2A(+)daf-2B(-) alleles may be due to the lack of appropriate mutant screens to identify such alleles. Alternatively, all mutations resulting in daf-2B(-) may also cause some loss of daf-2A function.

Assigning alleles to classes is useful for dealing with the complexity of daf-2 mutant phenotypes and gene interactions. However, there is overlap between the two classes because a number of class 1 alleles exhibit weak class 2 traits. The class 1C alleles e1365, e1369, and m577 result in one marginal class 2 trait: reduced adult motility at 25.5° after 7 days. The class 1D allele m212 results in reduced motility also at 22.5°. Although the class 1C and 1D alleles might be classified as weak class 2 alleles, we have grouped them together with the class 1 alleles because their adult (class 2) phenotypes are very weak.

The daf-2 gene encodes a cell-surface tyrosine kinase receptor homolog resembling an insulin receptor (InR; KIMURA et al. 1997 Down). The nine mutant lesions for which sequence data were reported included four alleles characterized in this study: two class 1 alleles, e1365 and e1368, and two class 2 alleles, e1370 and e1391. The two class 1 mutant lesions mapped to the putative extracellular ligand-binding domain, and the two class 2 alleles mapped to the putative intracellular tyrosine kinase domain. Two further alleles with lesions mapping to the putative ligand-binding domain, sa187 and sa229, were subjected to preliminary phenotypic analysis. sa229 behaved as a class 1A allele: Adults maintained at 25.5° did not become Unc, and gonadal appearance remained normal (D. GEMS, unpublished results). However, sa187 behaved as a class 2 allele: Adults became Unc and developed abnormal gonadal appearance at 25.5° (D. GEMS, unpublished results). In sa187, a residue in the Cys-rich region of the InR homolog ligand-binding domain that is conserved between C. elegans and humans is substituted.

Thus, it is possible that class 1 mutations may, in general, affect the less conserved parts of the ligand-binding domain of the InR-like protein, whereas class 2 mutations affect the conserved region of the ligand-binding domain and the tyrosine kinase domain. A possible interpretation explaining both phenotypic and molecular data is as follows. daf-2A and daf-2B correspond to two components of signaling into the cell by the InR-like receptor. While daf-2A signaling is completely ligand dependent, daf-2B signaling is not. Thus, in class 1 alleles, which are daf-2A(-)daf-2B(+), ligand-dependent signaling is blocked by the defect in the ligand-binding domain, but ligand-independent signaling is not. In class 2 alleles, which are daf-2A(-)daf-2B(-), both signaling components are blocked. This interpretation suggests that the tyrosine kinase is required for both daf-2A and daf-2B signaling. Possibly, mutations like sa187, which are class 2 and map to the Cys-rich conserved region of the extracellular domain, render the entire protein defective and hence are daf-2A(-)daf-2B(-).

The model in Figure 7 suggests that daf-2A and daf-2B activities correspond to signals from the daf-2 receptor propagated by different signaling intermediates. This is consistent with the nature of vertebrate InRs, which propagate signals via intermediates other than PI 3-kinase (e.g., ras and the MAP kinase cascade). If this is so, how is it that both daf-2A(-) and daf-2B(-) are suppressed by daf-16(-)? The pathway presented includes two daf-16 activities, daf-16 (A) and daf-16 (B), which we suggest may correspond to daf-16(+) activity at different times in development or in different cell types, in which the daf-2 InR signal may be transmitted via different signaling cascades.



View larger version (21K):
In this window
In a new window
Download PPT slide
 
Figure 7. Genetic interactions of daf-2, daf-12, daf-16, and age-1 in controlling larval development, life span, and other traits. The pathway is drawn to depict wild-type gene functions that stimulate (arrow) or inhibit (T bar) subsequent activities, or traits. Traits seen only in daf-2 or age-1 mutants are shown in italics. They are proposed to result from unmodulated activity of daf-12 or daf-16. Mutations in daf-2 and age-1 are Daf-c and Age, whereas those in daf-12 and daf-16 are Daf-d. See text for detailed discussion. In this model daf-12(+) activity is activated by dauer-inducing pheromone. This activation involves switching off signalling via a number of daf-c genes, including daf-1, daf-4, daf-7, daf-8, and daf-14 (reviewed in RIDDLE and ALBERT 1997 Down). daf-2(+) and age-1(+) are also environmentally modulated, but it is not clear by what. As drawn, some physiological factor, e.g., glucose, that is associated with growth-promoting conditions, denoted ?, results in activation of daf-2(+) and age-1(+). Similarly, the activity of these genes could be inhibited by dauer-inducing conditions. One possible regulator of daf-2(+) and age-1(+) activities is the nutritional status of the animal. Both daf-12 and daf-16 are required for expression of the class 1 traits. Activities that inhibit either daf-12 or daf-16 (A) functions prevent expression of these traits. Only daf-16 is required for expression of class 2 traits. Data clearly indicate that daf-12(+) is required for dauer development. In the adult, daf-12(+) either weakly enhances or plays no role in the Age phenotype.

The daf-2(0) phenotype:
Because daf-2(m65) results in nonconditional dauer formation at all temperatures, it is maintained in the heterozygous state, usually in trans to the balancer chromosome qC1. Consequently, the effects of this allele on embryonic and L1 development have previously been masked by the genetic maternal effect. We uncovered the embryonic and L1 arrest component of the m65 phenotype by examining the progeny of heteroallelic adults in which maternal rescue was reduced. Thus, the daf-2 gene has a role in embryonic and L1 development, as well as nondauer development, and maintenance of adult characteristics. Of the ts alleles, the e979 egg-L1 lethal is the only candidate for complete loss of function at 25.5°.

In most daf-2 alleles, the effects of daf-2B(-) on early development were maternally rescued, whereas those of daf-2A(-) were not. (An exception was m41, where the Daf-c phenotype was partially maternally rescued.) This suggests that zygotic expression of daf-2B is not required, at least as far as the second molt. However, zygotic expression of daf-2 is generally required to prevent dauer larva formation.

Embryonic and L1 arrest have also been observed at 25° when daf-2(e1370) is combined with mutations in the cilium structure genes che-3, che-11, osm-1, osm-3, or osm-5 (VOWELS and THOMAS 1992 Down). When wild-type embryos hatch in the absence of food, developmental arrest at the L1 stage occurs, which can last for at least 12 days at 20° without effect on subsequent development (JOHNSON et al. 1984 Down). This L1 arrest is not dependent on chemosensation of food alone because even the most severe cilium structure mutants do not result in significant L1 arrest in the presence of food. The L1 arrest resulting from daf-2(e1370) in combination with cilium structure mutants suggests that it may be regulated by two redundant modes of food detection. The first involves chemosensation and is rendered defective by cilium structure mutants. The second is independent of chemosensation and involves daf-2B, possibly responding to the nutritional state of the organism. Embryonic and L1 arrest have also been observed in strains combining a severe age-1 allele, mg44, with mutations in the cilium structure genes che-3 and daf-10 (GOTTLIEB and RUVKUN 1994 Down).

Distinctive properties of m41:
daf-2(m41) is the only classically ts allele, and it is the only allele where Daf-c is maternally rescued. The life spans of most alleles at 15° correspond in severity to their Daf-c phenotype at 22.5° (Figure 5A, Table 2 and Table 3). However, m41 life span is only marginally greater than wild type at 15° (Table 3; LARSEN et al. 1995 Down), despite being the fifth most severe Daf-c allele at 22.5°. Likewise, the Itt phenotype of m41 animals raised at 15° is also wild type (Figure 5C, Table 4). This suggests that either the synthesis or function of m41 DAF-2 protein is thermolabile. The other 14 ts daf-2 alleles are likely to represent hypomorphic mutations, the temperature sensitivity of which reflects the innate temperature sensitivity of wild-type dauer formation (GOLDEN and RIDDLE 1984B Down).

Relationship between the class 2 mutant traits:
We posit that class 2-specific defects result from differing degrees of defectiveness in one component of daf-2 gene function (Table 12). Hypothetically, some of the class 2-specific defects may be related to each other as follows. A slight defect in daf-2B results in reduced motility and coiling. A slightly more severe defect in daf-2B results in late progeny. The latter trait may be due to severely retarded production of oocytes, with fertilization of rare late oocytes occurring at advanced ages. Alternatively, it could result from a failure of egg laying combined with developmental arrest of internally hatched eggs as L1s inside the uterus.

A decrease in class 2 median life span relative to maximum life span at 22.5° (Figure 2B) suggests that many animals may be dying of some deleterious effect of daf-2B rather than old age (subsequently referred to as early mortality or premature death). The coincidence of late progeny and increased premature death suggests that these two traits may be related. Although dead animals in which internally hatched larvae were observed were excluded from quantitation of life span, the presence of small numbers of L1 larvae inside the bodies of dead hermaphrodites would have been hard to detect. But given that pharyngeal pumping is greatly reduced in some class 2 mutants, premature death may result from starvation.

In general, later stages in C. elegans development are more sensitive to loss of daf-2(+). Hence, many alleles result in Age and Itt but not Daf-c phenotypes at 15°. Similarly, the most sensitive indicator of daf-2B(-) is reduced adult motility, seen only after 7 days at 25.5° in class A3 alleles (Table 10). More severe alleles in the class 2 series affect increasingly early stages of development: brood size; later larval development; and, in the most severe alleles, L1 and even embryonic development. Thus, the threshold of daf-2 activity below which a mutant phenotype results appears to increase with age from the embryo to at least mid-adulthood.

daf-2(e1370) ts Unc phenotype:
It has been suggested that the increased longevity of daf-2 mutants may result from the adult expression of dauer longevity (KENYON et al. 1993 Down). The reduced adult motility, reduced adult pharyngeal pumping, and shrinkage of the adult body seen in daf-2B mutants may be interpreted in similar terms: inappropriate expression of dauer-associated behavior and morphology in the adult. The neural basis of dauer-specific behavior (e.g., reduced motility and nictation) is unknown. We have shown that if adult daf-2(e1370) hermaphrodites are maintained at 25.5° until reduced motility is seen, then shifted to 15°, they recover wild-type motility. Furthermore, recovered animals may be rendered Unc and non-Unc again by successive rounds of temperature upshift and downshift. This phenotype represents an instance of reversible, temperature-sensitive behavioral plasticity in the C. elegans adult that warrants further study.

daf-2B defects and age-1:
Mutations in age-1 (formerly also known as daf-23) result in Daf-c and Age phenotypes (FRIEDMAN and JOHNSON 1988 Down; GOTTLIEB and RUVKUN 1994 Down; MALONE et al. 1996 Down; MORRIS et al. 1996 Down; TISSENBAUM and RUVKUN 1998 Down). Gene interaction studies suggest that age-1 functions at the same point as daf-2 in the epistasis pathway of genes controlling dauer formation and life span (GOTTLIEB and RUVKUN 1994 Down; LARSEN et al. 1995 Down). The phenotype of the severe age-1 mutants more closely resembles that of class 2 than of class 1 daf-2 mutants in four respects. First, stronger age-1 alleles result in arrest of larvae at the predauer L2d stage as well as the dauer stage. For example, at 15° age-1(mg44) results largely in L2d arrest and some dark-bodied, sterile adults with protruding vulvas (GOTTLIEB and RUVKUN 1994 Down). At temperatures below 25.5° daf-2(sa223) also results in L2d arrest, and sa223/qC1 hermaphrodites segregate some dark-bodied, sterile sa223 adults. Shifting daf-2 (e1370, e979, and e1391) early L3 larvae raised at 15° to 25.5° results in formation of dark-bodied adults with delayed fertility and protruding vulvas. Second, the age-1 nonconditional L2d or dauer-stage arrest is fully maternally rescued (GOTTLIEB and RUVKUN 1994 Down; LARSEN et al. 1995 Down). Whereas dauer formation in daf-2 mutants is generally not maternally rescued, the L2d arrest seen in progeny of sa223 homozygotes at temperatures below 25.5° is rescued (Table 9). The L2d arrest resulting from e1370 at 22.5° shows twice the level of maternal rescue as does dauer arrest. Third, the age-1 larval arrest phenotype is not suppressed by mutations in daf-12 (GOTTLIEB and RUVKUN 1994 Down; LARSEN et al. 1995 Down). Similarly, daf-12(m20) suppresses the daf-2 Daf-c phenotype but not class 2-specific embryonic and larval defects. Fourth, age-1(hx546) did not enhance the e1370 Daf-c phenotype at 20°, but double mutants were retarded in development, were infertile, and had a reduced rate of pharyngeal pumping (DORMAN et al. 1995 Down). At 20° age-1(hx546); daf-2(+) animals are wild type with respect to larval development, and daf-2(e1370) is essentially wild type with respect to class 2 traits. Thus, in the age-1(hx546); daf-2(e1370) strain an additive interaction between age-1(hx546) and daf-2B(-) but not daf-2A(-) occurs.

If age-1 and daf-2B act together, then it would be expected that a daf-2A(+)daf-2B(0) mutation would closely resemble age-1(0) mutations. We propose that daf-2(sa223) phenotypically resembles severe age-1 alleles because it may be weakly mutant with respect to daf-2A and severely mutant with respect to daf-2B.

The age-1 gene encodes a phosphatidylinositol kinase (MORRIS et al. 1996 Down). The similarity of daf-2B and age-1 mutants suggests the hypothesis that a function of the DAF-2 protein that requires AGE-1 may be defective in class 2 but not class 1 mutants. If daf-2B function requires the age-1 PI 3kinase, and daf-2A does not, this suggests that daf-2A may act through an alternative signalling pathway.

Reproductive investment and life span:
A key element of the evolutionary theory of aging is that evolution will maximize the reproductive success of species even at a cost to longevity (reviewed in ROSE 1991 Down). From this, it is expected that mutations that extend life span may also reduce fecundity. In C. elegans, mutations extending life span do not consistently reduce brood size (LITHGOW et al. 1994 Down; LARSEN et al. 1995 Down). The current study suggests that brood-size reduction, in most cases seen in the daf-2B mutants, results from a pleiotropic effect on gonad function that is separable from the Age phenotype (Table 3 and Table 6). Furthermore, reduction in the capacity to produce eggs may not be detectable in self-fertilizing, protandrous hermaphrodites, where brood size is limited by the fixed number of self-sperm. In this context, it is intriguing that most daf-2 alleles result in a significant reduction in the number of unfertilized oocytes laid at 22.5° after the depletion of self-sperm (Table 8). In three class 1 strains examined at 15° (e1369, m212, and sa193), the number of unfertilized oocytes laid was also reduced (data not shown). This reduction potentially reflects a change in the reproductive physiology of the animal, resulting in a reduction in oocytes produced by the ovary in response to sperm in the spermatheca. Alternatively, the smaller number of unfertilized oocytes laid may reflect a reduction in the laying rather than production of oocytes.

A further consequence of the evolutionary theory of aging is that a selective advantage exists for species with the capacity to respond to reproductive opportunities by facultatively increasing reproductive output, even where this increase shortens life span (PARTRIDGE and HARVEY 1988 Down). A cost to increased egg production in reduced life span has been observed in numerous species, e.g., fruit flies (MAYNARD SMITH 1958 Down) and cockroaches (GRIFFITHS and TAUBER 1942 Down). Conversely, increasing egg production in C. elegans does not shorten life span (GEMS and RIDDLE 1996 Down) nor does decreasing egg production lengthen it (FRIEDMAN and JOHNSON 1988 Down; KENYON et al. 1993 Down). However, this does not exclude the possibility that in daf-2 hermaphrodites resources are diverted from egg production to the processes underlying longevity. If such resource diversion occurs, it does not reduce egg production in well-fed hermaphrodites.

Epistasis between daf-2 and daf-12:
We examined the phenotypes resulting from the combination of daf-12(m20) with five class 1 and three class 2 daf-2 alleles. Our aim was to establish whether or not differences between the phenotypes of daf-2; daf-12 strains can be related to phenotypic differences between daf-2 alleles and to clarify the epistasis relationship between daf-2 and daf-12. The effect of daf-12(m20) on several daf-2 mutant traits was examined: Daf-c, Itt, Age, and class 2-specific defects (reduced adult motility, abnormal gonad morphology, embryonic and L1 arrest, and production of late progeny). Only with regard to the class 1 mutant Daf-c phenotype was daf-12(m20) clearly epistatic.

Two components of the Daf-c phenotype, dauer larva morphogenesis and developmental arrest, were differentially suppressed by daf-12(m20) in a daf-2 class-dependent manner. When class 1 alleles were present, daf-12(m20) resulted in growth, i.e., suppression of dauer larva morphogenesis and developmental arrest at 25.5° (Table 13). Given that class 1 alleles are defective with respect to daf-2A, but not daf-2B, this indicates that daf-12(m20) is epistatic to daf-2A(-) during development.

When the severe class 2 allele e1391 was combined with daf-12(m20) at 25.5°, animals arrested as dark L2- or L3-sized larvae (Table 13). daf-2(e1370); daf-12 resulted in L1- and L2d-like arrest, and daf-2(e979); daf-12, like e979 alone, resulted in embryonic and L1 arrest. At 22.5°, all three double mutants arrested development at a stage resembling slightly dark-bodied L3s or L4s. Thus, while daf-12(m20) suppresses dauer larva morphogenesis in both class 1 and class 2 daf-2 mutants, it suppresses larval arrest in the class 1 but not the severe class 2 mutants. Given that class 2 daf-2 alleles are defective in both the daf-2A and daf-2B elements of daf-2 function, this indicates that daf-12(m20) is epistatic to strong daf-2A(-) but not to strong daf-2B(-) during development.

Revised model for gene interactions:
The differences between daf-2 class 1 and class 2 alleles with respect to their interactions with daf-12, daf-16, and age-1 follow from the model represented in Figure 7. The daf-2 gene specifies two functions, daf-2A and daf-2B. daf-2 mutants fall into two groups: class 1, which are daf-2A(-)daf-2B(+), and class 2, which are daf-2A(-)daf-2B(-). daf-2A but not severe daf-2B mutations are suppressed by the daf-12(m20) mutation, yet both daf-2A and daf-2B mutations are suppressed by mutations in daf-16. Mutations in daf-16 suppress Daf-c (RIDDLE et al. 1981 Down), Age (KENYON et al. 1993 Down; LARSEN et al. 1995 Down), and, to some extent, Itt (K. V. KING and D. L. RIDDLE, unpublished results). In the case of daf-2B, daf-16(m26) was found to suppress the shrinkage of the adult body, gonad abnormalities, and reduced adult motility resulting from daf-2(e1370). Furthermore, mutations in daf-16 were previously observed to suppress daf-2 L1 arrest and reduced brood size (GOTTLIEB and RUVKUN 1994 Down). Thus, while daf-12 is epistatic to daf-2A only, daf-16 is epistatic to both daf-2A and daf-2B; i.e., both daf-12(+) and daf-16(+) are required for daf-2A-mediated mutant effects, whereas daf-16(+) but not daf-12(+) is required for daf-2B-mediated mutant effects (Figure 7).

In the proposed model, the mutant phenotypes result from unmodulated daf-12(+) and daf-16(+) activity when daf-2 is mutant. Loss of daf-2A function results in active daf-16(+). Both daf-12(+) and daf-16(+) are required to promote dauer larva development and third-stage larval arrest. daf-16(+) is also required for increased longevity, as is daf-12(+) to some extent. The suppression of daf-2A(-) by daf-12(-) results from the loss of daf-12(+) interaction with daf-16(+) (Figure 7). An alternative possibility is that daf-2A(+) inhibits daf-12(+), in which case the suppression of daf-2A(-) defects by daf-16(-) would be due to the failure of the latter to interact with daf-12(+).

In daf-2B(-) mutants, daf-16(+) function is active and exerts its effects independently of daf-12(+). For the model to work, it must be supposed that the manner in which daf-16(+) is activated as the result of daf-2A(-) is different from that resulting from daf-2B(-). The daf-16(+) functions inhibited by daf-2A(+) and daf-2B(+) are designated daf-16 (A) and daf-16 (B), respectively. While it must be assumed that daf-2A and daf-2B correspond to different elements of DAF-2 function, this is not the case for daf-16 (A) and daf-16 (B). daf-16 (A) and daf-16 (B) may correspond to daf-16(+) activity at different times in development, or in different cell types.

daf-16 (B)(+) activity may require age-1(+), given the similarity between age-1 and daf-2B mutant phenotypes (see above), and results in a different set of mutant defects. Some of these (e.g., third-larval stage arrest) are the same as those resulting from daf-16 (A)(+) and daf-12(+) combined, when daf-2A is mutant. Others (e.g., adult morphological and behavioral abnormalities and embryonic and L1 arrest) are different. Thus, some overlap exists between the daf-2A/daf-16 (A) and daf-2B/age-1/daf-16 (B) pathways. The existence of such overlap explains why, in terms of the model, the severest age-1 alleles result in dauer larva formation.

The effect of daf-12(m20) on the class 2 traits (embryonic and L1 arrest, late progeny and shrunken adult body, defective gonads, and reduced motility) supports the hypothesis that daf-2B acts independently of daf-12. In the three class 2 alleles studied (e979, e1370, and e1391), effects of daf-12(m20) on these traits were marginal. However, in the case of e1370 and e1391, daf-12(m20) significantly reduced the frequency of death from internal hatching.

Epistasis between daf-2 and daf-12—Life span:
Among daf-2 alleles the severity of the Age trait largely correlates with those of the Daf-c and Itt phenotypes (Figure 5) but not the class 2-specific defects. The more severe class 2 defects are, in fact, associated with reduced extension of median life span relative to extension of maximum life span seen at 22.5° (Figure 2B), presumably resulting from early mortality in some animals. In interpreting the effects of daf-12(m20) on the life span of daf-2; daf-12 strains, potential enhancing effects of daf-2A(-) and daf-2B(-) on longevity must be distinguished from life span-reducing pleiotropic effects of daf-2B(-).

Although the epistasis relationship between daf-2A and daf-12(m20) in dauer formation is clear, in the case of the Age phenotype, the ordering of these two genes is ambiguous. When combined with class 1 daf-2 alleles, daf-12(m20) results in some depression of daf-2 extended life span (mostly median) but no enhancement (Figure 6, Table 3). To some extent, this conforms with the inference from the daf-2; daf-12 Daf-c phenotypes that daf-12(m20) is epistatic to daf-2A (Figure 7). However, daf-12(m20) is a poor suppressor of Age compared to daf-16(m26), which fully suppresses the daf-2 Age phenotype (LARSEN et al. 1995 Down). Potentially, the failure of daf-12(m20) to fully suppress daf-2 Age reflects the weakness of the m20 mutation. However, sequence analysis of m20 shows that it is an amber nonsense mutation (A. ANTEBI and E. HEDGECOCK, personal communication), and this allele is fully Daf-d. Taken together, this suggests that the Age phenotype is activated by daf-16(+) but that daf-12(+) may also have a weak activating role.

An alternative interpretation of the weak Age-suppressing effect of daf-12(m20) on daf-2A mutations is that loss of daf-12(+) is generally deleterious, thereby reducing life span. The life span of daf-2(+); daf-12(m20) populations is only about 70% of wild type, supporting this interpretation. However, suppression of Age through deleterious effects of daf-12(m20) might have been expected to affect all alleles similarly, and this was not the case.

The fact that daf-12(m20) did not suppress the Age phenotype of the class 2 daf-2 alleles e979, e1370, and e1391 (Figure 6, Table 3) both supports the contention that daf-2B does not act through daf-12 (Figure 7) and suggests that daf-2B(-) and daf-2A(-) result in extended life span. However, the class 2 mutants, which lack both functions, do not live longer than the class 1 mutants.

At 22.5° (but not 15°) addition of daf-12(m20) enhanced the longevity of e979, e1370, and e1391 (Figure 6, Table 3). This enhancement of the Age phenotype by daf-12(m20) could be due either to further retardation of the rate of senescence at 22.5° or to suppression of deleterious effects of daf-2B(-). In populations of e979, e1370, and e1391 animals, the extension of median life span is generally less than the extension of maximum life span at 22.5° (Figure 6B). In these cases, early mortality may result from deleterious effects rather than senescence itself, and enhancement of the Age phenotype by the daf-12 mutation (Figure 6B) may result from the suppression of this early mortality. Consistent with this are the similar relative extensions of median and maximum life span seen in daf-2(e1391); daf-12(m20) populations (Figure 6B), which would be expected in the absence of an early deleterious effect that depressed the median. Furthermore, daf-12 has no Age-enhancing effect at 15° when class 2 defects are not expressed. In cases where death is not a reliable measure of senescence, we need other markers of progressive decline in function.

If the enhancement of longevity by daf-12(m20) in these cases is due to suppression of premature death, this is likely to be an indirect effect. Mutations in daf-12 can result in numerous defects in addition to Daf-d. These include reduced brood size (LARSEN et al. 1995 Down), heterochronic lineage defects in the hypodermis, and failure in migration of the gonadal distal tip cells (ANTEBI et al. 1998 Down). Thus, the suppression of premature death may result from pleiotropic interactions.

The Age phenotype and reduced motility:
One interpretation of species differences in life span is that they reflect differences in metabolic rates. The "rate of living" theory postulates that life span depends upon the rate at which a fixed metabolic potential is expended (PEARL 1928 Down). In some species, e.g., the housefly Musca domestica (SOHAL and BUCHAN 1981 Down) and fruit fly D. melanogaster (TROUT and KAPLAN 1970 Down), life span is dependent on the level of physical activity. Although evidence suggests that metabolic rate is reduced in dauer larvae (O'RIORDAN and BURNELL 1989 Down; WADSWORTH and RIDDLE 1989 Down), this is not true for daf-2 adults (VANFLETEREN and DE VREESE 1995 Down). However, in some respects daf-2 adults appear dauer-like in their behavior: Both dauer larvae (CASSADA and RUSSELL 1975 Down) and older daf-2 adults (KENYON et al. 1993 Down) show little spontaneous movement but will move away rapidly in response to touch. Likewise, dauer larvae are nonfeeding (CASSADA and RUSSELL 1975 Down), and pharyngeal pumping is greatly reduced in older daf-2 adults (KENYON et al. 1993 Down). However, the current study demonstrates that reduced movement and reduced feeding are not required for life extension because these traits are not seen in some class 1 mutant adults.

In most prior studies of daf-2 adults, the class 2, canonical allele, e1370, has been used. The daf-2 Age phenotype may be studied in the absence of class 2-specific defects by using class 1A or 1B mutants. We propose m41 as a class 1 canonical allele. The m41 allele is a more convenient allele to work with than the class 1A alleles e1368, e1371, and sa193, as it forms dauer larvae that do not recover at 25.5°.

It remains to be established whether e1370 adult-expressed dauer-like traits, such as elevated levels of antioxidant and glyoxylate pathway enzymes, are also exhibited by class 1 daf-2 mutants, and how many traits, such as reduced-pharyngeal movement or adult motility, are class 2-specific characteristics not associated with life extension. For example, it is possible that increased use of the glyoxylate pathway in e1370 adults occurs in response to starvation resulting from cessation of feeding, a defect not seen in at least some class 1 mutants.

In summary, our results have revealed two overlapping classes of daf-2 mutant, the properties of which suggest that daf-2 is a bifunctional gene. These two elements of daf-2 function regulate different but overlapping sets of developmental events, from embryogenesis to the maintenance of adult characteristics. Our detailed description of the complex mutant phenotypes provides a resource for interpretation of the molecular alterations in the DAF-2 receptor.


*  FOOTNOTES

1 Present address: The Galton Laboratory, Department of Biology, University College London NW1 2HE, UK. Back


*  ACKNOWLEDGMENTS

We thank A. ANTEBI, E. HEDGECOCK, and J. MCCARTER for communication of unpublished results, S. BOTTS for technical assistance, and E. A. MALONE and J. H. THOMAS for providing strains. This work was supported by fellowships from the University of Missouri Molecular Biology Program to D.G., P.L.L., and A.J.S., a grant from the American Federation of Aging Research to K.V.K. and P.L.L., and Department of Health and Human Services grants AG12689 and HD11239 to D.L.R.

Manuscript received April 23, 1997; Accepted for publication June 11, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ANDERSON, G. L., 1978  Responses of dauerlarvae of Caenorhabditis elegans (Nematoda: Rhabditidae) to thermal stress and oxygen deprivation. Can. J. Zool. 56:1786-1791.

ANDERSON, G. L., 1982  Superoxide dismutase activity in dauerlarvae of Caenorhabditis elegans (Nematoda: Rhabditidae). Can. J. Zool. 60:288-291.

ANTEBI, A., J. G. CULOTTI, and E. M. HEDGECOCK, 1998  daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125:1191-1205[Abstract].

BRENNER, S., 1974  The genetics of Caenorhabditis elegans. Genetics 77:71-94[Abstract/Free Full Text].

CASSADA, R. C. and R. L. RUSSELL, 1975  The dauerlarva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans. Dev. Biol. 46:326-342[Medline].

CHISHOLM, A. D. and H. R. HORVITZ, 1995  Patterning of the Caenorhabditis elegans head region by the Pax-6 family member vab-3. Nature 377:52-55[Medline].

DORMAN, J. B., B. ALBINDER, T. SHROYER, and C. KENYON, 1995  The age-1 and daf-2 genes function in a common pathway to control the lifespan of Caenorhabditis elegans. Genetics 141:1399-1406[Abstract].

FRIEDMAN, D. B. and T. E. JOHNSON, 1988  A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics 118:75-86[Abstract/Free Full Text].

GEMS, D. and D. L. RIDDLE, 1996  Longevity in Caenorhabditis elegans reduced by mating but not gamete production. Nature 379:723-725[Medline].

GOLDEN, J. W. and D. L. RIDDLE, 1984a  The C. elegans dauer larva: developmental effects of pheromone, food and temperature. Dev. Biol. 102:368-378[Medline].

GOLDEN, J. W. and D. L. RIDDLE, 1984b  A pheromone-induced developmental switch in Caenorhabditis elegans: temperature-sensitive mutants reveal a wild-type temperature-dependent process. Proc. Natl. Acad. Sci. USA 81:819-823[Abstract/Free Full Text].

GOTTLIEB, S. and G. RUVKUN, 1994  daf-2, daf-16 and daf-23: genetically interacting genes controlling dauer formation in Caenorhabditis elegans. Genetics 137:107-120[Abstract].

GRIFFITHS, J. T. and O. E. TAUBER, 1942  Fecundity, longevity, and parthenogenesis of the American roach, Periplaneta americana L. Physiol. Zool. 15:196-209.

HODGKIN, J., 1983  Male phenotypes and mating efficiency in Caenorhabditis elegans. Genetics 103:43-64[Abstract/Free Full Text].

JOHNSON, T. E. and W. B. WOOD, 1982  Genetic analysis of life-span in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 79:6603-6607[Abstract/Free Full Text].

JOHNSON, T. E., D. H. MITCHELL, S. KLINE, R. KEMAL, and J. FOY, 1984  Arresting development arrests aging in the nematode Caenorhabditis elegans. Mech. Ageing Dev. 28:23-40[Medline].

KAPELLER, R. and L. C. CANTLEY, 1994  Phosphatidylinositol 3-kinase. BioEssays 16:565-576[Medline].

KENYON, C., J. CHANG, E. GENSCH, A. RUDNER, and R. TABTIANG, 1993  A C. elegans mutant that lives twice as long as wild type. Nature 366:461-464[Medline].

KIMURA, K. D., H. A. TISSENBAUM, Y. LIU, and G. RUVKUN, 1997  daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 277:942-946[Abstract/Free Full Text].

KLASS, M. and D. HIRSH, 1976  Non-aging developmental variant of C. elegans. Nature 260:523-525[Medline].

LARSEN, P. L., 1993  Aging and resistance to oxidative stress in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 90:8905-8909[Abstract/Free Full Text].

LARSEN, P. L., P. S. ALBERT, and D. L. RIDDLE, 1995  Genes that regulate both development and longevity in Caenorhabditis elegans. Genetics 139:1567-1583[Abstract].

LIN, K., J. B. DORMAN, A. RODAN, and C. KENYON, 1997  daf-16: an HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Nature 278:1319-1322.

LITHGOW, G. J., T. M. WHITE, D. A. HINERFIELD, and T. E. JOHNSON, 1994  Thermotolerance of a long-lived mutant of Caenorhabditis elegans. J. Geron. 49:B270-B276.

LITHGOW, G. L., T. M. WHITE, S. MELOV, and T. E. JOHNSON, 1995  Thermotolerance and extended life-span conferred by single-gene mutations and induced by thermal stress. Proc. Natl. Acad. Sci. USA 92:7540-7544[Abstract/Free Full Text].

MALONE, E. A. and J. H. THOMAS, 1994  A screen for nonconditional dauer-constitutive mutations in Caenorhabditis elegans. Genetics 136:879-886[Abstract].

MALONE, E. A., T. INOUE, and J. H. THOMAS, 1996  Genetic analysis of the roles of daf-28 and age-1 in regulating Caenorhabditis elegans dauer formation. Genetics 143:1193-1205[Abstract].

MAYNARD SMITH, J., 1958  The effects of temperature and of egg-laying on the longevity of Drosophila subobscura. J. Exp. Biol. 35:832-843[Abstract].

MORRIS, J. Z., H. A. TISSENBAUM, and G. RUVKUN, 1996  A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382:536-538[Medline].

OGG, S., S. PARADIS, S. GOTTLIEB, G. I. PATTERSON, and L. LEE et al., 1997  The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389:994-999[Medline].

O'RIORDAN, V. B. and A. M. BURNELL, 1989  Intermediary metabolism in the dauer larva of the nematode Caenorhabditis elegans - 1. Glycolysis, gluconeogenesis, oxidative phosphorylation and the tricarboxylic acid cycle. Compar. Biochem. Physiol. 92B:233-238.

PARTRIDGE, L. and P. H. HARVEY, 1988  The ecological context of life history evolution. Science 241:1449-1455[Abstract/Free Full Text].

PEARL, R., 1928 The Rate of Living. Knopf, New York.

RIDDLE, D. L., 1977  A genetic pathway for dauer larva formation in Caenorhabditis elegans. Stadler Symp. 9:101-120.

RIDDLE, D. L., 1988 The dauer larva, pp. 393–412 in The Nematode Caenorhabditis elegans, edited by W. B. WOOD. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

RIDDLE, D. L., and P. S. ALBERT, 1997 Genetic and environmental regulation of dauer larva development, pp. 739–768 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

RIDDLE, D. L., M. S. SWANSON, and P. S. ALBERT, 1981  Interacting genes in nematode dauer larva formation. Nature 290:668-671[Medline].

ROSE, M., 1991 Evolutionary Biology of Aging. Oxford University Press, Oxford.

SOHAL, R. S. and P. B. BUCHAN, 1981  Relationship between physical activity and life span in the adult housefly, Musca domestica. Exp. Gerontol. 16:157-162[Medline].

SULSTON, J., and J. HODGKIN, 1988 Methods, pp. 587–606 in The Nematode Caenorhabditis elegans, edited by W. B. WOOD. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

SWANSON, M. M. and D. L. RIDDLE, 1981  Critical periods in the development of the Caenorhabditis elegans dauer larva. Dev. Biol. 84:27-40[Medline].

TISSENBAUM, H. A. and G. RUVKUN, 1998  An insulin-like signaling pathway affects both longevity and reproduction in Caenorhabditis elegans. Genetics 148:703-717[Abstract/Free Full Text].

TRENT, C., N. TSUNG, and H. R. HORVITZ, 1983  Egg-laying defective mutants of the nematode Caenorhabditis elegans. Genetics 104:619-647[Abstract/Free Full Text].

TROUT, W. E. and W. D. KAPLAN, 1970  A relation between longevity, metabolic rate, and activity in Shaker mutants of Drosophila melanogaster. Exp. Gerontol. 5:83-92[Medline].

VANFLETEREN, J. R. and A. DE VREESE, 1995  The gerontogenes age-1 and daf-2 determine metabolic rate potential in aging Caenorhabditis elegans. FASEB J. 9:1355-1361[Abstract].

VOWELS, J. J. and J. H. THOMAS, 1992  Genetic analysis of chemosensory control of dauer formation in Caenorhabditis elegans. Genetics 130:105-123[Abstract].

WADSWORTH, W. G. and D. L. RIDDLE, 1989  Developmental regulation of energy metabolism in Caenorhabditis elegans. Dev. Biol. 132:167-173[Medline].

WARD, S. and J. S. CARREL, 1979  Fertilization and sperm competition in the nematode Caenorhabditis elegans. Dev. Biol. 73:304-321[Medline].

WILLIAMS, B. D., B. SCHRANK, C. HUYNH, R. SHOWNKEEN, and R. H. WATERSTON, 1992  A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131:609-624[Abstract].

YEH, W.-Y., 1991 Genes acting late in the signalling pathway for Caenorhabditis elegans dauer larval development. Ph.D. Thesis, University of Missouri, Columbia, Missouri.

ZHANG, Y. and S. W. EMMONS, 1995  Specification of sense-organ identity by a Caenorhabditis elegans Pax-6 homologue. Nature 377:55-59[Medline].




This article has been cited by other articles:


Home page
J. Neurosci.Home page
M. M. Gaglia and C. Kenyon
Stimulation of Movement in a Quiescent, Hibernation-Like Form of Caenorhabditis elegans by Dopamine Signaling
J. Neurosci., June 3, 2009; 29(22): 7302 - 7314.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Chen, J. R. Whetstine, S. Ghosh, J. A. Hanover, R. R. Gali, P. Grosu, and Y. Shi
The conserved NAD(H)-dependent corepressor CTBP-1 regulates Caenorhabditis elegans life span
PNAS, February 3, 2009; 106(5): 1496 - 1501.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
A. R. Mendenhall, M. G. LeBlanc, D. P. Mohan, and P. A. Padilla
Reduction in ovulation or male sex phenotype increases long-term anoxia survival in a daf-16-independent manner in Caenorhabditis elegans
Physiol Genomics, February 2, 2009; 36(3): 167 - 178.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
H. Schulenburg, J. Kurtz, Y. Moret, and M. T Siva-Jothy
Introduction. Ecological immunology
Phil Trans R Soc B, January 12, 2009; 364(1513): 3 - 14.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
R. Doonan, J. J. McElwee, F. Matthijssens, G. A. Walker, K. Houthoofd, P. Back, A. Matscheski, J. R. Vanfleteren, and D. Gems
Against the oxidative damage theory of aging: superoxide dismutases protect against oxidative stress but have little or no effect on life span in Caenorhabditis elegans
Genes & Dev., December 1, 2008; 22(23): 3236 - 3241.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
D. Tohyama, A. Yamaguchi, and T. Yamashita
Inhibition of a eukaryotic initiation factor (eIF2B{delta}/F11A3.2) during adulthood extends lifespan in Caenorhabditis elegans
FASEB J, December 1, 2008; 22(12): 4327 - 4337.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
G. Kleemann, L. Jia, and S. W. Emmons
Regulation of Caenorhabditis elegans Male Mate Searching Behavior by the Nuclear Receptor DAF-12
Genetics, December 1, 2008; 180(4): 2111 - 2122.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
P. De Caigny and K. Lukowiak
Crowding, an environmental stressor, blocks long-term memory formation in Lymnaea
J. Exp. Biol., August 15, 2008; 211(16): 2678 - 2688.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. Fielenbach and A. Antebi
C. elegans dauer formation and the molecular basis of plasticity
Genes & Dev., August 15, 2008; 22(16): 2149 - 2165.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Kniazeva, T. Euler, and M. Han
A branched-chain fatty acid is involved in post-embryonic growth control in parallel to the insulin receptor pathway and its biosynthesis is feedback-regulated in C. elegans
Genes & Dev., August 1, 2008; 22(15): 2102 - 2110.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. A. Hallem and P. W. Sternberg
Acute carbon dioxide avoidance in Caenorhabditis elegans
PNAS, June 10, 2008; 105(23): 8038 - 8043.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. S. Patel, A. Garza-Garcia, M. Nanji, J. J. McElwee, D. Ackerman, P. C. Driscoll, and D. Gems
Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor
Genetics, February 1, 2008; 178(2): 931 - 946.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. M. Yamawaki, N. Arantes-Oliveira, J. R. Berman, P. Zhang, and C. Kenyon
Distinct Activities of the Germline and Somatic Reproductive Tissues in the Regulation of Caenorhabditis elegans' Longevity
Genetics, January 1, 2008; 178(1): 513 - 526.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. L. Miller and M. B. Roth
Hydrogen sulfide increases thermotolerance and lifespan in Caenorhabditis elegans
PNAS, December 18, 2007; 104(51): 20618 - 20622.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
V. L. Jensen, P. S. Albert, and D. L. Riddle
Caenorhabditis elegans SDF-9 Enhances Insulin/Insulin-Like Signaling Through Interaction With DAF-2
Genetics, September 1, 2007; 177(1): 661 - 666.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
M.-Q. Dong, J. D. Venable, N. Au, T. Xu, S. K. Park, D. Cociorva, J. R. Johnson, A. Dillin, and J. R. Yates III
Quantitative Mass Spectrometry Identifies Insulin Signaling Targets in C. elegans
Science, August 3, 2007; 317(5838): 660 - 663.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Hasshoff, C. Bohnisch, D. Tonn, B. Hasert, and H. Schulenburg
The role of Caenorhabditis elegans insulin-like signaling in the behavioral avoidance of pathogenic Bacillus thuringiensis
FASEB J, June 1, 2007; 21(8): 1801 - 1812.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Corona, R. A. Velarde, S. Remolina, A. Moran-Lauter, Y. Wang, K. A. Hughes, and G. E. Robinson
Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity
PNAS, April 24, 2007; 104(17): 7128 - 7133.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Gerisch, V. Rottiers, D. Li, D. L. Motola, C. L. Cummins, H. Lehrach, D. J. Mangelsdorf, and A. Antebi
A bile acid-like steroid modulates Caenorhabditis elegans lifespan through nuclear receptor signaling
PNAS, March 20, 2007; 104(12): 5014 - 5019.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A.-F. Ruaud and J.-L. Bessereau
The P-type ATPase CATP-1 is a novel regulator of C. elegans developmental timing that acts independently of its predicted pump function
Development, March 1, 2007; 134(5): 867 - 879.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. Yook and J. Hodgkin
Mos1 Mutagenesis Reveals a Diversity of Mechanisms Affecting Response of Caenorhabditis elegans to the Bacterial Pathogen Microbacterium nematophilum
Genetics, February 1, 2007; 175(2): 681 - 697.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E. Kodama, A. Kuhara, A. Mohri-Shiomi, K. D. Kimura, M. Okumura, M. Tomioka, Y. Iino, and I. Mori
Insulin-like signaling and the neural circuit for integrative behavior in C. elegans.
Genes & Dev., November 1, 2006; 20(21): 2955 - 2960.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. R. Mendenhall, B. LaRue, and P. A. Padilla
Glyceraldehyde-3-Phosphate Dehydrogenase Mediates Anoxia Response and Survival in Caenorhabditis elegans
Genetics, November 1, 2006; 174(3): 1173 - 1187.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. Vellai, D. McCulloch, D. Gems, and A. L. Kovacs
Effects of Sex and Insulin/Insulin-Like Growth Factor-1 Signaling on Performance in an Associative Learning Paradigm in Caenorhabditis elegans
Genetics, September 1, 2006; 174(1): 309 - 316.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. M. Pinkston, D. Garigan, M. Hansen, and C. Kenyon
Mutations that increase the life span of C. elegans inhibit tumor growth.
Science, August 18, 2006; 313(5789): 971 - 975.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
N. A. Hopper
The Adaptor Protein soc-1/Gab1 Modifies Growth Factor Receptor Output in Caenorhabditis elegans
Genetics, May 1, 2006; 173(1): 163 - 175.
[Abstract] [Full Text] [PDF]


Home page
Proc R Soc BHome page
A. I Barnes, J. M Boone, J. Jacobson, L. Partridge, and T. Chapman
No extension of lifespan by ablation of germ line in Drosophila
Proc R Soc B, April 22, 2006; 273(1589): 939 - 947.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Murakami, K. Bessinger, J. Hellmann, and S. Murakami
Aging-Dependent and -Independent Modulation of Associative Learning Behavior by Insulin/Insulin-Like Growth Factor-1 Signal in Caenorhabditis elegans
J. Neurosci., November 23, 2005; 25(47): 10894 - 10904.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Yabe, N. Suzuki, T. Furukawa, T. Ishihara, and I. Katsura
Multidrug resistance-associated protein MRP-1 regulates dauer diapause by its export activity in Caenorhabditis elegans
Development, July 15, 2005; 132(14): 3197 - 3207.
[Abstract] [Full Text] [PDF]


Home page
Biol LettHome page
W. A Van Voorhies, J. Fuchs, and S. Thomas
The longevity of Caenorhabditis elegans in soil
Biol Lett, June 22, 2005; 1(2): 247 - 249.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
J. Halaschek-Wiener, J. S. Khattra, S. McKay, A. Pouzyrev, J. M. Stott, G. S. Yang, R. A. Holt, S. J.M. Jones, M. A. Marra, A. R. Brooks-Wilson, et al.
Analysis of long-lived C. elegans daf-2 mutants using serial analysis of gene expression
Genome Res., May 1, 2005; 15(5): 603 - 615.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Shostak and K. R. Yamamoto
Overlapping but Separable Determinants of DNA Binding and Nuclear Localization Map to the C-terminal End of the Caenorhabditis elegans DAF-12 DNA Binding Domain
J. Biol. Chem., February 25, 2005; 280(8): 6554 - 6560.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Li, G. Brown, M. Ailion, S. Lee, and J. H. Thomas
NCR-1 and NCR-2, the C. elegans homologs of the human Niemann-Pick type C1 disease protein, function upstream of DAF-9 in the dauer formation pathways
Development, November 15, 2004; 131(22): 5741 - 5752.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. McElwee, E. Schuster, E. Blanc, J. H. Thomas, and D. Gems
Shared Transcriptional Signature in Caenorhabditis elegans Dauer Larvae and Long-lived daf-2 Mutants Implicates Detoxification System in Longevity Assurance
J. Biol. Chem., October 22, 2004; 279(43): 44533 - 44543.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Y. Shostak, M. R. Van Gilst, A. Antebi, and K. R. Yamamoto
Identification of C. elegans DAF-12-binding sites, response elements, and target genes
Genes & Dev., October 15, 2004; 18(20): 2529 - 2544.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. H. Ludewig, C. Kober-Eisermann, C. Weitzel, A. Bethke, K. Neubert, B. Gerisch, H. Hutter, and A. Antebi
A novel nuclear receptor/coregulator complex controls C. elegans lipid metabolism, larval development, and aging
Genes & Dev., September 1, 2004; 18(17): 2120 - 2133.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Meissner, M. Boll, H. Daniel, and R. Baumeister
Deletion of the Intestinal Peptide Transporter Affects Insulin and TOR Signaling in Caenorhabditis elegans
J. Biol. Chem., August 27, 2004; 279(35): 36739 - 36745.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Jia, D. Chen, and D. L. Riddle
The TOR pathway interacts with the insulin signaling pathway to regulate C. elegans larval development, metabolism and life span
Development, August 15, 2004; 131(16): 3897 - 3906.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. Gerisch and A. Antebi
Hormonal signals produced by DAF-9/cytochrome P450 regulate C. elegans dauer diapause in response to environmental cues
Development, April 15, 2004; 131(8): 1765 - 1776.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Y. Mak and G. Ruvkun
Intercellular signaling of reproductive development by the C. elegans DAF-9 cytochrome P450
Development, April 15, 2004; 131(8): 1777 - 1786.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
N. Arantes-Oliveira, J. R. Berman, and C. Kenyon
Healthy Animals with Extreme Longevity
Science, October 24, 2003; 302(5645): 611 - 611.
[Full Text] [PDF]


Home page
ScienceHome page
A. Melendez, Z. Talloczy, M. Seaman, E.-L. Eskelinen, D. H. Hall, and B. Levine
Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in C. elegans
Science, September 5, 2003; 301(5638): 1387 - 1391.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
D. H. Castrillon, L. Miao, R. Kollipara, J. W. Horner, and R. A. DePinho
Suppression of Ovarian Follicle Activation in Mice by the Transcription Factor Foxo3a
Science, July 11, 2003; 301(5630): 215 - 218.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A.-L. Hsu, C. T. Murphy, and C. Kenyon
Regulation of Aging and Age-Related Disease by DAF-16 and Heat-Shock Factor
Science, May 16, 2003; 300(5622): 1142 - 1145.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
P. L. Larsen
Direct and Indirect Transcriptional Targets of DAF-16
Sci. Aging Knowl. Environ., April 30, 2003; 2003(17): pe9 - 9.
[Abstract] [Full Text]


Home page
ScienceHome page
V. D. Longo and C. E. Finch
Evolutionary Medicine: From Dwarf Model Systems to Healthy Centenarians?
Science, February 28, 2003; 299(5611): 1342 - 1346.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Ayyadevara, R. Ayyadevara, A. Vertino, A. Galecki, J. J. Thaden, and R. J. S. Reis
Genetic Loci Modulating Fitness and Life Span in Caenorhabditis elegans: Categorical Trait Interval Mapping in CL2a x Bergerac-BO Recombinant-Inbred Worms
Genetics, February 1, 2003; 163(2): 557 - 570.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Positive Selection of Caenorhabditis elegans Mutants With Increased Stress Resistance and Longevity
Genetics, January 1, 2003; 163(1): 171 - 180.



Home page
ScienceHome page
A. Dillin, A.-L. Hsu, N. Arantes-Oliveira, J. Lehrer-Graiwer, H. Hsin, A. G. Fraser, R. S. Kamath, J. Ahringer, and C. Kenyon
Rates of Behavior and Aging Specified by Mitochondrial Function During Development
Science, December 20, 2002; 298(5602): 2398 - 2401.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Wolkow, M. J. Munoz, D. L. Riddle, and G. Ruvkun
Insulin Receptor Substrate and p55 Orthologous Adaptor Proteins Function in the Caenorhabditis elegans daf-2/Insulin-like Signaling Pathway
J. Biol. Chem., December 13, 2002; 277(51): 49591 - 49597.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. Dillin, D. K. Crawford, and C. Kenyon
Timing Requirements for Insulin/IGF-1 Signaling in C. elegans
Science, October 25, 2002; 298(5594): 830 - 834.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. Garigan, A.-L. Hsu, A. G. Fraser, R. S. Kamath, J. Ahringer, and C. Kenyon
Genetic Analysis of Tissue Aging in Caenorhabditis elegans: A Role for Heat-Shock Factor and Bacterial Proliferation
Genetics, July 1, 2002; 161(3): 1101 - 1112.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
B. A. Scott, M. S. Avidan, and C. M. Crowder
Regulation of Hypoxic Death in C. elegans by the Insulin/IGF Receptor Homolog DAF-2
Science, June 28, 2002; 296(5577): 2388 - 2391.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Jia, P. S. Albert, and D. L. Riddle
DAF-9, a cytochrome P450 regulating C. elegans larval development and adult longevity
Development, January 1, 2002; 129(1): 221 - 231.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
M. Leslie
Aging Research Grows Up
Sci. Aging Knowl. Environ., October 3, 2001; 2001(1): oa1 - 1.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. B. Pierce, M. Costa, R. Wisotzkey, S. Devadhar, S. A. Homburger, A. R. Buchman, K. C. Ferguson, J. Heller, D. M. Platt, A. A. Pasquinelli, et al.
Regulation of DAF-2 receptor signaling by human insulin and ins-1, a member of the unusually large and diverse C. elegans insulin gene family
Genes & Dev., March 15, 2001; 15(6): 672 - 686.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Jonassen, P. L. Larsen, and C. F. Clarke
A dietary source of coenzyme Q is essential for growth of long-lived Caenorhabditis elegans clk-1 mutants
PNAS, December 28, 2000; (2000) 21337498.
[Abstract] [Full Text]


Home page
GeneticsHome page
A. J. Piekny, A. Wissmann, and P. E. Mains
Embryonic Morphogenesis in Caenorhabditis elegans Integrates the Activity of LET-502 Rho-Binding Kinase, MEL-11 Myosin Phosphatase, DAF-2 Insulin Receptor and FEM-2 PP2c Phosphatase
Genetics, December 1, 2000; 156(4): 1671 - 1689.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-C. Labbe, J. Burgess, L. A. Rokeach, and S. Hekimi
ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation
PNAS, November 2, 2000; (2000) 230284297.
[Abstract] [Full Text]


Home page
GeneticsHome page
J. Leips and T. F. C. Mackay
Quantitative Trait Loci for Life Span in Drosophila melanogaster: Interactions With Genetic Background and Larval Density
Genetics, August 1, 2000; 155(4): 1773 - 1788.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
A. Antebi, W.-H. Yeh, D. Tait, E. M. Hedgecock, and D. L. Riddle
daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans
Genes & Dev., June 15, 2000; 14(12): 1512 - 1527.
[Abstract] [Full Text]


Home page
GeneticsHome page
D. Gems and D. L. Riddle
Genetic, Behavioral and Environmental Determinants of Male Longevity in Caenorhabditis elegans
Genetics, April 1, 2000; 154(4): 1597 - 1610.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
S. Paradis, M. Ailion, A. Toker, J. H. Thomas, and G. Ruvkun
A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans
Genes & Dev., June 1, 1999; 13(11): 1438 - 1452.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Jonassen, P. L. Larsen, and C. F. Clarke
A dietary source of coenzyme Q is essential for growth of long-lived Caenorhabditis elegans clk-1 mutants
PNAS, January 16, 2001; 98(2): 421 - 426.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-C. Labbe, J. Burgess, L. A. Rokeach, and S. Hekimi
ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation
PNAS, November 21, 2000; 97(24): 13233 - 13238.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. J.M. Jones, D. L. Riddle, A. T. Pouzyrev, V. E. Velculescu, L. Hillier, S. R. Eddy, S. L. Stricklin, D. L. Baillie, R. Waterston, and M. A. Marra
Changes in Gene Expression Associated with Developmental Arrest and Longevity in Caenorhabditis elegans
Genome Res., August 1, 2001; 11(8): 1346 - 1352.
[Abstract] [Full Text] [PDF]