- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Slade, R. W.
- Articles by Burton, H. R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Slade, R. W.
- Articles by Burton, H. R.
Molecular Population Genetics of the Southern Elephant Seal Mirounga leonina
Robert W. Slade1,a,b, Craig Moritza, A. Rus Hoelzel2,c, and Harry R. Burtonda Department of Zoology, University of Queensland, 4072, Australia,
b Centre for Molecular and Cellular Biology, University of Queensland, 4072, Australia,
c National Cancer Institute, Frederick, Maryland 21702
d Australian Antarctic Division, Kingston, Tasmania, 7002, Australia
Corresponding author: Robert W. Slade, Queensland Institute of Medical Research, Post Office, Royal Brisbane Hospital, Queensland 4029, Australia., roberts{at}qimr.edu.au (E-mail).
Communicating editor: R. R. HUDSON
| ABSTRACT |
|---|
Southern elephant seals breed on sub-Antarctic islands and have a circumpolar distribution. We assayed mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) variation in the three main populations in the south Atlantic, south Indian, and south Pacific oceans, and a smaller continental population in South America. Population structure of mtDNA was strong and not consistent with isolation by distance. The nDNA loci, although less informative, were consistent with the mtDNA results. Geographic structure appears to be dominated by historical processes, not contemporary gene flow. Uncorrected levels of nucleotide diversity for mtDNA control region I (2.86%) and nDNA (0.09%) were similar to those in humans and mice. Mutation rates for control region I (75 x 10-9 substitutions per site per year) and nDNA (1.23 x 10-9) were similar to those in other mammals. Female effective population size and total effective population size were roughly equal at ~4 x 104, indicating a twofold greater rate of drift for mtDNA. Effective breeding sex ratio of four to five females per male was estimated from nucleotide diversity and mutation rates for mtDNA and nDNA, and was much less than behavioral observations would suggest. There was no evidence for selection at any of the assayed loci.
THE southern elephant seal Mirounga leonina has a circumpolar distribution, and breeding colonies are concentrated on sub-Antarctic islands near the Antarctic convergence (Figure 1). The three main populations are centered on South Georgia (SG) in the south Atlantic Ocean, the geographically close Heard (HD) and Kerguelen Islands in the south Indian Ocean, and Macquarie Island (MQ) in the south Pacific Ocean (![]()
![]()
![]()
![]()
![]()
![]()
|
Recent studies on population size change have also indicated similarities between HD and MQ compared with SG. Population size was estimated as 350,000 for SG, 80,000 for HD, 157,000 for Kerguelen, and 136,000 for MQ, and the three main populations account for 96% of total population size (![]()
![]()
![]()
![]()
One of the aims of this study was to assess the extent of geographic structure in the southern elephant seal and to determine if the genetic relationship between populations corresponded to the relationship indicated by the morphometric and demographic studies. A previous study analyzed the genetic relationship between only the MQ and HD populations, between which there were significant differences in allozyme frequency (![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Samples and molecular methods:
The southern elephant seal blood tissue samples from Macquarie Island (MQ) in the south Pacific Ocean and Heard Island (HD) in the south Indian Ocean were collected by the Australian Antarctic Division. Samples from South Georgia (SG) in the south Atlantic Ocean were collected by the British Antarctic Survey using ronguers to clip ~12 g of skin from the webbing in the rear flippers. The MQ and HD samples were from beaches representing the geographic extremes of each island. The samples from other pinniped species were described in ![]()
![]()
![]()
|
For mtDNA, amplification with the THR and TDKD primers from 15 individuals (5 from each major population) resulted in 444 bp of sequence data, and analysis focused on a highly variable 299-bp subset comprising all 264 bp of control region I (CRI) and 35 bp of flanking sequence. This CRI subset corresponds to sites 67365 in the GenBank sequence. (All site numbers refer to the sequences in GenBank; accession numbers in Table 1.) This enabled us to make direct use of published mtDNA sequence data (![]()
For nDNA, an ~800-bp gene fragment of the ß-globin gene, spanning exons 23, was amplified with primers BETA3/BETA4 using cycling parameters of 35 x 94° for 1 min, 65° for 1 min, 72° for 3 min; 168 bp at the 5' end was sequenced with BETA3, and 351 bp at the 3' end was sequenced with BETA4. Sequencing with the BETA4 primer revealed a pentameric microsatellite (GGAAA)n, the 3' end of which was located 297 bp upstream from the beginning of exon 3. Primers BETA6 and BETA5 were designed to regions flanking the microsatellite. The BETA6/BETA5 amplified product consisted of 149 bp of flanking sequence and from 6 to 20 repeats. The cycling parameters for BETA6/BETA5 were 35 x 94° for 1 min, 65° for 1 min, 72° for 1 min. An ~260-bp fragment of the Corticotropin-releasing factor gene was amplified and sequenced with primers OSCRFA1/OSCRFA2 using cycling parameters of 35 x 94° for 1 min, 50° for 1 min, and 72° for 1 min. An ~1-kb fragment of the lysozyme gene was amplified with primers LYSO1/LYSO2 using cycling parameters of 35 x 94° for 1 min, 55° for 1 min, 72° for 3 min, and 303 bp at the 5' end was sequenced using LYSO1, and 311 bp at the 3' end was sequenced with LYSO2. The PCR primers not described previously are (5'
3') LYSO1 (AGGTCTTTGRACGDTGTGA), LYSO2 (GGGGTTTTGCCATCATTACA), DQA4 (ACACATACCATTGGTAG), BETA6 (AATTGGGCATGTGATGTATGAG), and BETA5 (AATTAGTATGATGCTGGGCTGTC).
For microsatellite PCR, the BETA5 primer was end-labeled with [
-33P]dATP according to a standard protocol (![]()
![]()
![]()
For each sequence with a variant nucleotide site, a computer search was made using the "MacVector" program (IBI-Kodak) for corresponding variant restriction sites. For mtDNA CRI there were several variant restriction sites, and three enzymes (RsaI, FokI, BslI) were chosen, on the basis of their geographic distribution, to use in a large-scale survey (Figure 2A). For ALD-A (Figure 2B), there was a variant site at position 202 that was part of a NspI restriction site (![]()
![]()
|
Data analysis:
For those nDNA sequences with multiple variant sites (i.e., ALD-A and Lysozyme), the haplotypes were determined. For ALD-A, the method of phase determination was described in ![]()
![]()
The pairwise genetic distances between sequences were calculated with the "MEGA" program (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Nucleotide diversity within populations was calculated as in equation 10.6 in ![]()
![]()
![]()
The distribution of genetic variation between populations was estimated in several ways. For CRI data only, we utilized a procedure analogous to analysis of variance with the "AMOVA" program (![]()
![]()
2 tests of independence were conducted using "Monte" (![]()
![]()
To estimate levels of long-term gene flow, we calculated analogs of GST between pairs of populations from the CRI sequence data and from the nDNA allele frequency data. For the CRI sequence data, estimates of GST were calculated between pairs of populations as KST =
(![]()
, where
= (
)2 and n is the number of populations exchanging migrants (![]()
![]()
(![]()
The CRI sequences were analyzed for any pattern of selection among haplotypes using the methods of ![]()
![]()
![]()
![]()
2 test means that it is an appropriate first choice and that, subsequently, any significant associations can be revisited with the more conservative HKA test. For comparisons between mtDNA and nDNA sequences, the difference in effective population size needs to be accounted for (![]()
The total effective population size (N) and the female effective population size (Nf) were estimated from the formulae
= 4Nug and
= 2Nfug, respectively. The neutral parameter
was taken to be equivalent to nucleotide diversity (
). The mutation rate per site per generation (ug) was calculated as the mutation rate per year multiplied by the generation time. The generation time for the southern elephant seal of 8 yr was calculated from female life tables of the stable population at South Georgia (![]()
, where x is age in years, lx is the proportion of females surviving to age x, and mx is the number of females produced per female at age x (![]()
n and
mt) for nDNA and mtDNA, respectively. The mutation rates do not depend on effective population size, although diversity does, and so for neutrally evolving sequences, and assuming mutation-drift equilibrium, the following should be true:
![]() |
(1) |
N is composed of male and female components such that N =
(![]()
![]() |
(2) |
| RESULTS |
|---|
From mtDNA, we analyzed 299 bp of CRI from 60 individuals and assayed three diagnostic restriction sites from 115 individuals. From nDNA we sequenced 3594 bp of mostly noncoding regions from seven single-copy loci from 6 haplotypes (three individuals) from the geographic extremes of the range, and 877 bp of this was sequenced from 30 haplotypes. Three nDNA diagnostic markers (restriction site, indel, microsatellite) were assayed from ~186 haplotypes.
Sequence variation:
nDNA:
The pilot analysis of one individual per main population of SG, HD, and MQ (i.e., a total of 6 haplotypes) detected variation in 7 of the 15 nDNA gene segments (Table 1). From this initial screening, several segments were selected to increase the sample size from one individual per population to five individuals per population (i.e., a total of 30 haplotypes). The segments chosen for further analysis were ALD-A, exons 2 and 3 of Mhc-DQA, and two segments of ß-globin. Subsequently, it was discovered that two ß-globin loci were being amplified simultaneously and that it was not possible to distinguish alleles from loci (see MATERIALS AND METHODS). Therefore, the 734 bp of ß-globin sequence was not included in further analyses of sequence variation. The 3594 bp of nDNA analyzed (excluding the 734 bp of ß-globin) comprised 877 bp sequenced from 30 haplotypes and 2717 bp sequenced from 6 haplotypes. Of the total 3594 bp, there were 2838 bp of silent sites comprised of 467 bp sequenced from 30 haplotypes and 2371 bp sequenced from 6 haplotypes. The silent sites were assumed to be the synonymous sites in exons, all intron sites except for the AG/GT splice sites, and all of the 5' UTR and pseudogene sites.
The variants detected included 9-point substitutions, a 6-bp indel, and a pentameric microsatellite. Of the nine variant sites, five were found in introns, two were silent polymorphisms in exons, and there were two nonsynonymous polymorphisms, glycine/arginine in exon 2 of Mhc-DQA and glycine/arginine in exon 2 of Lysozyme. There were five transitions and four transversions resulting in a roughly twofold bias of transitions over transversions. The total diversity (uncorrected) for nDNA of 0.09 ± 0.03% was calculated from 877 bp from 30 haplotypes and 2717 bp from 6 haplotypes. The level of silent site diversity of 0.08 ± 0.03% was calculated from 467 bp from 30 haplotypes and 2371 bp from 6 haplotypes. The diversity calculated from the samples from the initial screening was the same, and therefore we assume that no systematic bias was introduced by selecting some gene fragments for further sampling. Phase was determined for those nDNA genes with more than one polymorphic site, ALD-A and Lysozyme. For ALD-A, the phase of the variant sites is shown in Figure 2B. for Lysozyme, the T/C polymorphism at site 239 was in phase with the A/G polymorphism at site 273.
mtDNA:
The level of polymorphism in the 299 bp of mtDNA CRI sequence was considerably higher with 16 different haplotypes observed from 15 individuals, 5 from each of the three main populations (Table 1, Figure 2A). One HD individual was heteroplasmic. All 26 variant sites were transitions. All further analyses of CRI sequence variation combined this data set of 16 sequences with the data set of ![]()
![]()
2 = 161.3, P < 0.001) but did fit a negative-binomial distribution (
2 = 0.98, P > 0.25). The scale parameter for the negative-binomial distribution was estimated by maximum-likelihood as 0.1042, and therefore we supplied this to the Tamura-Nei gamma model of pairwise distances giving a nucleotide diversity of 4.75 ± 2.67%.
Selection:
Using the method of ![]()
![]()
2 test of independence on all the variant nDNA sequences and the 60 CRI sequences showed no significant deviations from the neutral expectation of levels of polymorphism within species, given the number of fixed differences between species.
Rate of molecular evolution, Ne and Nf:Nm:
The rate of neutral evolution for ~1200 bp of silent sites in pinniped nDNA (see Table 1 for genes sequenced) was previously estimated with a Kimura two-parameter model (![]()
![]()
![]()
The total effective population size of roughly Ne = 4 x 104 (Table 2) was calculated from the silent site nucleotide diversity given above. We considered that there was not enough nDNA variation to properly estimate Ne within populations. The female effective population size calculated from the 60 CRI sequences was roughly Nf = 4 x 104, and each of the three main populations has an Nf of roughly 23 x 104 (Table 2). The PV population is an order of magnitude smaller than the other southern elephant seal populations, and the effective number of northern elephant seals is an order of magnitude smaller than that for the southern elephant seal. The effective breeding ratio was estimated from Equation 2 to be four to five females to one male.
|
Geographic structure:
Distribution of CRI sequence variation:
The levels of CRI nucleotide diversity and divergence within and between populations are shown in Table 3. Diversity was highest within the SG and HD populations and very low by comparison in the PV population. The greatest divergence was between the PV and MQ populations, and the least was between the SG and HD populations. Although PV and SG are in the same oceanic region, there is almost an order of magnitude of greater divergence between those two populations than between the separate oceanic populations of SG and HD. The AMOVA results showed that 57% of CRI variation was distributed between populations. This distribution of mtDNA variation was significantly different from random (P < 0.001).
|
For a hierarchical AMOVA, we compared oceanic regions, with SG and PV representing the south Atlantic ocean, HD the south Indian ocean, and MQ the south Pacific ocean. This resulted in a decomposition of variation of -5% among the three oceanic regions, 61% among SG and PV within the south Atlantic oceanic region, and 44% within populations. The breakdown into oceanic regions thus explained none of the variation. This is because of heterogeneity within the south Atlantic ocean between SG and PV and the close relationship between haplotypes from SG and HD representing different regions.
Distribution of nDNA allele and CRI haplotype frequencies:
Diagnostic markers were screened in ~30 individuals from each of the three main populations. For CRI, the combined RFLP haplotypes and their population frequencies are shown in Figure 3. Most haplotypes were found in more than one population; however, none of the MQ haplotypes were shared with HD, SG, or PV. Haplotype frequency differences were analyzed by
2, and significant heterogeneity was found among all populations (
2 = 224.76, P < 0.001). For each of the pairwise comparisons, there was significant heterogeneity (P < 0.001 for each comparison).
|
For the nDNA loci, the markers analyzed were the presence/absence of the Mhc-DQA 6-bp deletion, the ALD-A NspI restriction site, and the two ß-globin pentameric microsatellites (Table 4). There were no departures from the Hardy-Weinberg equilibrium (HWE) for genotypes at the Mhc-DQA or ALD-A loci. The ß-globin microsatellite data were not tested for HWE because single-locus genotypes could not be determined. There was no significant heterogeneity among the three populations for alleles at the Mhc-DQA and ALD-A loci. The
2 analysis of the two microsatellite loci treated them as a single multiallelic locus in a tetraploid. This approach (![]()
![]()
![]()
![]()
![]()
![]()
|
Gene flow:
For the 60 CRI sequences, the spatial variance of gene frequency (KST), the number of female migrants exchanged between populations per generation (Nfmf), and the proportion of female migrants exchanged per generation (mf) were estimated from the uncorrected and Tamura-Nei corrected distances (Table 5). To estimate mf from Nfmf, Nf was assumed to be the arithmetic mean of the Nf estimates from the two populations (![]()
![]()
|
Time since divergence: An alternative approach is to assume that there has been no gene flow between populations and that the level of nucleotide divergence between populations reflects only time since population divergence. The time of divergence between southern elephant seal populations and between the southern and northern elephant seal populations was estimated from CRI data using the Tamura-Nei net divergences and the estimated mutation rate of 75 x 10-9 (Table 6). In this historical association model, MQ and PV last shared a common ancestral population some 600,000 yr ago, SG and HD separated as recently as 20,000 yr ago, whereas all other population divergences occurred some 200,000300,000 yr ago. The northern and southern elephant seals were estimated to have diverged 800,000 yr ago.
|
| DISCUSSION |
|---|
In this study, we assessed the contribution of mutation rate, effective population size, gene flow, and selection to the amount and distribution of genetic variation in some regions of mtDNA and nDNA of the southern elephant seal.
Selection:
Two approaches were used to infer that selection had not played a significant role in the level or distribution of genetic variation in the gene regions analyzed. First, selection can be detected from patterns of DNA sequence variation using several recently developed methods (![]()
![]()
![]()
![]()
![]()
![]()
Mutation rate, genetic diversity, and effective population size:
The rate of silent substitution in pinniped nDNA was previously estimated as 1.23 ± 0.24 substitutions per site per 109 yr (![]()
![]()
![]()
![]()
![]()
![]()
The rate of mtDNA evolution was estimated for 299 bp of CRI and was calibrated against only the 4.5 mya fossil-record date. Other calibrations were not possible because of alignment difficulties between more divergent sequences. The rate of evolution in CRI was estimated as 75 ± 46 x 10-9. It is clear that the rate is at least an order of magnitude higher than that for nDNA, and it may be close to two orders of magnitude higher. In terms of percent change, the nDNA is evolving at roughly 0.1%/million years (myr) along a lineage, and the mtDNA CRI is evolving at a rate of 510%/myr. The rate of substitution averaged over the entire mtDNA molecule in other animals was estimated as roughly 1%/myr along a lineage (![]()
![]()
![]()
![]()
![]()
![]()
The uncorrected level of nucleotide diversity in the 299 bp of CRI was 2.86 ± 0.49%. This is among the higher levels so far observed among vertebrate species (see Table 2 in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
Given that the neutral mutation rate and nucleotide diversity in southern elephant seal nDNA is similar to that found in humans, it is not surprising, then, that the total effective population size (Ne) of 4 x 104 is also similiar to that in humans, which is ~104 to 105 depending on the time scale over which the estimates are calculated (![]()
![]()
![]()
![]()
We estimated the effective breeding ratio as four to five females to one male. This ratio is perhaps lower than expected considering that, in one study, the average number of cows per bull in a harem varied between 28 and 53 (![]()
![]()
![]()
![]()
![]()
![]()
Geographic structure:
This is the first global survey of genetic variation in the southern elephant seal. For mtDNA, there was significant geographic structure among the four populations of the southern elephant seal for distribution of sequence variation and distribution of haplotype frequencies. A previous phylogeographic analysis had also shown geographic structure for distribution of lineages (![]()
![]()
![]()
![]()
Difference between mtDNA and nDNA:
Differences between mtDNA and nDNA in the level of observed geographic structure may reflect either differences in rates of gene flow between males and females, or differences in characteristics of the genes, such as mutation rate and/or rate of genetic drift. If males and females have an equal probability of migrating, then Nm is expected to be twice that of Nfmf. The observed result showing Nm between HD and MQ to be five to eight times greater than Nfmf suggests that the rate of male gene flow may be up to four times greater than female gene flow. The result must be viewed cautiously, because the estimate of Nfmf was derived from one locus, and because the estimate of Nm was derived from only one pairwise population comparison. Nonetheless, male-biased gene flow is consistent with ecological studies on dispersal of male and female southern elephant seals (![]()
![]()
However, we suggest that most of the difference between mtDNA and nDNA in the observed level of geographic structure is accounted for by differences in the characteristics of the genes. The greater sensitivity of mtDNA compared with nDNA is usually explained by two factors: its smaller effective population size and its higher mutation rate (![]()
![]()
![]()
![]()
Gene flow vs. historical association:
Geographic structure reflects some combination of contemporary levels of gene flow and recent historical association. Considering the former, the dispersal capacity of adult males and females is such that movement between oceanic regions is certainly possible. The longest interisland movement recorded was some 3000 km between Heard and Marion Islands in the south Indian ocean (![]()
![]()
![]()
![]()
If historical association, rather than contemporary gene flow, dominates the observed geographic structure of the southern elephant seal, then how do we explain the close genetic relationship between HD and SG, despite their being as geographically separate as HD and MQ? In the historical model, SG and HD separated as recently as 20,000 yr ago, and all other population divergences occurred over 200,000 yr ago. We suggest that the estimated relatively recent separation time between SG and HD is linked with the last ice age 18,000 yr ago (CLIMAP 1976). It is likely that the distribution of southern elephant seals during that period would have been different from the current distribution, because of the unsuitability of current breeding beaches that were iced over at that time (R. W. SLADE, unpublished results). Rather than being distributed on sub-Antarctic islands, the southern elephant seal was probably distributed primarily on the southern edge of the continental land masses of Australia, Africa, and South America, and we suggest that at that time HD and SG were a single breeding population on the coast of South Africa. Records of southern elephant seals in South Africa indicate that it is currently used as a haul-out for immature seals to moult, although several births have occurred there also (![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Queensland Institute of Medical Research, Australia. ![]()
2 Present address: Biological Sciences, University of Durham, England. ![]()
| ACKNOWLEDGMENTS |
|---|
Thanks to HAMISH MCCALLUM, YUKI TAKAHATA, and MONTY SLATKIN for advice; TOM ARNBOM and IAN BOYD for sample collection at South Georgia; CHRIS SCHNEIDER, DICK HUDSON, and two reviewers for comments on the manuscript; and especially ANITA HEIDEMAN for assistance in the lab. This work was funded principally by grant no. 66 from The Antarctic Science Advisory Committee of Australia. Logistic and financial support was also provided by The Australian Antarctic Division.
Manuscript received August 19, 1997; Accepted for publication May 11, 1998.
| LITERATURE CITED |
|---|
AMOS, W., S. TWISS, P. P. POMEROY, and S. S. ANDERSON, 1993 Male mating success and paternity in the grey seal, Halichoerus grypus: a study using DNA fingerprinting. Proc. R. Soc. Lond. Ser B 252:199-207[Medline].
AQUADRO, C. R., 1992 Why is the genome variable? Insights from Drosophila. Trends Genet. 8:355-362[Medline].
BARTLEY, D. M. and G. A. E. GALL, 1990 Genetic structure and gene flow in chinook salmon populations of California. Trans. Am. Fish. Soc. 119:55-71.
BEGON, M., J. L. HARPER and C. R. TOWNSEND, 1986 Ecology. Blackwell Scientific Publications, Oxford.
BIRKY, C. W., JR., T. MARUYAMA, and P. FUERST, 1983 An approach to population and evolutionary genetic theory for genes in mitochondria and chloroplasts, and some results. Genetics 103:513-527
BLISS, C. I. and R. A. FISHER, 1953 Fitting the negative binomial distribution to biological data and note on the efficient fitting of the negative binomial. Biometrics 9:176-200.
BRAVERMAN, J. M., R. R. HUDSON, N. L. KAPLAN, C. H. LANGLEY, and W. STEPHAN, 1995 The hitchhiking effect on the site frequency spectrum of DNA polymorphisms. Genetics 140:783-796[Abstract].
BROWN, W. M., E. M. PRAGER, A. WANG, and A. C. WILSON, 1982 Mitochondrial DNA sequences in primates: tempo and mode of evolution. J. Mol. Evol. 18:225-239[Medline].
BRYDEN, M. M., 1968 Control of growth in two populations of elephant seals. Nature 17:1106-1108.
CAMPAGNA, C. and M. LEWIS, 1992 Growth and distribution of a southern elephant seal colony. Marine Mam. Sci. 8:387-396.
CARRICK, R., S. E. CSORDAS, and S. E. INGHAM, 1962a Studies on the southern elephant seal, Mirounga leonina (L.). IV. Breeding and development. C.S.I.R.O. Wildlife Res. 7:161-197.
CARRICK, R., S. E. CSORDAS, S. E. INGHAM, and K. KEITH, 1962b Studies on the southern elephant seal, Mirounga leonina (L.). III. The annual cycle in relation to age and sex. C.S.I.R.O. Wildlife Res. 7:119-160.
CHAKRABORTY, R. and M. NEI, 1974 Dynamics of gene differentiation between incompletely isolated populations of unequal sizes. Theor. Pop. Biol. 5:460-469[Medline].
CLARK, A. G., 1990 Inferences of haplotypes from PCR-amplified samples of diploid populations. Mol. Biol. Evol. 7:111-122[Abstract].
CLIMAP PROJECT MEMBERS,, 1976 The surface of the ice-age earth. Science 191:1131-1137
CRAWLEY, M. J., 1993 Glim for Ecologists. Blackwell, Oxford.
CROW, J. F. and K. AOKI, 1984 Group selection for a polygenic behavioral trait: estimating the degree of population subdivision. Proc. Natl. Acad. Sci. USA 81:6073-6077
DON, R. H., P. T. COX, B. J. WAINWRIGHT, K. BAKER, and J. S. MATTICK, 1991 Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19:4008
EASTEAL, S., 1990 The pattern of mammalian evolution and the relative rate of molecular evolution. Genetics 124:165-173[Abstract].
EXCOFFIER, L., P. E. SMOUSE, and J. M. QUATTRO, 1992 Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131:479-491[Abstract].
FELSENSTEIN, J., 1993 PHYLIP (Phylogeny Inference Package) version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle.
FRANKHAM, R., 1994 Conservation of genetic diversity for animal improvement. Proc. 5th World Congr. Genetics Appl. Livestk. Prod. 21:385-392.
FU, Y. X. and W. H. LI, 1993 Statistical tests of neutrality of mutations. Genetics 133:693-709[Abstract].
GALES, N. J., M. ADAMS, and H. R. BURTON, 1989 Genetic relatedness of two populations of the southern elephant seal, Mirounga leonina.. Mar. Mamm. Sci. 5:57-67.
GALL, G. A. E., D. BARTLEY, B. BENTLEY, J. BRODZIAK, and R. GOMULKIEWICZ et al., 1992 Geographic variation in population genetic structure of chinook salmon from California and Oregon. Fish. Bull. (U.S.) 90:77-100.
GHARRETT, A. J., S. M. SHIRLEY, and G. R. TROMBLE, 1987 Genetic relationships among populations of Alaskan chinook salmon (Oncorhynchus tshawytscha). Can. J. Fish. Aquat. Sci. 44:765-774.
HINDELL, M. A., 1991 Some life-history parameters of a declining population of southern elephant seals, Mirounga leonina.. J. Anim. Ecol. 60:119-134.
HINDELL, M. A. and H. R. BURTON, 1987 Past and present status of the southern elephant seal (Mirounga leonina) at Macquarie Island. J. Zool. Lond. 213:365-380.
HINDELL, M. A., H. R. BURTON, and D. J. SLIP, 1991 Foraging areas of southern elephant seals, Mirounga leonina, as inferred from water temperature data. Austral. J. Mar. Freshwater Res. 42:115-128.
HOELZEL, A. R., J. HALLEY, S. J. O'BRIEN, C. CAMPAGNA, and T. ARNBOM et al., 1993 Elephant seal genetic variation and the use of simulation models to investigate historical population bottlenecks. J. Hered. 84:443-449
HORAI, S., K. HAYASAKA, R. KONDO, K. TSUGANE, and N. TAKAHATA, 1995 Recent African origin of modern humans revealed by complete sequences of hominoid mitochondrial DNAs. Proc. Natl. Acad. Sci. USA 92:532-536
HUDSON, R. R., M. KREITMAN, and M. AGUADÉ, 1987 A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159
HUDSON, R. R., M. SLATKIN, and W. P. MADDISON, 1992 Estimation of levels of gene flow from DNA sequence data. Genetics 132:583-589[Abstract].
ISHIDA, N., T. OYUNSUREN, S. MASHIMA, H. MUKOYAMA, and N. SAITOU, 1995 Mitochondrial DNA sequences of various species of the genus Equus with special reference to the phylogenetic relationship between Przewalskii's wild horse and domestic horse. J. Mol. Evol. 41:180-188[Medline].
KOCHER, T. D., and A. C. WILSON, 1991 Sequence evolution of mitochondrial DNA in humans and chimpanzees: control region and a protein-coding region, pp. 391413 in Evolution of LifeFossils, Molecules and Culture, edited by S. OSAWA and T. HONJO. Springer-Verlag, Berlin.
KREITMAN, M. E. and M. AGUADÉ, 1986 Excess polymorphism at the Adh locus in Drosophila melanogaster.. Genetics 114:93-110
KUMAR, S., K. TAMURA and M. NEI, 1993 MEGA: molecular evolutionary genetics analysis, version 1.0. The Pennsylvania State University, University Park, PA.
LAMBERT, D. M., C. D. MILLAR, K. JACK, S. ANDERSON, and J. L. CRAIG, 1994 Single- and multilocus DNA fingerprinting of communally breeding pukeko: do copulations or dominance ensure reproductive success? Proc. Natl. Acad. Sci. USA 91:9641-9645
LESSA, E. and G. APPLEBAUM, 1993 Screening techniques for detecting allelic variation in DNA sequences. Mol. Ecol. 2:121-129.
LI, W. H. and L. A. SADLER, 1991 Low nucleotide diversity in man. Genetics 129:513-523[Abstract].
LI, W. H., M. C. TANIMURA, and P. M. SHARP, 1987 An evaluation of the molecular clock hypothesis using mammalian DNA sequences. J. Mol. Evol. 25:330-342[Medline].
LING, J. K., and M. M. BRYDEN, 1992 Mirounga leonina, No. 391, in Mammalian Species, edited by C. S. HOOD. Am. Soc. Mammalogists.
LYDEKKER, R., 1909 On the skull-characters in the southern sea-elephant. Proc. Zool. Soc. Lond. 1909: 600606.
MCCANN, T. S., 1985 Size, status and demography of southern elephant seals (Mirounga leonina) populations, pp. 117 in Studies of Sea Mammals in South Latitudes, edited by J. K. LING and M. M. BRYDEN. South Australian Museum, Adelaide.
MCCANN, T. S. and P. ROTHERY, 1988 Population size and status of the southern elephant seal (Mirounga leonina) at South Georgia, 19511985. Polar Biol. 8:305-309.
MCCONNELL, B. J. and M. A. FEDAK, 1996 Movements of southern elephant seals. Can. J. Zool. 74:1485-1496.
MCELROY, D., P. MORAN, E. BERMINGHAM, and I. KORNFIELD, 1992 REAP: an integrated environment for the manipulation and phylogenetic analysis of restriction data. J. Hered. 83:157-158
MOORE, S. S., W. BARENDSE, K. T. BERGER, S. M. ARMITAGE, and D. J. S. HETZEL, 1992 Bovine and ovine DNA microsatellites from the EMBL and GENBANK databases. Anim. Genet. 23:463-467[Medline].
NACHMAN, M. W., 1997 Patterns of DNA variability at X-linked loci in Mus domesticus.. Genetics 147:1303-1316[Abstract].
NACHMAN, M. W., S. N. BOYER, and C. F. AQUADRO, 1994 Nonneutral evolution at the mitochondrial NADH dehydrogenase subunit 3 gene in mice. Proc. Natl. Acad. Sci. USA 91:6364-6368
NEI, M., 1987 Molecular Evolutionary Genetics. Columbia University Press, New York.
NEI, M. and L. JIN, 1989 Variances of the average numbers of nucleotide substitutions within and between populations. Mol. Biol. Evol. 6:290-300[Abstract].
NEVO, E., A. BEILES and R. BEN-SHLOMO, 1984 The evolutionary significance of genetic diversity: ecological, demographic and life history correlates, pp. 13213 in Evolutionary Dynamics of Genetic Diversity, edited by G. S. MANI. Springer-Verlag, Berlin.
OOSTHUIZEN, W. H., J. H. M. DAVID, and G. J. B. ROSS, 1988 New records of southern elephant seals Mirounga leonina L. on the coast of southern Africa. South Afr. J. Marine Sci. 7:75-86.
PEMBERTON, D. and I. J. SKIRA, 1989 Elephant seals in Tasmania. Victorian Naturalist 106:202-204.
PEMBERTON, J. M., S. D. ALBON, F. E. GUINESS, T. H. CLUTTON-BROCK, and G. A. DOVER, 1992 Behavioural estimates of male mating success tested by DNA fingerprinting in a polygynous mammal. Behav. Ecol. 3:66-75
RAY, C. E., 1976 Geography of phocid evolution. Syst. Zool. 25:391-406.
ROFF, D. A. and P. BENTZEN, 1989 The statistical analysis of mitochondrial DNA polymorphisms:
2 and the problem of small samples. Mol. Biol. Evol. 6:539-545[Abstract].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SARICH, V. M., 1985 Rodent macromolecular systematics, pp. 423452 in Evolutionary Relationships Among Rodents: A Multidisciplinary Analysis, edited by W. P. LUCKETT and J. L. HARTENBERGER. NATO ASI Series, Plenum Press, New York.
SEAL, U. S., A. W. ERICKSON, D. B. SINIFF and R. J. HOFFMAN, 1971 Biochemical, population genetic, phylogenetic and cytological studies of Antarctic seal species, pp. 7795 in Symposium on Antarctic Ice and Water Masses, edited by G. DEACON. Science Committee for Antarctic Research, Cambridge, UK.
SIMONSEN, K. L., G. A. CHURCHILL, and C. F. AQUADRO, 1995 Properties of statistical tests of neutrality for DNA polymorphism data. Genetics 141:413-429[Abstract].
SLADE, R. W., 1998 Genetic studies of the southern elephant seal, Mirounga leonina, pp. 1129 in Marine Mammal Research in the Southern Hemisphere Volume 1: Status Ecology, and Medicine, edited by M. HINDELL and C. KEMPER. Surrey Beatty & Sons, Chipping Norton, Australia.
SLADE, R. W., C. MORITZ, A. HEIDEMAN, and P. T. HALE, 1993 Rapid assessment of single copy nuclear DNA variation in diverse species. Mol. Ecol. 2:359-373[Medline].
SLADE, R. W., C. MORITZ, and A. HEIDEMAN, 1994 Multiple nuclear-gene phylogenies: application to pinnipeds and comparison with a mitochondrial DNA gene phylogeny. Mol. Biol. Evol. 11:341-356[Abstract].
SOKAL, R. R., and F. J. ROHLF, 1969 Biometry. W. H. Freeman and Company, San Francisco.
STONEKING, M., S. T. SHERRY, A. J. REDD, and L. VIGILANT, 1992 New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B 337:167-175[Medline].
SWOFFORD, D. L., and R. B. SELANDER, 1989 BIOSYS-1: a computer program for the analysis of allelic variation in population genetics and biochemical systematics. Release 1.7. Illinois Natural History Survey, Champaign.
TAJIMA, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595
TAKAHATA, N., 1993 Allelic genealogy and human evolution. Mol. Biol. Evol. 10:2-22[Abstract].
TAKAHATA, N. and F. TAJIMA, 1991 Sampling errors in phylogeny. Mol. Biol. Evol. 8:494-502.
TAMURA, K. and M. NEI, 1993 Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10:512-526[Abstract].
UTTER, F. M., R. S. WAPLES, and D. J. TEEL, 1992 Genetic isolation of previously indistinguishable chinook salmon populations of the Snake and Klamath rivers: limitations of negative data. Fish. Bull. (U.S.) 90:770-777.
VIGILANT, L., M. STONEKING, H. HARPENDING, K. HAWKES, and A. C. WILSON, 1991 African populations and the evolution of human mitochondrial DNA. Science 253:1503-1507
WAKELEY, J., 1993 Substitution rate variation among sites in hypervariable region 1 of human mitochondrial DNA. J. Mol. Evol. 37:613-623[Medline].
WAPLES, R. S., 1988 Estimation of allele frequencies at isoloci. Genetics 118:371-384
WAPLES, R. S. and P. B. AEBERSOLD, 1990 Treatment of data for duplicated gene loci in mixed-stock fishery analysis. Can. J. Fish. Aquat. Sci. 47:2092-2098.
WEBER, J. L. and C. WONG, 1993 Mutations of human short tandem repeats. Hum. Mol. Genet. 2:1123-1128
WILSON, A. C., R. L. CANN, S. M. CARR, M. GEORGE, and U. B. GYLLENSTEIN et al., 1985 Mitochondrial DNA and two perspectives on evolutionary genetics. Biol. J. Linn. Soc. 26:375-400.
WILSON, A. C., H. OCHMAN, and E. M. PRAGER, 1987 Molecular time scale for evolution. Trends Genet. 3:241-247.
WRIGHT, S., 1931 Evolution in Mendelian populations. Genetics 16:97-159
This article has been cited by other articles:
![]() |
R.A Campbell, N.J Gales, G.M Lento, and C.S Baker Islands in the sea: extreme female natal site fidelity in the Australian sea lion, Neophoca cinerea Biol Lett, February 23, 2008; 4(1): 139 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Rogers Evolution and biodiversity of Antarctic organisms: a molecular perspective Phil Trans R Soc B, December 29, 2007; 362(1488): 2191 - 2214. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pineau, M. Henry, R. Suspene, A. Marchio, A. Dettai, R. Debruyne, T. Petit, A. Lecu, P. Moisson, A. Dejean, et al. A Universal Primer Set for PCR Amplification of Nuclear Histone H4 Genes from All Animal Species Mol. Biol. Evol., March 1, 2005; 22(3): 582 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fabiani, F. Galimberti, S. Sanvito, and A. R. Hoelzel Extreme polygyny among southern elephant seals on Sea Lion Island, Falkland Islands Behav. Ecol., November 1, 2004; 15(6): 961 - 969. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fabiani, A. R. Hoelzel, F. Galimberti, and M. M. C. Muelbert Long-Range Paternal Gene Flow in the Southern Elephant Seal Science, January 31, 2003; 299(5607): 676 - 676. [Full Text] [PDF] |
||||
![]() |
C. W. Matson and R. J. Baker DNA Sequence Variation in the Mitochondrial Control Region of Red-Backed Voles (Clethrionomys) Mol. Biol. Evol., August 1, 2001; 18(8): 1494 - 1501. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Slade, R. W.
- Articles by Burton, H. R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Slade, R. W.
- Articles by Burton, H. R.









