Genetics, Vol. 149, 1353-1362, July 1998, Copyright © 1998

Molecular Evolution of a Sex Determination Protein: FEM-2 (PP2C) in Caenorhabditis

Dave Hansena and Dave Pilgrima
a Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada

Corresponding author: Dave Pilgrim, Department of Biological Sciences, University of Alberta, Edmonton, AB T6G 2E9, Canada, dave.pilgrim{at}ualberta.ca (E-mail).

Communicating editor: R. K. HERMAN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Somatic sex determination in Caenorhabditis elegans involves a signal transduction pathway linking a membrane receptor to a transcription factor. The fem-2 gene is central to this pathway, producing a protein phosphatase (FEM-2) of the type 2C (PP2C). FEM-2 contains a long amino terminus that is absent in canonical PP2C enzymes. The function of this domain is difficult to predict, since it shows no sequence similarity to any other known proteins or motifs. Here we report the cloning of the fem-2 homologue from Caenorhabditis briggsae (Cb-fem-2). The sequence identity is much higher than that observed for other C. briggsae homologues of C. elegans sex determination proteins. However, this level is not uniform across the entire lengths of the proteins; it is much lower in the amino termini. Thus, the two domains of the same protein are evolving at different rates, suggesting that they have different functional constraints. Consistent with this, Cb-FEM-2 is able to replace some, but not all, of the Ce-FEM-2 in vivo function. We show that removal of the amino terminus from Ce-FEM-2 has no effect on its in vitro phosphatase activity, or its ability to replace the in vivo function of a yeast PP2C enzyme, but that it is necessary for proper FEM-2 function in worms. This demonstrates that the amino terminus is not an extended catalytic domain or a direct negative regulator of phosphatase activity.


THE primary sex determination signal in many animals, including the nematode Caenorhabditis elegans, is the ratio of sex chromosomes to sets of autosomes (MADL and HERMAN 1979 Down). In C. elegans, somatic and germline sex (exclusive of dosage compensation) is regulated by a set of gene products whose order and function have been predicted through genetic analysis (HODGKIN 1986 Down). Most of the genes identified through genetic means as being involved in sex determination have been cloned, and their predicted protein products are known (KIMBLE 1988; SPENCE et al. 1990 Down; KUWABARA et al. 1992 Down; ZARKOWER and HODGKIN 1992 Down; PERRY et al. 1993 Down; PILGRIM et al. 1995 Down; BARNES and HODGKIN 1996 Down). This has allowed a molecular model to be developed for the biochemical activities involved in transducing the sex determination signal (KUWABARA and KIMBLE 1992 Down). fem-2 is required for normal male somatic development and spermatogenesis (KIMBLE et al. 1984 Down). Its sequence shows similarity to protein phosphatases type 2C (PP2C), and is most similar to PP2C homologues from plants and humans (PILGRIM et al. 1995 Down). FEM-2 is able to dephosphorylate targets in vitro, and this activity is necessary for FEM-2's masculinizing function (CHIN-SANG and SPENCE 1996 Down).

The areas of similarity among all PP2C enzymes span a region of approximately 260 amino acids (PILGRIM et al. 1995 Down), which is almost the entire length of many PP2C enzymes, including the PP2C enzyme from yeast, Ptc1p (MAEDA et al. 1993 Down; ROBINSON et al. 1994 Down; HUANG and SYMINGTON 1995 Down; JIANG et al. 1995 Down). FEM-2 is a member of Class A PP2C enzymes (PILGRIM et al. 1995 Down), which also includes the Arabidopsis proteins ABI1, ABI2 and KAPP (LEUNG et al. 1994 Down, LEUNG et al. 1997 Down; MEYER et al. 1994 Down; STONE et al. 1994 Down), and a predicted protein of unknown function from humans (NOMURA et al. 1994 Down). They are much larger than Ptc1p due to an additional domain at the amino terminus. With the exception of ABI1 and ABI2, none of the Class A proteins show sequence similarity to each other in their amino termini, suggesting that their functions differ. The amino terminus of KAPP has been shown to interact with the protein kinase RLK5 (STONE et al. 1994 Down), and this binding is thought to regulate KAPP's phosphatase activity. FEM-2's amino terminus could also be involved in regulating PP2C activity. This could be accomplished in a number of ways including binding to a positive or negative regulator, providing target specificity, or determining subcellular localization. It is also possible that it is an integral part of an extended catalytic domain needed for phosphatase activity.

FEM-2's amino terminus does not show similarity to any domains of known biochemical function making it difficult to predict its role in sex determination. One approach to understand its role is to identify and characterize functional homologues of fem-2. The Caenorhabditis briggsae homologues of two other C. elegans sex determining genes have been reported (DE BONO and HODGKIN 1996 Down; KUWABARA 1996 Down). Cb-TRA-1 and Cb-TRA-2 both show surprisingly low amino acid identity to their C. elegans counterpart (44% and 43%, respectively). This level of conservation is much lower than that observed for other, nonsex-determining, C. briggsae homologues that have been identified (e.g., Table 1; DE BONO and HODGKIN 1996 Down), suggesting that the sex-determining genes are diverging much faster than those involved in other developmental processes. It is tempting to speculate that this rapid divergence is due to strong evolutionary pressure on a set of interacting proteins, which must coevolve. Since there is evidence that FEM-2 interacts with other members of the sex determination cascade, at least in vitro (CHIN-SANG and SPENCE 1996 Down), we expect that at least a portion of the FEM-2 sequence should be diverging at the same accelerated rate. It is unlikely that the carboxy terminus is diverging at this high rate due to constraints needed to maintain the PP2C activity; however, we do expect the amino terminus to be diverging at a rate similar to the TRA-1 and TRA-2 homologues from C. elegans and C. briggsae.

Herein we report the cloning of the C. briggsae homologue of fem-2 (Cb-fem-2). The degree of identity between the two predicted proteins is much higher than has previously been reported for other C. elegans sex-determining proteins and their C. briggsae homologues (DE BONO and HODGKIN 1996 Down; KUWABARA 1996 Down), although a higher level of conservation is seen over the PP2C domain than the amino terminus. We show that the amino terminal domain of Ce-FEM-2 is not necessary for in vitro phosphatase activity. Also, Ce-FEM-2 is able to functionally replace the yeast PP2C enzyme, Ptc1p, independent of the presence or absence of this domain. These results suggest that the function of the amino terminal domain is distinct from that of the phosphatase domain and their functions may impose different stringencies of sequence constraints. These different stringencies could cause the amino termini of the C. elegans and C. briggsae FEM-2 proteins to diverge from each other at a much faster rate than the phosphatase domains.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

DNA primers used in this work:
DHA17, 5' CCGAGCACTCAGAGATGTTCC 3'; DHA22, 5' CGACAAGATCTTCCAGCAAAACGC 3'; DHA23, 5' GGATCAGATCTGCGATCGCCGTC 3'; DHB.2, 5' CGGATGGGAATGTATGACTGTGG 3'; DHB.3, 5' GCACTCGTGGCCTCCATGACCATCG 3'; DHB.4, 5' GGTGGACGGAGGAATCCAATGACG 3'; DHB.5, 5' CCACAGTCATACATTCCCATCCG 3'; PJA1, 5' AATTCGTCGACG 3'; PJA2, 5' TCTAGATCTCGAGAGAGAAAATTGGAATACCC 3'; PJA3, 5' TCTAGATCTCGAGATGGAAAAAGTAAACGAGGAG 3'.

Cloning of the C. briggsae homologue:
Southern blotting was performed using C. briggsae genomic DNA digested with various restriction endonucleases and probing with a full-length C. elegans fem-2 cDNA. Hybridization was performed at 50° with three subsequent 15-min 50° washes of 2x SSC, 0.1% sodium dodecyl sulfate (SDS). Autoradiography revealed a single 3.7-kbp band when the C. briggsae DNA was digested with XbaI. A genomic minilibrary was made by gel purifying XbaI-digested C. briggsae DNA that was 3.2–4.0 kbp in size. These fragments were ligated into XbaI-digested pBluescript II SK-, transformed into bacteria, and screened using colony hybridization as described (SAMBROOK et al. 1989 Down). Hybridization and washing conditions for colony hybridization were the same as those used for the Southern blot mentioned above. Analysis of the sequence of a positive clone (pDP#DH42) showed that all of the predicted coding region was contained in the 3.7-kbp XbaI fragment; however not all of the predicted 3' untranslated region (3' UTR) and only 414 bp of upstream sequence was contained in the clone (Figure 1). To get a larger clone, another minilibrary was constructed by digesting HindIII-digested genomic DNA and isolating fragments between 10 and 20 kbp. These were cloned into pBluescript II SK- and transformed into bacteria. pDP#DH42 was used to probe colony lifts. The blots were hybridized at 65° and then, at the same temperature, washed twice with 2x SSC (10 min), once with 2x SSC, 0.1% SDS (15 min) and once with 0.1x SSC (5 min). One positive clone was isolated (pDP#DH53) and confirmed to completely contain pDP#DH42 region by restriction mapping, PCR, and partial sequencing (Figure 1). The sequence of Cb-fem-2 can be obtained from GenBank (accession no. AF054982).



View larger version (6K):
In this window
In a new window
Download PPT slide
 
Figure 1. Restriction map of genomic region containing Cb-fem-2 and location of intron and exon boundaries. The horizontal line represents the C. briggsae genomic DNA insert of clone pDP#DH53. Vertical lines represent restriction enzymes (D, HindIII; K, KpnI; P, PstI; S, SstI; and X, XbaI). The hash marks represent portions of DNA not included on this figure. Clone pDP#DH42 contains the region flanked by the two XbaI sites within the hash marks. Clone pDP#DH53 contains the entire region shown on the restriction map. The distance between the first HindIII site and the second XbaI site is ~4.5 kbp while the distance between the third XbaI site and the final HindIII site is ~7.0 kbp. The numbered arrows show the location of the primers used for RT-PCR and 5' RACE (1, DHB.2; 2, DHB.5; and 3, DHB.4). The black boxes below the line represent coding regions of the six exons.

C. briggsae mRNA transcript analysis:
Total RNA was isolated from hermaphrodite (XX) worms which were grown in liquid culture as described (SULSTON and HODGKIN 1988 Down). Four volumes of TRIZOL (Life Technologies) were added to packed worms and resuspended by vortexing, then incubated at 20° for 5 min. The solution was centrifuged at 16,000 x g (4°) for 10 min and liquid was transferred to a new tube. One-fifth volume of chloroform was added to the solution and vortexed for 15 sec. Centrifugation was performed as described above for 15 min and the aqueous phase was transferred to a new tube containing one volume of isopropanol and incubated for 10 min at 20°. The RNA was recovered by centrifuging at 16,000 x g for 10 min (4°) and the pellet was washed with 75% ethanol and suspended in DEPC-treated water.

A DNA copy of the 5' end of the Cb-fem-2 transcript was obtained by Rapid Amplification of cDNA Ends (RACE) using a 5' RACE Kit (Life Technologies), following the manufacturer's instructions. Primer DHB.4 was used for first strand synthesis and primer DHB.3 was used for PCR amplification (Figure 1). The PCR product was cloned into pGEM-T (Promega, Madison, WI). Sequencing revealed the presence of a trans-spliced leader with the sequence 5'GGTTTAATTACCCAAGTTGAG3', although the number of G's at the 5' end cannot be precisely determined because the RACE protocol used incorporates a string of G's at this location. The leader splices into the sequence UUUCAG*AUG, with * being the site of splicing. The AUG shown (bold) is predicted to encode the initiator methionine. Therefore, as seen in other C. elegans transcripts (BLUMENTHAL and STEWARD 1997 Down), there is no sequence between the trans-spliced leader and the coding region. Since the RACE product contained only one intron splice site, reverse transcription (RT)-PCR was used to obtain a cDNA containing all putative intron splice sites. Primer DHB.4 was used for first strand synthesis and primers DHB.4 and DHB.5 were used for amplification (Figure 1). The product was cloned into pGEM-T (pDP#DH113) and sequenced.

RNA gel electrophoresis and Northern blotting were performed as described (SAMBROOK et al. 1989 Down). Ten micrograms of the total RNA described above was electrophoresed on a 1.3% agarose gel and transferred to GeneScreen Plus nylon membrane (New England Biolabs, Beverly, MA). The RNA was hybridized to a 32P-labeled DNA probe made from the insert of clone pDP#DH113. Hybridization was performed at 65° overnight using Hybridsol II hybridization solution (Oncor). The blot was washed at 65° twice with 2x SSC for 15 min, once with 2x SSC, 0.1% SDS for 30 min and once with 0.1x SSC, 0.1% SDS for 10 min.

Partial rescue of fem-2 animals with C. briggsae clone:
pDP#DH53 was coinjected with pRF4 (rol-6(su1006dm)), into the gonads of hermaphrodites of strain DP51 (fem-2(e2105) unc-45(r450ts)/sC1 [dpy-1(s2171)];him-8(e1489)). pDP#DH53 was injected at concentrations of 50 ng/µl and 100 ng/µl as described in MELLO et al. 1991 Down. F1 progeny with the rolling phenotype were confirmed to also be transmitting pDP#DH53 by single worm PCR using primers DHB.3 and DHB.5 as described in PILGRIM et al. 1995 Down and WILLIAMS et al. 1992 Down. Single rolling Unc hermaphrodites were transferred onto plates and allowed to self-fertilize at 21° and 25°. F2 hermaphrodite (XX) and male (XO) rolling animals were scored for their ability to self-fertilize, as well as for somatic sexual phenotype, compared to control DP51 animals grown at the same temperature.

Attempted rescue of fem-2 animals with truncated FEM-2:
pDP#DH28 was coinjected with pRF4 into strains DP51 and DP53. DP53 is similar to DP51 except that it carries a lethal allele (s2683) on the balancer sC1 chromosome (gift of H. STEWART and D. BAILLIE). Construction of pDP#DH28 is described below. Analysis of the transformed worms was performed at 21° as described above.

Yeast strains, media, and transformation:
Saccharomyces cerevisiae strain TM126 (MATa leu2 ura3 his3 ptc1::URA3) was obtained from H. SAITO (MAEDA et al. 1994 Down). Transformation of plasmids into strain TM126 was carried out as described (SCHIESTL et al. 1993 Down) following protocol number 3. Transformation of pDP#DH1 into TM126 yielded strain sDH2, pDBL yielded sDH3, and pDP#DH29 yielded sDH5 (DNA constructs described below). For growth curves, cells were grown overnight at 30° with constant shaking in selective (SC-leu) liquid media. The next day, 5 µl of each overnight culture was added to 5 ml of fresh media. These samples were grown with constant shaking at 30° or 37° at 300 rpm and the OD550 was measured at specified intervals in a Bausch and Lomb Spectronic 20 spectrophotometer. Growth was assayed for five independent cultures of each strain at both temperatures.

Detection of Ce-FEM-2 in yeast and worms:
Protein extracts of the yeast strains sDH2, sDH3, and sDH5 were obtained following overnight growth at 30° in liquid SC (minus leucine and uracil) media. The cells were pelleted and resuspended in 1.5 ml of water. 0.24 ml of 1.85 M NaOH, 7.4% ß-mercaptoethanol was added to the cells and incubated at 4° for 10 min. 0.24 ml of 50% trichloroacetic acid was added to the solution and incubated again at 4° for 10 min. The solution was centrifuged and the pellet was resuspended in 1.5 ml of acetone. The acetone was removed after centrifugation and the dried pellet was resuspended in 0.1 ml of 2x sample buffer (SAMBROOK et al. 1989 Down). Protein extracts of worm strains DP51 and DP151 were isolated as described (GOETINCK and WATERSTON 1994 Down).

SDS-PAGE was performed as described in SAMBROOK et al. 1989 Down using a 12% resolving gel. Western blotting and detection were performed using the ECL kit (Amersham, Arlington Heights, IL) following the supplier's instructions using a 1:2500 dilution of a polyclonal antibody made against Ce-FEM-2 (JACKLE-BALDWIN 1996 Down).

DNA manipulation:
pDBL, containing the 2 µm origin of replication and ADH1 promoter, has been described previously (MILNE and WEAVER 1993 Down) and was obtained from T. MILNE (Harvard Medical School, Cambridge, MA). This plasmid was used as the backbone for the construction of pDP#DH1 (directs the synthesis of FEM-2 under the control of the ADH1 promoter in yeast) and pDP#DH29 (same as pDP#DH1 but contains a deletion in the region encoding the amino terminal domain of FEM-2). For pDP#DH1, a cDNA, previously shown to contain the entire Ce-fem-2 open reading frame and upstream sequences including the first few bases of the SL1 spliced leader cloned into the EcoRI site of pBluescript (PILGRIM et al. 1995 Down), was liberated from the plasmid by digesting with NotI and EcoRV. NotI linkers were added to the blunt end, the insert was redigested with NotI and then cloned into the NotI site of pDBL. For pDP#DH29, the insert from pDP#DH1 was cloned into the NotI site of pBluescript II SK- and subjected to in vitro mutagenesis (LEATHERBARROW and FERSHT 1986 Down), using mutagenic primers DHA22 and DHA23. These created in-frame BglII restriction sites at positions 396 and 1187 of the fem-2 sequence (PILGRIM et al. 1995 Down), which were digested and then religated, removing the sequence between the two sites (Figure 4A). This resulted in a truncated open reading frame and the resulting protein is referred to as FEM-2{Delta}N2 (Figure 4B). The engineered insert was then removed by digesting with NotI and ligated into the NotI site of pDBL. pDP#DH28 was made by in vitro mutagenesis (LEATHERBARROW and FERSHT 1986 Down) of a wild-type genomic Ce-fem-2 clone (pDP#DH11) that can completely rescue fem-2 mutant defects [data not shown; insert includes the minimal rescuing region shown in PILGRIM et al. 1995 Down]. Primers DHA22 and DHA23 introduced in-frame BglII restriction sites as described above (Figure 4A). The plasmid was digested with BglII and religated after removal of the intervening sequence. The resulting protein is the same as FEM-2{Delta}N2, which was expressed in yeast.



View larger version (24K):
In this window
In a new window
Download PPT slide
 
Figure 2. Northern blot of C. briggsae mRNA. Ten micrograms of C. briggsae total RNA was hybridized with a 32P-labeled probe generated from a Ce-fem-2 RT-PCR product. The numbers represent relative location of RNA size standards in kb. Hybridization occurs only at a molecular weight of ~1.9 kb and suggests the presence of only one transcript or multiple transcripts of similar molecular weight. The blot was exposed at -80° for 8 days.




View larger version (71K):
In this window
In a new window
Download PPT slide
 
Figure 3. Alignment of amino acid sequence of Cb-FEM-2 and Ce-FEM-2. (A) White letters on a black background identify identical amino acids while black letters on a gray background identify similar amino acids. Sequences were compared using the program ALIGN. Triangles show the locations of the predicted introns. Black circles show the locations of the lesions associated with the two temperature-sensitive alleles of Ce-fem-2 (PILGRIM et al. 1995 Down). The gray circle shows the location of the lesion associated with the Arabidopsis mutations abi1-1 and abi2-1 (LEUNG et al. 1994 Down, LEUNG et al. 1997 Down; MEYER et al. 1994 Down). (B) The gray boxes represent the PP2C domains of the proteins. The striped boxes represent the portions of the amino-terminal domains that are common to each other. The exact location of the division between the gray and striped boxes is noted on part A.



View larger version (25K):
In this window
In a new window
Download PPT slide
 
Figure 4. The Ce-fem-2 gene and construction of fusion proteins. (A) Restriction map of the transcribed region of Ce-fem-2 (PILGRIM et al. 1995 Down). The black box corresponds to the FEM-2 open reading frame, white boxes to the 5' and 3' untranslated regions. The BglII sites in brackets were introduced into the gene by in vitro mutagenesis as described in MATERIALS AND METHODS, and were subsequently used to create an in-frame deletion that results in an amino-terminal deletion of 127 amino acids in Ce-FEM-2. Primers PJA2 and PJA3 used in the construction of pDP#DH14 and pDP#DH28 are indicated by arrows. The SalI site shown was used in the construction of pDP#PJB1. (B) Alignment of the predicted Ce-FEM-2 and Ptc1p proteins, with the vertical shaded regions corresponding to the conserved sequence motifs, as described (PILGRIM et al. 1995 Down). The hatched box in FEM-2{Delta}N2 shows the portion of FEM-2 missing because of the deletion using the BglII sites. The names of the plasmids encoding the proteins are in parentheses beside the respective protein. Ce-FEM-2 and Ptc1p share 30% identity and 50% similarity over the six motifs.

For the production of glutathione S-transferase (GST)-FEM-2 fusion proteins in bacteria, the following plasmids were constructed: pDP#DH14: pGEX-1{lambda}T (Pharmacia, Piscataway, NJ) vector was digested with EcoRI and ligated with primer PJA1, which introduces a SalI site at the location of the original EcoRI site to make pGEX-Sal. Full-length fem-2 cDNA was amplified by PCR using primers PJA2 and PJA3 and a 20:1 mixture of Taq polymerase to Pfu DNA Polymerase (Stratagene, La Jolla, CA). The amplified product was gel purified and digested with XhoI, which cuts at the sites introduced by the two primers. The product was then cloned into the introduced SalI site of the pGEX vector and orientation was confirmed by restriction digestion. pDP#DH19: The pDP#AMc001 "minigene" described previously (PILGRIM et al. 1995 Down), was mutagenized in vitro using primer DHA17 to introduce a mutation into the FEM-2 coding region identical to that found in the temperature-sensitive b245 mutation (PILGRIM et al. 1995 Down). The clone was then digested with SalI and SstI, and the insert containing the b245 mutation was gel purified and cloned into pDP#DH14 that had been digested with the same enzymes and separated from the corresponding insert. pDP#PJB1 was a gift of PETRA CKLE-BALDWIN and consists of a fragment of the fem-2 cDNA from the SalI site to the 3' end (Figure 4A) cloned into the pGEX-SalI plasmid. This results in a GST-FEM-2 fusion protein which is missing 87 amino acids at the amino terminus of FEM-2. This truncated form of FEM-2 is referred to as FEM-2{Delta}N1 (Figure 4B).

Isolation of the FEM-2 protein produced in Escherichia coli:
GST fusion vectors pDP#DH14, pDP#DH19 and pDP#PJB1 were transformed into E. coli strain BL21 DE3, then grown in LB-ampicillin to an OD550 of ~0.9 at 30°. Induction of the fusion protein was achieved by the addition of isopropyl-ß-D-thiogalactoside to a final concentration of 400 µM as described by the supplier (Pharmacia) for an additional 2–3 hr. The cells were pelleted and resuspended in lysis buffer (100 mM NaCl, 2.5 mM EDTA, 0.1% Tween-20, 50 mM Tris-HCl, pH 8.0). Cells were lysed using a Sonifier 450 (Branson Ultrasonics Corp., Danbury, CT) by sonication on ice with four bursts of 60 sec each on power setting 3. The debris was removed by centrifugation at 20,000 x g for 15 min in a Sorvall SS-34 rotor and the supernatant was added to 0.5 ml bed volume of washed Glutathione Sepharose 4B (Pharmacia) and allowed to bind at 4° for 2 hr with inversion. Beads were washed three times with phosphate buffered saline (PBS) and protein was eluted with two washes each of 10 and 15 mM glutathione in washing buffer (100 mM NaCl, 50 mM Tris-HCl, pH 8.0). The eluant was dialyzed against washing buffer for 2 hr, then overnight against 50 mM NaCl, 20 mM HEPES-KOH pH 7.2, 20% glycerol, 10% polyethylene glycol 20,000. Isolated proteins were quantified using the method of BRADFORD 1976 Down and by comparing against known standards on Coomassie Brilliant Blue-stained SDS-PAGE gels.

Phosphatase assays:
Bovine milk casein (C-4765; Sigma, St. Louis) was radioactively labeled using 7000 Ci/mmol [{gamma}-32P]ATP (ICN) with the catalytic subunit of bovine heart cAMP-dependent protein kinase (Sigma P-2645) as described by the supplier. The labeled protein was then precipitated with 20% trichloroacetic acid/20 mM NaH2PO4 and washed four times with the same solution. The pellet was dried and resuspended in 0.2 M Tris-HCl (pH 8.0) to a final concentration of ~105 cpm/µl. The phosphatase assay was performed as described (MAEDA et al. 1993 Down) at 22° and similar results were obtained in at least two separate reactions. All reactions contain 50 mM MgCl2 unless otherwise noted.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

C. briggsae homologue of fem-2:
Cb-fem-2 was cloned using low stringency hybridization and the entire putative coding region, covering approximately 3.0 kbp, was sequenced. Northern blotting shows a single band at approximately 1.9 kb, suggesting that Cb-fem-2 makes only one transcript, or more than one with very similar sizes (Figure 2). Comparison of the genomic sequence of Cb-fem-2 to that obtained through 5' RACE and RT-PCR reveals the presence of five introns (Figure 1), three of which are at the same location as those in Ce-fem-2 (Figure 3A). The sequence of the 5' RACE product contains a leader with the sequence 5'GGTTTAATTACCCAAGTTGAG3', confirming that the Cb-fem-2 transcript is trans-spliced. The leader is similar to SL1 to which the Ce-fem-2 transcript is spliced (PILGRIM et al. 1995 Down).

The predicted Cb-FEM-2 protein consists of 502 amino acids, 53 amino acids longer than Ce-FEM-2, due to an even longer domain amino terminal to the conserved phosphatase motifs (Figure 3A). Over 449 amino acids, the two proteins are 63% identical and 85% similar. The degree of similarity is not consistent over the entire length of the protein (Figure 3). In the region common to PP2C enzymes (the carboxy 279 amino acids), the two proteins are 72% identical and 90% similar. The first 170 amino acids of Ce-FEM-2 and the equivalent region of Cb-FEM-2 are 49% identical and 80% similar (Figure 3B).

Comparison of ~400 bp of Cb-fem-2 promoter sequence with the Ce-fem-2 promoter revealed no significant similarity except for the 9-bp sequence 5'tctgcatta3'. This sequence may be significant because it is at approximately the same location in both genes. This element starts 105 bp and 104 bp upstream of the Ce-fem-2 and Cb-fem-2 respective trans-splice sites. Some similarity is also seen in the 3'UTR of the two genes and will be discussed elsewhere.

Partial rescue of Ce-fem-2(null) with Cb-fem-2:
While the identity of the phosphatase domains is high, the level of sequence divergence in the amino termini suggests that portions of the two proteins may be rapidly evolving (Figure 4). To determine if the two genes are functionally interchangeable, we introduced Cb-fem-2 into Ce-fem-2(null) animals. Wild-type XX animals are normally self-fertile hermaphrodites, while wild-type XO are male. XX Ce-fem-2(null) animals, which receive neither maternal nor zygotic fem-2 product (m-z-), are self-sterile at both 21° and 25°, due to their inability to make sperm (HODGKIN 1986 Down). XO m-z- Ce-fem-2(null) animals are feminized in both the germline and the soma. The degree of somatic feminization is temperature dependent, with the somatic tissue of XO m-z- animals being intersexual at 21° and female at 25° (HODGKIN 1986 Down). Transgenic Cb-fem-2 is unable to rescue the germline feminization defect of either XX or XO animals. XX m-z- animals carrying the Cb-fem-2 array (n > 60) were unable to self-fertilize. After self-sterility was confirmed, two of these worms were mated to +/fem-2 males and were able to produce progeny, confirming that oogenesis occurred normally in these worms. At 21°, XO m-z- Ce-fem-2(null) animals have an intersexual soma that includes a partially formed vulva, a hermaphroditic bilobed gonad and an incomplete male tail (HODGKIN 1986 Down). XO m-z- Ce-fem-2(null) animals, either carrying the array or lacking it, were examined for somatic phenotype. It was found that all animals carrying the array lacked any obvious vulval tissue, had a single-lobed gonad and an incomplete male tail at both 21° (n = 34) and 25° (n = 24) (Figure 5). The germline was still feminized as evidenced by the presence of oocytes. Therefore, the conserved sequences in Cb-fem-2 are sufficient to rescue, at least partially, the somatic feminization cause by Ce-fem-2 mutations.



View larger version (85K):
In this window
In a new window
Download PPT slide
 
Figure 5. Comparison of the male tail in Ce-fem-2 and wild-type worms. (A) The tail of a wild-type male grown at 25°. (B) The tail of an XO m-z- fem-2(null) animal carrying Cb-fem-2 in a transgenic array grown at 25°. (C) The tail of an m-z- fem-2(null) female grown at 25°. Both XX and XO m-z- fem-2(null) animals develop indistinguishably as females at 25° (HODGKIN 1986 Down). Bar, 10 µm.

Lack of rescue using truncated fem-2:
To determine if the amino-terminal domain is necessary for proper FEM-2 function in worms, a clone carrying a deletion of this region was injected into Ce-fem-2(null) worms. The portion of the protein deleted is identical to that deleted in FEM-2-{Delta}N2, which is able to rescue a PP2C-deficient yeast strain, suggesting that the phosphatase activity is still intact (discussed below). XO m-z- Ce-fem-2(null) animals (n = 33) carrying the array showed the same degree of somatic feminization as those not carrying the array. Germline rescue was not observed in m-z- XX Ce-fem-2(null) animals carrying the array (n > 40), as demonstrated by self-sterility. Western blotting was used to confirm that worms carrying the array were expressing the amino-truncated form of FEM-2 (Figure 8). Strain DP51 shows a band at the predicted size for FEM-2 (51 kD); however, strain DP151 (same as strain DP51 but carrying array with plasmid pDP#DH28) shows a band at both 51 kD and 36 kD (the expected size of Ce-FEM-2{Delta}N2). Yeast strain sDH5, which also expresses Ce-FEM-2{Delta}N2, shows a band of the same size (Figure 8). This suggests that the amino terminus is necessary for FEM-2 to function properly in worm sex determination, and that phosphatase activity alone is not sufficient.



View larger version (14K):
In this window
In a new window
Download PPT slide
 
Figure 6. In vitro phosphatase assays. GST-FEM-2 fusion proteins were purified from E. coli and assayed for casein phosphatase activity as described in MATERIALS AND METHODS. All reactions were performed with 10 µg of test protein, except GST where 20 µg was used. Phosphatase activity was determined at 60 and 120 min for GST-FEM-2, GST-FEM-2{Delta}N2 and GST-FEM-2(b245). Bars represent the range of the results of the independent trials.



View larger version (16K):
In this window
In a new window
Download PPT slide
 
Figure 7. Growth curves for yeast containing Ce-FEM-2. S. cerevisiae ptc1 strains carrying an expression plasmid with Ce-FEM-2 (sDH2), Ce-FEM-2{Delta}N2 (sDH5) or vector alone (sDH3), were grown in selective liquid medium at (A) 30° or (B) 37° as described in MATERIALS AND METHODS. Points represent the average of five independent experiments, and bars are ±1 SD. For sDH3 at 37°, no increase in OD550 was seen over 7 hr in any of the experiments, although enough growth was seen over a 5-day period to predict a growth rate of ~0.003 OD550/hr. All OD550 readings were normalized to 0.2 at 0 hr.



View larger version (47K):
In this window
In a new window
Download PPT slide
 
Figure 8. Western blot of yeast and worm protein extracts. Lanes 1–3 are yeast protein extracts while lanes 4 and 5 are worm extracts. Proteins were detected using a polyclonal antibody raised against bacterially-expressed Ce-FEM-2. Lane 1, sDH2 that expresses full length Ce-FEM-2; lane 2, sDH3 that does not express FEM-2; lane 3, sDH5 that expresses Ce-FEM-2DN2; lane 4, DP151 that expresses wild-type Ce-FEM-2 and Ce-FEM-2{Delta}N2; lane 5, DP51 that only expresses Ce-FEM-2.

Phosphatase activity of truncated FEM-2 protein:
FEM-2 is predicted to have a longer amino terminus than either S. cerevisiae Ptc1p or its Schizosaccharomyces pombe homologue (PILGRIM et al. 1995 Down), and it appears from the experiments described above that this extra sequence encodes a domain necessary for sex-determining function in C. elegans. GST-FEM-2 exhibits phosphatase activity using 32P-labeled casein as a substrate (Figure 6), as has been previously shown (CHIN-SANG and SPENCE 1996 Down). We tested the phosphatase activity of a truncated form of FEM-2 that lacks the first 87 amino acids (FEM-2N{Delta}1). The deleted protein retains the six conserved motifs found in all PP2C enzymes (PILGRIM et al. 1995 Down). Bacterially expressed GST-fusion protein was purified as described, and tested for protein phosphatase activity in the same assay. As seen in Figure 6, FEM-2{Delta}N1 has indistinguishable phosphatase activity from intact FEM-2. Therefore, an intact amino terminus is not required for phosphatase activity in vitro.

The fem-2 gene was first discovered due to a temperature-sensitive mutation, b245 (KIMBLE et al. 1984 Down). This has subsequently been shown to be because of a missense mutation in conserved motif IV (Figure 3A; PILGRIM et al. 1995 Down). This base pair change was introduced into the FEM-2 coding sequence on a plasmid containing GST-FEM-2, and this fusion protein (FEM-2-b245) was also expressed and purified. As predicted from its mutant phenotype, little activity above background could be detected (Figure 6). Since even null alleles of fem-2 show temperature-dependent phenotypes (PILGRIM et al. 1995 Down), the low level of phosphatase activity produced from FEM-2(b245) may be sufficient at lower temperatures but not at the higher restrictive temperature. Alternatively, GST-FEM-2(b245) may not have been folded properly in bacteria, but is in worms at permissive temperatures.

Rescue of yeast ptc1 mutation:
There may be some overlap in function between the various PP2C enzymes within a yeast cell (MAEDA et al. 1994 Down; SHIOZAKI and RUSSELL 1995 Down). Ce-fem-2 has 50% similarity with Ptc1p in the six conserved motifs of the phosphatase domain. Since a phenotype has been described for S. cerevisiae ptc1 mutant cells (MAEDA et al. 1993 Down; ROBINSON et al. 1994 Down; HUANG and SYMINGTON 1995 Down; JIANG et al. 1995 Down), we tested whether the similarity between the two proteins is sufficient for Ce-FEM-2 to complement the yeast defects. ABI2 from Arabidopsis has recently been shown to be able to rescue ptc1 cells (LEUNG et al. 1997 Down). ptc1 mutant cells show a temperature-dependent growth defect, where growth is significantly slowed at 37°, but not at 30°. We transformed ptc1 yeast cells with a plasmid containing the Ce-FEM-2 coding region under the control of the constitutive yeast ADH1 promoter. In transformants containing Ce-FEM-2, the growth arrest is not observed, but growth arrest is observed in transformants containing vector alone (Figure 7).

As an independent in vivo assay for the effect of the amino terminus on FEM-2 phosphatase activity, a second truncated form of Ce-FEM-2 was tested. FEM-2-{Delta}N2 contains an in-frame deletion of 127 amino acids, which includes the majority of the amino-terminal extension (Figure 4). When this truncated form of Ce-FEM-2 is expressed in yeast, it is also able to rescue the temperature-dependent growth defect (Figure 7), with no apparent difference from the rescue achieved by intact Ce-FEM-2. Strains sDH2 and sDH5 were confirmed to be expressing Ce-FEM-2 and Ce-FEM-2{Delta}N2, respectively, through Western analysis (Figure 8). Thus, the conserved motifs of FEM-2 are sufficient to rescue the growth defect caused by lack of Ptc1p PP2C activity in yeast.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

FEM-2 plays an important role in promoting male somatic cell fates and spermatogenesis. Its similarity to PP2C enzymes suggests that it performs this function, at least in part, through dephosphorylation, which has been supported with empirical evidence (CHIN-SANG and SPENCE 1996 Down). In order to gain more insight into the sequences necessary for fem-2 to provide its masculinizing function, we cloned its C. briggsae homologue.

Very little is known about how the spatial or temporal expression of fem-2 is regulated except that RNA transcription is detectable throughout development, being most abundant in adults (PILGRIM et al. 1995 Down). Since Cb-fem-2 can partially replace the function of Ce-fem-2, Cb-fem-2 must contain elements that allow for its expression in C. elegans somatic tissue during development. The 9-bp sequence found at the same location in both upstream regions may be involved in this expression. Even though Cb-fem-2 seems to function in the C. elegans soma, it is unable to promote spermatogenesis in the germline. This could be due to the inability of the array to be expressed in the germline; however, transgenic arrays carrying Ce-fem-2 are able to rescue the germline defect and have never been shown to rescue only the somatic tissue (PILGRIM et al. 1995 Down; D. PILGRIM, unpublished results). Genetic epistatic analysis predicts that the sex determination components downstream of fem-2 differ in the germline and soma. Perhaps there are two different targets of FEM-2, one in the germline and one in the soma. The germline target may have diverged more at the protein sequence level than the somatic target between the two species, and is unable to be dephosphorylated by Cb-FEM-2. Alternatively, the factors regulating the expression or activity of FEM-2 could be more diverged in the germline than the soma. Since hermaphrodites first produce sperm and then oocytes, the regulation of sex determination factors in the germline requires an additional level of temporal and spatial control that is not necessary in the soma. This additional level of control may complicate matters to the degree that Cb-FEM-2 is unable to functionally replace Ce-FEM-2 in the germline.

Ce-FEM-2 and Cb-FEM-2 are similar in amino acid sequence in both the amino-terminal and the phosphatase domains. Since Cb-FEM-2 contains a long amino extension that is similar in sequence to Ce-FEM-2's, this supports the idea that this domain is needed for FEM-2's role in sex determination. Indeed, Ce-fem-2 transgenic constructs lacking a large portion of the coding region for the amino terminus are unable to rescue Ce-fem-2 mutant animals. The long amino extensions of other Class A PP2C enzymes have been proposed to be involved in regulation of phosphatase activity (LEUNG et al. 1994 Down, LEUNG et al. 1997 Down; MEYER et al. 1994 Down; STONE et al. 1994 Down). This could also be the function of the FEM-2 amino terminus. However, it is unlikely to be directly involved in dephosphorylation because there is no difference in the ability of full-length and truncated forms of CeFEM-2 to rescue yeast cells deficient in Ptc1p. Also, another amino-truncated derivative of Ce-FEM-2 showed no difference in phosphatase activity in vitro as compared to full-length Ce-FEM-2. This also suggests that the amino terminus does not serve as a direct repressor of phosphatase activity, otherwise removal of this domain would have released it from repression and a higher level of activity would have been observed in its absence.

The amino terminus could bind to another protein(s), possibly to the protein to be dephosphorylated to provide target specificity. Alternatively, it could bind to a protein that sequesters FEM-2 to remove it from the dephosphorylation target. Indeed, a model has been proposed that involves the membrane-bound TRA-2A protein binding the FEM proteins in XX animals, preventing them from repressing the feminizing activity of TRA-1 (KUWABARA and KIMBLE 1992 Down). A potential FEM-binding site has been predicted to exist in the carboxy terminus of TRA-2A (KUWABARA and KIMBLE 1995 Down), but this region does not seem to be highly conserved in Cb-TRA-2 (KUWABARA 1996 Down). Perhaps the regions of the sex determination proteins that interact with each other are evolving together. An amino acid change in one protein could be compensated for by a change in the other protein allowing the interaction to occur. Domains of proteins that are involved in binding other molecules, such as DNA (TRA-1) (DE BONO and HODGKIN 1996 Down), or a phosphate group (FEM-2), may be more constrained in their ability to evolve because the shapes of the targets are relatively fixed. This could explain why parts of FEM-2 seem to be evolving at different rates. The Cb-FEM-2 amino terminus is 32% longer than Ce-FEM-2's, and the region that is common between the two (170 aa) is only 49% identical. This degree of identity is similar to that seen with the C. briggsae and C. elegans homologues of TRA-1 and TRA-2, also involved in sex determination. However, the Ce-FEM-2 PP2C domain, which comprises ~60% of the protein, is 72% identical to the corresponding region of Cb-FEM-2. If the amino terminus is involved in binding to other sex determination proteins, a changed amino acid in one protein could put pressure on an interacting protein to also change to maintain the strength of the interaction. Thus, domains of protein-protein interaction, although functionally important, may not show a high degree of conservation between species. This does not explain why the degree of divergence in sex determination genes appears higher than in genes involved in other developmental processes. Sex determination factors in other systems (SRY in mammals and transformer in Drosophila) have also been shown to have unusually high divergence rates (O'NEIL and BELOTE 1992 Down; TUCKER and LUNDRIGAN 1993 Down; WHITFIELD et al. 1993 Down). For SRY, this has been suggested to be due to sequence-specific adaptive mutations as opposed to neutral evolution. This suggests that there is evolutionary pressure that causes sex determination proteins to evolve faster than proteins involved in other developmental decisions. Further analysis of the sequence and expression of sex-determining genes from a variety of species may help to determine why they are rapidly evolving.


*  ACKNOWLEDGMENTS

We thank HARUO SAITO for yeast strain TM126; T. MILNE for pDBL; ELLEN SHIBUYA and MORRIS MADURO for help and reagents; PAUL WONG and MICHELLE CHAMBERS for help and reagents regarding Northern analysis; REBECCA BURDINE and MICHAEL STERN for allowing me to use their RNA isolation protocol; SHAWNA MAGUIRE for help with Western blotting; PETRACKLE-BALDWIN for plasmid constructs, help with the fusion protein purification, and the FEM-2 antibody; HELEN STEWART and DAVE BAILLIE for balancers sC1 and sC1(let); and PAUL STOTHARD, JOHN BELL, and anonymous reviewers for critical reading of the manuscript. This work was supported by an operating grant from the Natural Sciences and Engineering Research Council of Canada to D.P.

Manuscript received February 13, 1998; Accepted for publication April 16, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BARNES, T. M. and J. HODGKIN, 1996  The tra-3 sex determination gene of Caenorhabditis elegans encodes a member of the calpain regulatory protease family. EMBO J. 15:4477-4484[Medline].

BLUMENTHAL, T., and K. STEWARD, 1997 RNA processing and gene structure, pp. 117–145 in C. elegans II, edited by D. RIDDLE, T. BLUMENTHAL, B. MEYER and J. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BRADFORD, M., 1976  A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline].

CHIN-SANG, I. D. and A. M. SPENCE, 1996  Caenorhabditis elegans sex-determining protein FEM-2 is a protein phosphatase that promotes male development and interacts directly with FEM-3. Genes Dev. 10:2314-2325[Abstract/Free Full Text].

DE BONO, M. and J. HODGKIN, 1996  Evolution of sex determination in Caenorhabditis: unusually high divergence of tra-1 and its functional consequences. Genetics 144:587-589[Abstract].

GOETINCK, S. and R. H. WATERSTON, 1994  The Caenorhabditis elegans muscle-affecting gene unc-87 encodes a novel thin filament-associated protein. J. Cell Biol. 127:79-93[Abstract/Free Full Text].

HODGKIN, J., 1986  Sex determination in the nematode C. elegans: analysis of tra-3 suppressors and characterization of fem genes. Genetics 114:15-52[Abstract/Free Full Text].

HUANG, K. N. and L. S. SYMINGTON, 1995  Suppressors of a Saccharomyces cerevisiae pkc1 mutation identify alleles of the phosphatase gene PTC1 and of a novel gene encoding a putative leucine zipper protein. Genetics 141:1275-1285[Abstract].

JACKLE-BALDWIN, P., 1996 Expression of fem-2 gene products. M.Sc. Thesis, University of Alberta, Edmonton, Alberta, Canada.

JIANG, B., A. F. J. RAM, J. SHERATON, F. M. KLIS, and H. BUSSEY, 1995  Regulation of cell wall b-glucan assembly: PTC1 negatively affects PBS2 action in a pathway that includes modulation of EXG1 transcription. Mol. Gen. Genet. 248:260-269[Medline].

KIMBLE, J., L. EDGAR, and D. HIRSH, 1984  Specification of male development in Caenorhabditis elegans: The fem genes. Dev. Biol. 105:234-239[Medline].

KUWABARA, P. E., 1996  Interspecies comparison reveals evolution of control regions in the nematode sex-determining gene tra-2.. Genetics 144:597-607[Abstract].

KUWABARA, P. E. and J. KIMBLE, 1992  Molecular genetics of sex determination in C. elegans.. Trends Genet. 8:164-168[Medline].

KUWABARA, P. and J. KIMBLE, 1995  A predicted membrane protein, TRA-2A, directs hermaphrodite development in Caenorhabditis elegans.. Development 121:2995-3004[Abstract].

KUWABARA, P. E., P. G. OKKEMA, and J. KIMBLE, 1992  tra-2 encodes a membrane protein and may mediate cell communication in the Caenorhabditis elegans sex determination pathway. Mol. Biol. Cell 3:461-473[Abstract].

LEATHERBARROW, R. J. and A. R. FERSHT, 1986  Protein engineering [review]. Protein Eng. 1:7-16[Free Full Text].

LEUNG, J., M. BOUVIER-DURAND, P. C. MORRIS, D. GUERRIER, and F. CHEFDOR et al., 1994  Arabidopsis ABA-response gene ABI1: features of a calcium-modulated protein phosphatase. Science 264:1448-1452[Abstract/Free Full Text].

LEUNG, J., S. MERLOT, and J. GIRAUDAT, 1997  The Arabidopsis ABSCISIC ACID-INSENSITIVE2 (ABI2) and ABI1 genes encode homologous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell 9:759-771[Abstract].

MADL, J. E. and R. K. HERMAN, 1979  Polyploids and sex determination in Caenorhabditis elegans.. Genetics 93:393-402[Abstract/Free Full Text].

MAEDA, T., A. Y. M. TSAI, and H. SAITO, 1993  Mutations in a protein tyrosine phosphatase gene (PTP2) and a protein serine/threonine phosphatase gene (PTC1) cause a synthetic growth defect in Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:5408-5417[Abstract/Free Full Text].

MAEDA, T., S. M. WURGLER-MURPHY, and H. SAITO, 1994  A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369:242-245[Medline].

MELLO, C. C., J. M. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991  Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970[Medline].

MEYER, K., M. P. LEUBE, and E. GRILL, 1994  A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana.. Science 264:1452-1455[Abstract/Free Full Text].

MILNE, G. T. and D. T. WEAVER, 1993  Dominant negative alleles of RAD52 reveal a DNA repair/recombination complex including Rad51 and Rad52. Genes Dev. 7:1755-1765[Abstract/Free Full Text].

NOMURA, N., N. MIYAJIMA, T. SAZUKA, A. TANAKA, and Y. KAWARABATASI et al., 1994  Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1. DNA Res. 1:27-35[Abstract/Free Full Text].

O'NEIL, M. T. and J. M. BELOTE, 1992  Interspecific comparison of the transformer gene of Drosophila reveals an unusually high degree of evolutionary divergence. Genetics 131:113-128[Abstract].

PERRY, M. D., W. LI, C. TRENT, B. ROBERTSON, and A. FIRE et al., 1993  Molecular characterization of the her-1 gene suggests a direct role in cell signaling during Caenorhabditis elegans sex determination. Genes Dev. 7:216-228[Abstract/Free Full Text].

PILGRIM, D., A. MCGREGOR, P. JACKLE, T. JOHNSON, and D. HANSEN, 1995  The C. elegans sex-determining gene fem-2 encodes a putative protein phosphatase. Mol. Biol. Cell 6:1159-1171[Abstract].

ROBINSON, M. K., W. H. VAN ZYL, E. M. PHIIZICKY, and J. R. BROACH, 1994  TPD1 of Saccharomyces cerevisiae encodes a protein phosphatase 2C-like activity implicated in tRNA splicing and cell separation. Mol. Cell Biol. 14:3634-3645[Abstract/Free Full Text].

ROSENQUIST, T. A. and J. KIMBLE, 1988  Molecular cloning and transcript analysis of fem-3, a sex determining gene in Caenorhabditis elegans.. Genes Dev. 2:606-616[Abstract/Free Full Text].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHIESTL, R. H., P. MANIVASAKAM, R. A. WOODS, and R. D. GIETZ, 1993  Introducing DNA into yeast by transformation. Methods: A Companion to Methods Enzymol. 5:79-85.

SHIOZAKI, K. and P. RUSSELL, 1995  Counteractive roles of protein phosphatase 2C (PP2C) and a MAP kinase kinase homolog in the osmoregulation of fission yeast. EMBO J. 14:492-502[Medline].

SPENCE, A. M., A. COULSON, and J. HODGKIN, 1990  The product of fem-1, a nematode sex-determining gene, contains a motif found in cell cycle control proteins and receptors for cell-cell interactions. Cell 60:981-990[Medline].

STONE, J. M., M. A. COLLINGE, R. D. SMITH, M. A. HORN, and J. C. WALKER, 1994  Interaction of a protein phosphatase with an Arabidopsis serine-threonine receptor kinase. Science 266:793-795[Abstract/Free Full Text].

SULSTON, J., and J. HODGKIN, 1988 Methods, pp. 587–606 in The Nematode Caenorhabditis elegans, edited by W. B. WOOD. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

TUCKER, P. K. and B. L. LUNDRIGAN, 1993  Rapid evolution of the sex determining locus in Old World mice and rats. Nature 364:715-717[Medline].

WHITFIELD, L. S., R. LOVELL-BADGE, and P. N. GOODFELLOW, 1993  Rapid sequence evolution of the mammalian sex-determining gene SRY.. Nature 364:713-715[Medline].

WILLIAMS, B. D., B. SCHRANK, C. HUYNH, R. SHOWNKEEN, and R. H. WATERSTON, 1992  A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131:609-624[Abstract].

ZARKOWER, D. and J. HODGKIN, 1992  Molecular analysis of the C. elegans sex-determining gene tra-1: a gene encoding two zinc finger proteins. Cell 70:237-249[Medline].




This article has been cited by other articles:


Home page
Genome ResHome page
S. Cho, S.-W. Jin, A. Cohen, and R. E. Ellis
A Phylogeny of Caenorhabditis Reveals Frequent Loss of Introns During Nematode Evolution
Genome Res., July 1, 2004; 14(7): 1207 - 1220.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Pires-daSilva and R. J. Sommer
Conservation of the global sex determination gene tra-1 in distantly related nematodes
Genes & Dev., May 15, 2004; 18(10): 1198 - 1208.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. E. Baird
Haldane's Rule by Sexual Transformation in Caenorhabditis
Genetics, July 1, 2002; 161(3): 1349 - 1353.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. M. L. Tan, S.-L. Chan, K. O. Tan, and V. C. Yu
The Caenorhabditis elegans Sex-determining Protein FEM-2 and Its Human Homologue, hFEM-2, Are Ca2+/Calmodulin-dependent Protein Kinase Phosphatases That Promote Apoptosis
J. Biol. Chem., November 16, 2001; 276(47): 44193 - 44202.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P.-J. Chen, S. Cho, S.-W. Jin, and R. E. Ellis
Specification of Germ Cell Fates by FOG-3 Has Been Conserved During Nematode Evolution
Genetics, August 1, 2001; 158(4): 1513 - 1525.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
W. J. Kent and A. M. Zahler
Conservation, Regulation, Synteny, and Introns in a Large-scale C. briggsae-C. elegans Genomic Alignment
Genome Res., August 1, 2000; 10(8): 1115 - 1125.
[Abstract] [Full Text]


Home page
GeneticsHome page
E. S. Haag and J. Kimble
Regulatory Elements Required for Development of Caenorhabditis elegans Hermaphrodites Are Conserved in the tra-2 Homologue of C. remanei, a Male/Female Sister Species
Genetics, May 1, 2000; 155(1): 105 - 116.
[Abstract] [Full Text]


Home page
GeneticsHome page
A. Streit, W. Li, B. Robertson, J. Schein, I. H. Kamal, M. Marra, and W. B. Wood
Homologs of the Caenorhabditis elegans Masculinizing Gene her-1 in C. briggsae and the Filarial Parasite Brugia malayi
Genetics, August 1, 1999; 152(4): 1573 - 1584.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
A. Mehra, J. Gaudet, L. Heck, P. E. Kuwabara, and A. M. Spence
Negative regulation of male development in Caenorhabditis elegans by a protein-protein interaction between TRA-2A and FEM-3
Genes & Dev., June 1, 1999; 13(11): 1453 - 1463.
[Abstract] [Full Text]


Home page
DevelopmentHome page
W Yi and D Zarkower
Similarity of DNA binding and transcriptional regulation by Caenorhabditis elegans MAB-3 and Drosophila melanogaster DSX suggests conservation of sex determining mechanisms
Development, January 2, 1999; 126(5): 873 - 881.
[Abstract] [PDF]


Home page
Genome ResHome page
D. Pilgrim
CeRep25B Forms Chromosome-Specific Minisatellite Arrays in Caenorhabditis elegans
Genome Res., November 1, 1998; 8(11): 1192 - 1201.
[Abstract] [Full Text]