Genetics, Vol. 149, 937-946, June 1998, Copyright © 1998

An Intragenic Suppressor of Cold Sensitivity Identifies Potentially Interacting Bases in the Peptidyl Transferase Center of Tetrahymena rRNA

Rosemary Sweeneya and Meng-Chao Yaoa
a Fred Hutchinson Cancer Research Center, Seattle, Washington 98109

Corresponding author: Meng-Chao Yao, Fred Hutchinson Cancer Research Center, 1124 Columbia St., Seattle, WA 98104, mcyao{at}fhcrc.org (E-mail).

Communicating editor: S. L. ALLEN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Peptidyl transfer of a growing peptide on a ribosome-bound transfer RNA (tRNA) to an incoming amino acyl tRNA is the central step in translation, and it may be catalyzed primarily by the large subunit (LSU) ribosomal RNA (rRNA). Genetic and biochemical evidence suggests that the central loop of domain V of the LSU rRNA plays a direct role in peptidyl transfer. It was previously found that a single base change at a universally conserved site in this region of the Tetrahymena thermophila LSU rRNA confers anisomycin resistance (an-r) as well as extremely slow growth, cold sensitivity, and aberrant cell morphology. Because anisomycin specifically inhibits peptidyl transfer, possibly by interfering with tRNA binding, it is likely that this mutant rRNA is defective in efficiently completing one of these steps. In the present study, we have isolated an intragenic suppressor mutation located only three bases away from the original mutation that partially reverses the slow growth and cold-sensitive phenotypes. These data imply that the functional interaction of these two bases is necessary for normal rRNA function, perhaps for peptidyl transfer or tRNA binding. These data provide the first demonstration of a functional interaction between bases within this rRNA region.


THE transfer of a nascent peptide from the 3' end of a transfer RNA (tRNA) to an incoming amino acyl tRNA on an actively translating ribosome is a crucial step in the process of translation. This so-called peptidyl transfer step can be catalyzed by the large subunit (LSU) of the ribosome (MONRO 1967 Down; MADEN et al. 1968 Down). Quite possibly, the LSU ribosomal RNA (rRNA) alone contains the primary enzymatic activity necessary to carry out this step (NOLLER et al. 1992 Down). Parts of domains II, IV, V, and VI of the LSU rRNA (NOLLER 1984 Down) have been implicated in carrying out this process (NOLLER 1993 Down; LIEBERMAN and DAHLBERG 1995 Down; NOLLER et al. 1995 Down). Presumably, these areas are in close physical proximity in the ribosome, even though they are distant in the primary rRNA sequence. Antibiotics that specifically inhibit this step exist, and mutations that confer resistance to these antibiotics have mapped in or close to a ring of single-stranded and highly conserved bases in the central loop of domain V of the LSU rRNA (HUMMEL and BOCK 1987 Down; WEISS-BRUMMER et al. 1995 Down; LAZARO et al. 1996 Down; TAN et al. 1996 Down; Figure 1). Biochemical evidence indicates that this area forms part of the binding site for many of these antibiotics (MOAZED and NOLLER 1987 Down; RODRIGUEZ-FONSECA et al. 1995 Down) and is physically near the 3' ends of tRNAs (STEINER et al. 1988 Down; MOAZED and NOLLER 1991 Down). This area has therefore been presumed to play a direct role in peptidyl transfer and has been referred to as the peptidyl transfer center (VESTER and GARRETT 1988 Down).



View larger version (29K):
In this window
In a new window
Download PPT slide
 
Figure 1. —The peptidyl transferase center of T. thermophila LSU rRNA. The sequence and secondary structure is from the central loop of domain V (SCHNARE et al. 1996 Down). The bases altered in the Anr and Arv mutant lines are circled, and the base changes are indicated. The numbering is relative to the center of the palindromic T. thermophila rDNA (ENGBERG and NIELSEN 1990; Figure 2), not to the beginning of the LSU rRNA. The symbols next to bases are explained in the figure. Information concerning tRNA protection of bases (MOAZED and NOLLER 1989 Down), anisomycin resistance in Halobacterium (HUMMEL and BOCK 1987 Down), chloramphenicol resistance in mitochondria (DUJON 1980 Down; BLANC et al. 1981A Down, BLANC et al. 1981B Down; WEISS-BRUMMER et al. 1995 Down), sparsomycin resistance in Halobacterium (LAZARO et al. 1996 Down; TAN et al. 1996 Down), amicetin resistance in Halobacterium (LEVIEV et al. 1994 Down), and cross-linking of aminoacyl tRNAs bearing a photo-affinity label on their amino acid (STEINER et al. 1988 Down) was derived from published sources.

Tetrahymena thermophila, a unicellular eukaryote, is one of the few organisms possessing a single copy of the rRNA genes (rDNA) in its germline genome (YAO and GALL 1977 Down); most organisms possess multiple copies of their rDNA, making classical genetic studies difficult. This has made it possible to isolate mutations in the T. thermophila rRNA that confer resistance to drugs that specifically interfere with translation in eukaryotes (BRUNS et al. 1985 Down; SWEENEY et al. 1991 Down). Anisomycin is an antibiotic that specifically inhibits peptidyl transfer in eukaryotes (GALE et al. 1981 Down). In past work, we have isolated mutant lines of T. thermophila (Anr) that are anisomycin resistant (an-r). These lines also grow slowly, are cold sensitive, and exhibit aberrant cell morphology (SWEENEY et al. 1991 Down). It is likely that these phenotypes stem from a defect in peptidyl transfer or tRNA binding, because anisomycin inhibits these steps of translation. The Anr mutation is a single base change at a universally conserved site in the peptidyl transfer center of the LSU rRNA gene (Figure 1). The site in the analogous position in yeast rRNA is one of several protected from chemical modification by the binding of anisomycin to yeast ribosomes (RODRIGUEZ-FONSECA et al. 1995 Down). Thus, it is likely that the Anr mutation lies within the binding site of anisomycin. Because Anr mutant lines are cold sensitive, it might be possible to isolate revertant lines that suppress this phenotype. Such revertant lines could identify other gene products or other bases within the rRNA that functionally interact with the originally mutated base.

Like many ciliates, T. thermophila contains two nuclei: a micronucleus, or germline nucleus, and a macronucleus, or somatic nucleus. The diploid micronucleus is transcriptionally silent. The polyploid macronucleus contains a subset of the sequences present in the micronucleus on 50–200 chromosomes with an average size of about 600 kb and a copy number of about 45 (COYNE et al. 1997 Down). Virtually all transcription occurs in the macronucleus. During conjugation, cells of different mating types pair. The micronucleus of each mating partner undergoes meiosis to produce four haploid gametic nuclei, one of which is retained, replicated, and ultimately becomes half of the new micronucleus generated in each mating partner. The other half is supplied by a similar gametic nucleus contributed by the other partner. The old macronuclei are degraded by a process similar to apoptosis (DAVIS et al. 1992 Down), and new macronuclei are formed from replicates of the new micronuclei by a complex series of steps, including DNA deletion, cleavage and telomere addition, and amplification (COYNE et al. 1997 Down). Thus, a mutation in the micronuclear genome will not be phenotypically expressed until the cells have undergone mating and generation of a new macronucleus (ORIAS and BRUNS 1976 Down).

The macronuclear rDNA is unique in that it is carried on a 21-kb palindromic molecule containing two head-to-head copies of the rDNA (Figure 2). There are about 9000 copies of rDNA per macronucleus (YAO et al. 1974 Down). T. thermophila can be transformed using drug-resistant versions of the rDNA. If a cloned copy of the micronuclear form rDNA is introduced into mating T. thermophila, it can replace the host rDNA in the new macronucleus because of drug selection as well as the more efficient maintenance of the variant form of rDNA used for transformation (LARSON et al. 1986 Down; YAO and YAO 1989 Down).



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 2. —Map of T. thermophila rDNA. In the upper left is shown the rDNA as it exists in the micronucleus. In the upper right is shown a cloned version of the micronuclear form rDNA that can be used for transformation (MATERIALS AND METHODS). Various regions are depicted as follows: checkered, micronuclear specific sequences flanking the rDNA; unfilled, extragenic portions of the rDNA; lightly shaded, coding regions of the rDNA; darkly shaded, the intervening sequence (CECH et al. 1981 Down); and solidly filled, bacterial plasmid DNA. In the lower part of the figure is shown a map of the palindromic macronuclear rDNA numbered from the center of the rDNA (ENGBERG and NIELSEN 1990). Below the line, restriction sites are indicated by letters: H, BamHI; P, SphI; R, EcoRI; and S, StuI. H* indicates a BamHI site found in C3-type, but not B-type, rDNA. The 1.2-kb SphI-StuI fragment is shown in expanded form below with the positions of oligonucleotides A–E (MATERIALS AND METHODS) and the Arv mutations indicated.

In this study, we utilize the T. thermophila genetic system to isolate an intragenic suppressor of the Anr mutation. These doubly mutant cells are an-r, but the cold sensitivity and slow growth phenotypes of the original mutation are partially suppressed. We have thus identified two bases in the LSU rRNA whose functional interaction is essential for normal rRNA function. This interaction may be direct or may be mediated via the tertiary structure of the ribosome or other cellular components. Because anisomycin inhibits peptidyl transfer and tRNA binding, it is likely that the interaction of these bases is necessary for the efficient completion of one of these steps.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and media:
T. thermophila strains are described in Table 1. T. thermophila cells were grown in suPP media (GOROVSKY 1970 Down) supplemented with penicillin (250 µg/ml), streptomycin (250 µg/ml), and fungizone (62.5 ng/ml; GIBCO BRL, Gaithersburg, MD). Anisomycin (100 µg/ml), cycloheximide (25 µg/ml), methylpurine (15 µg/ml), and paromomycin (130 µg/ml) were added as indicated.


 
View this table:
In this window
In a new window

 
Table 1. Strains

Isolation of Arv mutants:
The selection scheme is diagrammed in Figure 3. Log phase cells of strain FH103 (Table 1) were mutagenized with nitrosoguanidine (0.1 mg/ml) for 6 hr at 30°, washed into 10 mM Tris pH 7.4, and starved overnight at 30°. Log phase FH104 (Table 1) cells were also starved overnight in 10 mM Tris pH 7.4. About 1.3 x 106 cells of each strain in a total volume of 22 ml were mixed at 30°. Six hours thereafter, a small aliquot of mating cells was fixed with formaldehyde, and paired and unpaired cells were counted. About 66% of the cells were paired. At the same time, pairs were cloned in drops on a Petri dish (ORIAS and BRUNS 1976 Down) to determine viability and the presence of the drug-resistant phenotypes [an-r, cycloheximide resistance (cy-r), methylpurine resistance (mp-r)] that would distinguish true progeny from parental cells. Cloned pairs were 72% viable, but only about 6% of the viable pairs were true progeny, that is, resistant to anisomycin, cycloheximide, and methylpurine. About 24 hr post-mixing, the mating cells were fed with 1 vol (22 ml) of suPP media and distributed into microtiter plates with either ~10, 100, or 1000 cells per well. At 31.5 hr postmixing, cycloheximide was added, and the microtiter plates were transferred to 23°. After 22 days at this temperature, cells in 4/96 wells that had originally contained about 1000 cells/well and in 1/96 wells that had originally contained about 10 cells/well were growing visibly better than other similar wells, and individual cells were cloned from these wells and tested for drug resistance. An-r, cy-r, and mp-r lines isolated from these wells were further characterized and found to have different growth characteristics from Anr/Anr lines previously characterized. Thus, revertant lines arose at a frequency of ~9.2 x 10-4 of the viable progeny in this cross.



View larger version (42K):
In this window
In a new window
Download PPT slide
 
Figure 3. —Selection of Arv mutants. The large ovals represent T. thermophila cells, a mating pair above and a single cell below. The small circles within the ovals represent micronuclei, and the large circles represent macronuclei. The genetic identities of the micronuclei and macronuclei are shown. The Anr allele confers anisomycin resistance (an-r); the Mpr allele, methylpurine resistance (mp-r); and the ChxA allele, cycloheximide resistance (cy-r). Notice that the parental strains FH103 and FH104 (SWEENEY et al. 1991 Down) carry alleles specifying drug resistance in their micronuclei but not in their macronuclei. Thus, they do not have a drug-resistant phenotype. The asterisk following C3-Anr in the single cell below indicates that this allele must have been subjected to mutagenesis.

Plasmid construction, transformation, and DNA analysis:
Total T. thermophila DNA was isolated and analyzed by Southern blot using oligonucleotide hybridization probes as previously described (AUSTERBERRY and YAO 1987 Down). Longer probes were labeled by the random priming method (AUSUBEL et al. 1990 Down).

Arv mutant DNA was obtained by cloning a BamHI fragment (from position 6683 to about 9150; Figure 2) from total DNA of each of the five revertant lines, FH108–FH112, into the Bluescribe M13+ plasmid (Vector Cloning Systems, San Diego, CA). The BamHI site at around position 9150 is present in C3 but not in B-type rDNA. A BamHI-EcoRI fragment (positions 6683–8046) was subcloned from this fragment. A region of ~90 bases surrounding the Anr mutation was sequenced using the Sequenase method (United States Biochemical, Cleveland) and the M13+ sequencing primer (-20) and oligonucleotide E (Figure 2), which covers rDNA positions 7879–7898. The sequences of the oligonucleotides are M13+ (-20), 5'GTAAAACGACGGCCAGT3'; and oligonucleotide E, 5'AATACAAACCGCGAAAGCGT3'.

The plasmid Tt947-Arv was made by replacing a wild-type 1.2-kb SphI-StuI fragment (positions 7048–8261) with the corresponding cloned fragment from FH112 carrying the Arv mutations in the transformation vector D5-400 (Figure 2; YAO et al. 1990 Down).

Tt947-Rev was made by amplifying a plasmid consisting of the wild-type version of the SphI-StuI fragment (positions 7048–8261) cloned into pACIV (pACIVSS; SWEENEY et al. 1994 Down) with two primers. The first pointed downstream, covered both the Anr and Rev sites, and had the wild-type sequence at the Anr site and the mutant sequence at the Rev site (oligonucleotide B; Figure 2). The second primer was completely wild type in sequence and pointed upstream, and its 5' base was adjacent to, upstream, and on the opposite strand from the 5' base of oligonucleotide B (oligonucleotide A; Figure 2). When this PCR product was self-ligated (after treatment with Klenow; New England Biolabs, Beverly, MA), a plasmid identical to pACIVSS, except at the Rev site, was created. This SphI-StuI fragment was used to replace the corresponding fragment in the transformation vector D5-400. The sequences of these primers are: oligonucleotide A, 5'TTATCCCTGTGGTAACTTTT3'; oligonucleotide B, 5'CTGACTTGTGGCAGCCAAGAGTTC3'.

Mating cells were transformed by means of the electroporation method (GAERTIG and GOROVSKY 1992 Down) using CU427 and CU428 (Table 1) as the parental strains.

Oligonucleotides C and D span the Anr mutation site and contain the wild-type and Anr mutant sequences, respectively. Their sequences are: oligonucleotide C, 5'ACAAGCCAGTTATCCCTGTG3'; and oligonucleotide D, 5'ACAAGCCAATTATCCCTGTG3'.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Isolation of Arv mutants:
Previously, we isolated a mutation (Anr) in the T. thermophila rDNA that conferred an-r, slow growth, cold sensitivity, and aberrant cell morphology (SWEENEY et al. 1991 Down). To identify other bases in the rRNA that functionally interact with the Anr site, we set out to isolate intragenic suppressor mutations that reversed the cold-sensitive phenotype. To maximize the chance of recovering intragenic suppressors, we used two distinct lines of T. thermophila, C3 and B, which are able to interbreed but have many sequence differences. C3-type rDNA is preferentially maintained in C3/B heterozygotes; that is, only C3 rDNA is found in the macronuclei of most C3/B heterozygotes after 20 cell doublings subsequent to the formation of a heterozygote (LARSON et al. 1986 Down). A strain homozygous for the Anr mutation and C3-type rDNA in its micronucleus (FH103; Table 1) was mutagenized and mated to another strain (FH104; Table 1) that was homozygous for the Anr mutation and B-type rDNA in its micronucleus. Progeny of this cross were visually screened for growth at 23° in microtiter plates (Figure 3; MATERIALS AND METHODS). Because the progeny of this cross would contain mostly C3-type rDNA (which had been mutagenized) in their macronuclei, intragenic suppressor mutations should easily be identified by this scheme, even if they are recessive. Extragenic suppressor mutations could also be identified, but only if they are dominant.

Five independent isolates (FH108–FH112; Table 1) were obtained (at a frequency of at least 9 x 10-4 per viable, progeny-producing pair) that partially reversed the cold-sensitive and slow growth phenotypes, but not the an-r phenotype (Table 1 and Table 2) of the original Anr mutant strains. Levels of drug resistance, unlike growth, were almost unaffected. One revertant line tested was resistant to as much as 500 µg/ml anisomycin, and heterozygous strains carrying both Anr and wild-type rDNAs in their macronuclei were resistant to as much as 400 µg/ml (data not shown). The cell morphology of the revertant lines was less aberrant than that of Anr/Anr lines, showing only occasional "monstrous" cells (SWEENEY et al. 1991 Down) at 30°. These five lines did not grow as well as wild-type strains at any temperature but grew better than an Anr/Anr strain (FH101) at 30° and 23°, at which temperature Anr/Anr strains do not grow (SWEENEY et al. 1991 Down; Table 2). Thus, the slow growth and cold-sensitive phenotypes were partially reversed, and the an-r phenotype was retained in all five revertant lines.


 
View this table:
In this window
In a new window

 
Table 2. Growth properties of revertant lines

Mapping and sequencing the revertant mutations:
Although unlikely, it was possible that the revertant phenotype was caused by a reversion of the Anr mutation to the wild-type sequence. To determine if this was the case, DNA from the revertant strains was subjected to Southern blot analysis using oligonucleotides homologous to the mutant and wild-type (oligonucleotides D and C, respectively, Figure 2; MATERIALS AND METHODS) sequences at the Anr mutation site as hybridization probes. These oligonucleotides can distinguish mutant from wild-type sequences under stringent washing conditions (SWEENEY et al. 1991 Down; R. SWEENEY and M.-C. YAO, unpublished results). So if oligonucleotide C hybridized under stringent washing conditions to DNA from the revertant lines, the Anr mutation must have been reverted to the wild-type sequence in these lines. And if oligonucleotide D hybridized to the revertant DNA under stringent washing conditions, the Anr mutation must still be present in the revertant lines. Surprisingly, neither of these oligonucleotides hybridized well to the rDNA of any of the five revertant lines under stringent washing conditions (Figure 4; data not shown for FH111). It was therefore likely that all the revertant lines were different from both the wild-type and Anr sequences in the area covered by these oligonucleotides. Thus, in one step, the likely site of the second site mutation(s) in all five revertant lines had been narrowed to the 20 bases covered by oligonucleotides C and D.



View larger version (73K):
In this window
In a new window
Download PPT slide
 
Figure 4. —Southern blot analysis of revertant DNA. Panel A shows an ethidium bromide-stained 1% agarose gel. The leftmost lane contains bacteriophage lambda DNA digested with HindIII as a size marker. The remaining lanes contain total Tetrahymena DNA digested with BamHI made from the strains indicated above each lane, which are described in Table 1. In panel B is the Southern blot analysis of the gel shown in panel A. The upper panel is hybridized with end-labeled oligonucleotide C (wild-type sequence), and the lower panel is hybridized with end-labeled oligonucleotide D (Anr mutant sequence; MATERIALS AND METHODS). Both are washed under stringent conditions. FH113 and FH114 serve as positive controls for the Anr mutant sequence, and C3-368 serves as a positive control for the wild-type sequence. Note the high intensities of these lanes in the appropriate panels.

To sequence these mutations, a BamHI fragment of ~2.4 kb from the rDNA of each revertant line was cloned (Figure 2; MATERIALS AND METHODS), and a region of ~90 bases around the Anr mutation was sequenced. The same base change was detected in all five revertant lines, a G to A transition three bases downstream from the Anr mutation (Figure 1). All lines retained the Anr mutation. We named this new, doubly mutated genotype Arv. Because the two mutations in the Arv lines are so closely linked, their isolation makes anisomycin resistance more useful as a selectable genetic trait because Arv lines are far healthier than Anr lines.

Transformation with Arv rDNA:
Because five independent revertant lines contained the same base change, it seemed likely that this base change was responsible for the partial reversal of the cold-sensitive phenotype. To further confirm this point, a plasmid containing a micronuclear copy of the rDNA bearing the Arv mutations (Tt947-Arv; MATERIALS AND METHODS) was constructed and used to transform mating T. thermophila cells. The only portion of this construct derived from the revertant lines was a 1.2-kb SphI-StuI fragment spanning the sites of the Arv mutations (Figure 2). This construct and Tt947-214 (SWEENEY et al. 1991 Down), which contains only the Anr mutation and does not bear the Pmr mutation (BRUNS et al. 1985 Down; SPANGLER and BLACKBURN 1985 Down) were used to transform mating cells, and transformants were selected with anisomycin.

Southern blot analysis of the DNA of these transformants indicates that they contain mostly rDNA bearing the BamHI site at about position 9150 that is specific to transforming rDNA (Figure 2 and Figure 5). Because this site is only ~1.2 kb from the Arv mutation site, it is likely that these rDNAs also contain any mutations present at this site. Thus, it is likely that these transformants contain almost entirely rDNA introduced by transformation. If so, their phenotype might be similar to that of lines homozygous for the mutant rDNAs. In fact, previously measured growth curves of Anr homozygotes grown under similar conditions (R. SWEENEY and M.-C. YAO, unpublished results) are comparable to what was observed for Tt947-214 transformants (Figure 6). These data provide evidence that the phenotype of Tt947-214 transformants is very similar to that of Anr homozygote lines, in spite of any minor amounts of host rDNA that may be present in these transformed lines.



View larger version (39K):
In this window
In a new window
Download PPT slide
 
Figure 5. —Southern blot analysis of transformant DNA. Total T. thermophila DNA was digested with BamHI, hybridized with pACIVSS (panel A; MATERIALS AND METHODS) or oligonucleotide D (panel B; MATERIALS AND METHODS), and washed under nonstringent conditions. Under these conditions, sequences with one or two mismatches hybridize as well as those with no mismatch. Thus, the probe is used to indicate the presence of complementary sequences on a DNA fragment, not to distinguish mismatches. Sources of the DNA in each lane are indicated above. Transformed lines are named with the plasmid with which they are transformed (Tt947-214, Tt-947-Arv, or Tt947-Rev), followed by a letter indicating individual, independent transformed lines. Untransformed strains (CU427, CU428, and FH108) are described in Table 1.



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 6. —Growth of transformed lines. Cells were grown in suPP with anisomycin (Tt947-214 and Tt947-Arv) or paromomycin (Tt947-Rev) or without drugs (CU428) in a vol of 15 ml in a 250-ml flask shaken (when applicable) at 150 rpm. Tt947-Rev transformants grown without drugs grew similarly to those grown with paromomycin at 30° with shaking and at 18° without shaking, indicating that paromomycin has little or no effect on growth rate of paromomycin-resistant lines. Tt-947-214 transformants grown with anisomycin grew similarly to strains homozygous for the Anr allele grown without anisomycin, suggesting that anisomycin has little, if any, effect on cell growth of resistant lines. Optical density was read at 540 nM. At least two strains of each type were tested in each growth condition and found to behave similarly.

Transformants were tested for growth with shaking at 30° and with and without shaking at 18°. Other experiments had indicated that shaking was a stressful condition for Anr mutant strains at any temperature and wild-type strains at 18° (R. SWEENEY and M.-C. YAO, unpublished results; Figure 6). Tt947-214 and Tt947-Arv transformants both grew slowly at 30° with shaking and reached a plateau at a much lower density than untransformed wild-type lines. Both Tt947-214 and Tt947-Arv transformants grew very little at 18° with shaking (Figure 6), and microscopic inspection indicated that most, if not all, cells were dead after 4 days in this growth condition. Untransformed cells grew with an average doubling time of 15.8 hr after undergoing a variable initial lag period. Tt947-Arv transformants were able to grow at 18° without shaking, although at a slower rate than untransformed cells. Tt947-214 transformants failed to grow in this condition. Thus, Tt947-Arv transformants can be distinguished from Tt947-214 transformants by their ability to grow at 18° without shaking. They are also phenotypically distinguishable from untransformed lines by their failure to grow at 18° with shaking and their slower growth at 30° with shaking. Because Tt947-Arv can confer anisomycin resistance with a less severe cold-sensitive phenotype than that conferred by Tt947-214 and because the only DNA derived from the revertant lines present in Tt947-Arv is the 1.2-kb SphI-StuI fragment, the position of the revertant mutation is narrowed to this fragment. It is thus very likely that the base change we have detected is indeed responsible for the revertant phenotype we have observed. We called this mutation (when it occurs in the absence of the Anr mutation) Rev.

Phenotype conferred by the suppressor mutation alone:
The base altered by the Rev mutation is, like the Anr mutation site, highly conserved phylogenetically (SCHNARE et al. 1996 Down). It was therefore likely that this mutation might confer a phenotype in the absence of the Anr mutation. To determine whether this was true, we constructed a plasmid similar to Tt947-Arv but bearing only the revertant mutation (Tt947-Rev; MATERIALS AND METHODS). This plasmid was used to transform mating cells, and paromomycin was used to select for transformants.

Unlike Tt947-Arv transformants, Tt947-Rev transformants were not an-r (data not shown). Southern blot analysis indicated that almost all of their rDNA contained the BamHI site specific to the transforming rDNA and, thus, probably also the Rev mutation (Figure 2 and Figure 5). They grew almost as well as untransformed cells at 30°, in contrast to Tt947-214 and Tt947-Arv transformants, which grew much more slowly (Figure 6). They also grew almost as fast as untransformed cells at 18° without shaking, although they showed a somewhat longer but variable initial lag period in this growth condition. They grew more slowly than untransformed lines at 18° with shaking, showing an average doubling time of 19.6 hr after a somewhat variable initial lag period. Thus, Tt947-Rev transformants can be distinguished from Tt947-Arv transformants by their ability to grow at 18° with shaking and by their vigorous growth at 30°; they are distinguished from untransformed cells only by their slower growth at 18° with shaking. It is surprising that the mutation of such a highly conserved base should confer such a mild phenotype.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Arv mutations define interacting bases in the peptidyl transferase center:
We have isolated an intragenic suppressor mutation that partially reverses the cold-sensitive phenotype conferred by the Anr mutation, a single base change in the peptidyl transfer center of the T. thermophila LSU rRNA gene that also confers an-r (SWEENEY et al. 1991 Down). The suppressor mutation is another single base change only three bases away (Figure 1). These data strongly suggest that these two bases functionally interact. It is unclear whether this is a direct, physical interaction or an indirect interaction mediated by the tertiary structure of the ribosome or other cellular components. This is the first demonstration of a functional interaction between two bases within this important functional region of the LSU rRNA.

Anisomycin inhibits peptidyl transfer and binding of the substrate tRNAs for this reaction (GALE et al. 1981 Down). Because of this and the fact that the Anr mutation is within an rRNA region implicated in peptidyl transfer and tRNA binding by many other studies (NOLLER 1993 Down; LIEBERMAN and DAHLBERG 1995 Down; NOLLER et al. 1995 Down), it is very likely that the cold-sensitive and slow growth phenotypes conferred by the Anr mutation are due to a defect in peptidyl transfer or tRNA binding. Thus, although other interpretations are possible, these data strongly suggest that these two bases cooperate in the execution of one or both of these processes.

It is possible, although unlikely, that an additional mutation(s) may contribute to the reversal of the cold-sensitive phenotype observed in Arv mutant lines because we sequenced only 90 bases in the vicinity of the original Anr mutation. However, because we have recovered identical suppressor mutations (i.e., Rev) in five independent isolates with similar phenotypes, it is very unlikely that such a putative additional mutation(s) confers the observed phenotype. It is therefore most likely that only the two bases defined by the Anr and Rev mutations confer the observed phenotype.

Evidence from a variety of sources strengthens the hypothesis that the peptidyl transfer center is directly involved in peptidyl transfer. Binding of many antibiotics that inhibit peptidyl transfer and/or closely related translation steps (such as translocation and binding of the 3' end of tRNAs or movement of the nascent peptide) protects primarily bases in the peptidyl transfer center of the Escherichia coli, Haloferax mediterranei, or Saccharomyces cerevisiae LSU rRNAs from chemical modification (MOAZED and NOLLER 1987 Down; RODRIGUEZ-FONSECA et al. 1995 Down). Chloramphenicol resistant (cm-r) lines of human, mouse, and yeast cells have been found to bear mutations in their mitochondrial LSU rRNAs that are at or near the Anr site (DUJON 1980 Down; BLANC et al. 1981A Down, BLANC et al. 1981B Down; WEISS-BRUMMER et al. 1995 Down; Figure 1). Mutations in the peptidyl transfer center confer sparsomycin resistance in Halobacterium salinarium and H. halobium (LAZARO et al. 1996 Down; TAN et al. 1996 Down; Figure 1). In H. halobium, amicetin resistance is conferred by a mutation close to the Anr site (LEVIEV et al. 1994 Down). Also, three different mutations conferring an-r in H. halobium and H. cutirubrum map at and near the Anr site (HUMMEL and BOCK 1987 Down; Figure 1). Because chloramphenicol, sparsomycin, amicetin, and anisomycin all inhibit peptidyl transfer (GALE et al. 1981 Down), these data further implicate this region in peptidyl transfer. In addition, a derivative of Phe-tRNA bearing a photoreactive group on the phenylalanine has been crosslinked to a number of sites in the peptidyl transfer center (STEINER et al. 1988 Down; Figure 1), indicating that this region is in close physical proximity to the amino acid on a charged tRNA. Also, bases in the peptidyl transfer center are protected from chemical modification by the binding of tRNAs or even a fragment consisting of the 3' end of a tRNA (MOAZED and NOLLER 1989 Down; MOAZED and NOLLER 1991 Down). Thus, it is almost certain that many bases in or near the central loop of domain V play a direct role in peptidyl transfer.

Phenotypes of cells containing rRNAs with mutations in the peptidyl transferase center:
Because the T. thermophila Anr mutation affects a universally conserved base, it is not surprising that the growth of Anr mutant lines is adversely affected. Anr homozygotes fail to grow at temperatures of 23° or below and grow very slowly (with a doubling time about 10 times that of wild-type cells) at 30°. They also have abnormal cell morphology. Chloramphenicol-resistant (cm-r) lines of yeast, mouse, and human cells that bear mutations in their mitochonrdrial LSU rRNA at highly conserved sites close to or exactly at the Anr site have been isolated (DUJON 1980 Down; BLANC et al. 1981A Down, BLANC et al. 1981B Down; WEISS-BRUMMER et al. 1995 Down; Figure 1). In one yeast mitochondrial mutant bearing a mutation at a site homologous to site 8018 (Figure 1), a decrease in growth rate was observed (WEISS-BRUMMER et al. 1995 Down). A mild growth defect was observed in cm-r human cell lines bearing a C to A transversion in the site homologous to the Anr site on their mitochondrial LSU rRNA (BLANC et al. 1981A Down). Growth phenotypes have not been noted for cm-r cell lines bearing mutations at other sites in the peptidyl transfer center (DUJON 1980 Down; BLANC et al. 1981A Down, BLANC et al. 1981B Down; WEISS-BRUMMER et al. 1995 Down). However, some mutations in highly conserved bases in the peptidyl transferase center in E. coli have conferred severe phenotypes (VESTER and GARRETT 1988 Down). It is surprising that mutations of highly conserved bases in mitochondrial systems yield mutant lines with very mild or completely wild-type phenotypes. It may be that the nature of eukaryotic mitochondrial systems makes phenotypic effects of rRNA mutations less apparent.

It is also surprising that archaebacterial mutants bearing a base change identical to the Anr mutation exhibit no growth defect. None were noted in an-r mutants of H. halobium and H. cutirubrum or in cm-r mutants of Sulfolobus acidocaldarius (HUMMEL and BOCK 1987 Down; AAGAARD et al. 1994 Down). Ribosomes from the Halobacterium mutants had activity in a polyphenylalanine synthesis assay, but these data did not allow a conclusive quantitative comparison with the activity of wild-type ribosomes (HUMMEL and BOCK 1987 Down). In S. acidocaldarius, growth of mutant and wild-type lines was monitored, but no differences were found (AAGAARD et al. 1994 Down). The T. thermophila intragenic suppressor mutation isolated in this study (Rev) is a G to A transition at a highly conserved (except in archaebacteria and mitochondria) site only three bases away from the Anr mutation (Figure 1). Interestingly, this base is an A in H. halobium and H. cutirubrum, rather than the G found in all eukaryotes and eubacteria. Because an-r mutants of H. halobium and H. cutirubrum have the same sequence at these two positions as the Arv revertant T. thermophila lines, it is perhaps not surprising that the Halobacterium mutants showed no noticeable phenotype other than drug resistance. On the other hand, S. acidocaldarius has the same G at the Rev site that is present in wild-type T. thermophila. Thus, it may be even more likely that other differences between archaebacterial ribosomes (which must be stable in extreme environmental conditions) and eukaryotic ribosomes account for the differences in phenotype.

Transformed cells containing only rDNA bearing the revertant mutation in the absence of the original Anr mutation show only a slight cold-sensitive phenotype, which is surprising given the high sequence conservation of this base. However, an inhibition of growth by dilution was sometimes observed at 30°. When diluted to 2.5 x 103 cells/ml, one transformed line failed to grow for 4 days and then began to grow with a doubling time of 4.7 hr or less, as it had previously. Similar effects of dilution have been observed with cells bearing Anr or Arv genotypes but not with wild-type cells (J. WARD and R. SWEENEY, unpublished results). The basis of this inhibition of growth by dilution has not been investigated, but it may be related to a previously described phenomenon in T. thermophila (WHEATLEY et al. 1993 Down; CHRISTENSEN et al. 1996 Down).

Possible reasons for the severe phenotype of Anr mutant lines:
If the Anr mutation confers a defect in peptidyl transfer or binding of the 3' ends of tRNAs, it is possible that protein synthesis is not sufficient for healthy cell growth or that incomplete peptides are being made and exerting toxic effects on the cells. Other, less likely, explanations are possible. Some antibiotics, including anisomycin, induce a signal transduction cascade, including the stress-activated protein kinases (SAPKs) in eukaryotes (IORDANOV et al. 1997 Down). Because this activation is dependent on the presence of actively translating ribosomes and intact rRNA, it has been hypothesized that the initiating signal may arise from translating ribosomes. If, like anisomycin itself, the Anr mutation inhibits peptidyl transfer, it may also activate the SAPK cascade, which could possibly confer the observed phenotypes. Another observed activity of the E. coli LSU rRNA is the facilitation of protein folding in vitro. Oligonucleotides complementary to parts of domain V (including the Anr site) inhibit this activity (CHATTOPADHYAY et al. 1996 Down). Thus, the Anr mutant phenotype could be due to defects in protein folding. Either of these hypotheses might explain the phenotypic difference between T. thermophila and archaebacteria because these organisms could easily differ in their mechanisms of protein folding or activation of the SAPK cascade, if this pathway actually exists in either of these organisms.

Conclusion:
Peptidyl transfer is at the heart of translation. It may be catalyzed primarily by the LSU rRNA, which certainly plays a role in this process (NOLLER et al. 1992 Down). A variety of studies have implicated parts of LSU rRNA domains II, IV, V, and VI in the peptidyl transfer step of translation, but there is little doubt that bases in the peptidyl transfer center play a central role in this process (NOLLER 1993 Down; LIEBERMAN and DAHLBERG 1995 Down; NOLLER et al. 1995 Down). Our data strongly suggest the existence of a direct or indirect functional interaction between two bases in the peptidyl transfer center. This interaction may be instrumental in carrying out peptidyl transfer or tRNA binding as suggested by the location of both bases in a region that past work has implicated in these processes. This is the first demonstration of a functional interaction between two bases within the peptidyl transferase center that is necessary for normal rRNA function.


*  ACKNOWLEDGMENTS

We gratefully acknowledge SARAH MACLEOD for technical assistance and JOHN WARD for critical reading of the manuscript. This work was supported by National Science Foundation grant DMB-9602135 to M.-C.Y.

Manuscript received October 14, 1997; Accepted for publication February 25, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AAGAARD, C., H. PHAN, S. TREVISANATO, and R. A. GARRETT, 1994  A spontaneous point mutation in the single 23S rRNA gene of the thermophilic archaeon Sulfolobus acidocaldarius confers multiple drug resistance. J. Bacteriol. 176:7744-7747[Abstract/Free Full Text].

AUSTERBERRY, C. F. and M.-C. YAO, 1987  Nucleotide sequence structure and consistency of a developmentally regulated DNA deletion in Tetrahymena thermophila. Mol. Cell. Biol. 7:435-443[Abstract/Free Full Text].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1990 Current Protocols in Molecular Biology. John Wiley and Sons, New York.

BLANC, H., C. W. ADAMS, and D. C. WALLACE, 1981a  Different nucleotide changes in the large rRNA gene of the mitochondrial DNA confer chloramphenicol resistance on two human cell lines. Nucleic Acids Res. 9:5785-5795[Abstract/Free Full Text].

BLANC, H., C. T. WRIGHT, M. J. BIBB, D. C. WALLACE, and D. A. CLAYTON, 1981b  Mitochondrial chloramphenicol-resistant mouse cells contains a single nucleotide change in the region encoding the 3' end of the large ribosomal RNA. Proc. Natl. Acad. Sci. USA 78:3789-3793[Abstract/Free Full Text].

BRUNS, P. J., A. L. KATZEN, L. MARTIN, and E. H. BLACKBURN, 1985  A drug-resistant mutation in the ribosomal DNA of Tetrahymena. Proc. Natl. Acad. Sci. USA 82:2844-2846[Abstract/Free Full Text].

CECH, T. R., A. J. ZAUG, and P. J. GRABOWSKI, 1981  In vitro splicing of the ribosomal RNA precursor of Tetrahymena: involvement of a guanosine nucleotide in the excision of the intervening sequence. Cell 27:487-496[Medline].

CHATTOPADHYAY, S., B. DAS, and C. DASGUPTA, 1996  Reactivation of denatured proteins by 23S ribosomal RNA: role of domain V. Proc. Natl. Acad. Sci. USA 93:8284-8287[Abstract/Free Full Text].

CHRISTENSEN, S. T., K. KEMP, H. QUIE, and L. RASMUSSEN, 1996  Cell death, survival and proliferation in Tetrahymena thermophila: effects of insulin, sodium nitroprusside, 8-Bromo cyclic GMP, NG-methyl-L-arginine and methylene blue. Cell Biol. Int. 20:653-666[Medline].

COYNE, R. S., D. L. CHALKER, and M.-C. YAO, 1997  Genome downsizing during ciliate devolopment: nuclear division of labor through chromosome restructuring. Annu. Rev. Genet. 30:557-578[Medline].

DAVIS, M. C., J. G. WARD, G. HERRICK, and C. D. ALLIS, 1992  Programmed nuclear death: apoptotic-like degradation of specific nuclei in conjugating Tetrahymena. Developmental Biology 154:419-432[Medline].

DUJON, B., 1980  Sequence of the intron and flanking exons of the mitochondrial 21S rRNA gene of yeast strains having different alleles at the {omega} and rib-1 loci. Cell 20:185-197[Medline].

ENGBERG, J. and H. NEILSEN, 1990  Complete sequence of the extrachromosomal rDNA molecule from the ciliate Tetrahymena thermophila strain B1868VII. Nucleic Acids Res. 18:6915-6919[Abstract/Free Full Text].

GAERTIG, J. and M. A. GOROVSKY, 1992  Efficient mass transformation of Tetrahymena thermophila by electroporation of conjugants. Proc. Natl. Acad. Sci. USA 89:9196-9200[Abstract/Free Full Text].

GALE, E. F., E. CUNDLIFFE, P. E. REYNOLDS, M. H. RICHMOND and M. J. WARING, 1981 The Molecular Basis of Antibiotic Action. John Wiley and Sons, New York.

GOROVSKY, M. A., 1970  Studies on nuclear structure and function in Tetrahymena pyriformis. II. Isolation of macro- and micronuclei. J. Cell Biol. 47:619-630[Abstract/Free Full Text].

HUMMEL, H. and A. BOCK, 1987  23S ribosomal RNA mutations in Halobacteria conferring resistance to the anti-80S ribosome targeted antibiotic anisomycin. Nucleic Acids Res. 15:2431-2443[Abstract/Free Full Text].

IORDANOV, M. S., D. PRIBNOW, J. L. MAGUN, T.-H. DINH, and J. A. PEARSON et al., 1997  Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the {alpha}-sarcin/ricin loop in the 28S rRNA. Mol. Cell. Biol. 17:3373-3381[Abstract].

LARSON, D. D., E. H. BLACKBURN, P. C. YAEGER, and E. ORIAS, 1986  Control of rDNA replication in Tetrahymena involves a cis-acting upstream repeat of a promoter element. Cell 47:229-240[Medline].

LAZARO, E., C. RODRIGUEZ-FONSECA, B. PORSE, D. URENA, and R. A. GARRETT et al., 1996  A sparsomycin-resistant mutant of Halobacterium salinarium lacks a modification at nucleotide U2603 in the peptidyl transferase centre of 23S rRNA. J. Mol. Biol. 261:231-238[Medline].

LEVIEV, I. G., C. RODRIGUEZ-FONSECA, H. PHAN, R. A. GARRETT, and G. HEILEK et al., 1994  A conserved secondary structural motif in 23S rRNA defines the site of interaction of amicetin, a universal inhibitor of peptide bond formation. EMBO J. 13:1682-1686[Medline].

LIEBERMAN, K. R. and A. E. DAHLBERG, 1995  Ribosome-catalyzed peptide-bond formation. Progress in Nucleic Acid Res. and Mol. Biol. 50:1-23.

MADEN, B. E. H., R. R. TRAUT, and R. E. MONRO, 1968  Ribosome-catalyzed peptidyl transfer: the polyphenylalanine system. J. Mol. Biol. 35:333-345[Medline].

MOAZED, D. and H. F. NOLLER, 1987  Chloramphenicol, erythromycin, carbomycin and vernamycin B protect overlapping sites in the peptidyl transferase region of 23S ribosomal RNA. Biochimie 69:879-884[Medline].

MOAZED, D. and H. F. NOLLER, 1989  Interaction of tRNA with 23S rRNA in the ribosomal A, P, and E sites. Cell 57:585-597[Medline].

MOAZED, D. and H. F. NOLLER, 1991  Sites of interaction of the CCA end of peptidyl-tRNA with 23S rRNA. Proc. Natl. Acad. Sci. USA 88:3725-3728[Abstract/Free Full Text].

MONRO, R. E., 1967  Catalysis of peptide bond formation by 50S ribosomal subunits from Escherichia coli.. J. Mol. Biol. 26:147-151[Medline].

NOLLER, H. F., 1984  Structure of ribosomal RNA. Ann. Rev. Biochem. 53:119-162[Medline].

NOLLER, H. F., 1993  RNA-rRNA interactions and peptidyl transferase. The FASEB Journal 7:87-89[Abstract].

NOLLER, H. F., V. HOFFARTH, and L. ZIMNIAK, 1992  Unusual resistance of peptidyl transferase to protein extraction procedures. Science 256:1416-1419[Abstract/Free Full Text].

NOLLER, H. F., R. GREEN, G. HEILEK, V. HOFFARTH, and A. HUTTENHOFER et al., 1995  Structure and function of ribosomal RNA. Biochem. Cell Biol. 73:997-1009[Medline].

ORIAS, E., and P. J. BRUNS, 1976 Induction and isolation of mutants in Tetrahymena, pp. 247–282 in Methods in Cell Biology, Vol. XIII, edited by D. M. PRESCOTT, Academic Press, New York.

RODRIGUEZ-FONSECA, C., R. AMILS, and R. A. GARRETT, 1995  Fine structure of the peptidyl transferase centre on 23S-like rRNAs deduced from chemical probing of antibiotic-ribosome complexes. J. Mol. Biol. 247:224-235[Medline].

SCHNARE, M. N., S. H. DAMBERGER, M. W. GRAY, and R. R. GUTELL, 1996  Comprehensive comparison of structural characteristics in eukaryotic cytoplasmic large subunit (23S-like) ribosomal RNA. J. Mol. Biol. 256:701-719[Medline].

SPANGLER, E. A. and E. H. BLACKBURN, 1985  The nucleotide sequence of the 17S ribosomal RNA gene of Tetrahymena thermophila and the identification of point mutations resulting in resistance to the antibiotics paromomycin and hygromycin. J. Biol. Chem. 260:6334-6340[Abstract/Free Full Text].

STEINER, G., E. KUECHLER, and A. BARTA, 1988  Photo-affinity labelling at the peptidyl transferase centre reveals two different positions for the A- and P-sites in domain V of 23S rRNA. EMBO J. 7:3949-3955[Medline].

SWEENEY, R., C. H. YAO, and M. C. YAO, 1991  A mutation in the large subunit ribosomal RNA gene of Tetrahymena confers anisomycin resistance and cold sensitivity. Genetics 127:327-334[Abstract].

SWEENEY, R., L. CHEN, and M.-C. YAO, 1994  An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence. Mol. Cell. Biol. 14:4203-4215[Abstract/Free Full Text].

TAN, G. T., A. DEBLASIO, and A. S. MANKIN, 1996  Mutations in the peptidyl transferase center of 23S rRNA reveal the site of action of sparsomycin, a universal inhibitor of translation. J. Mol. Biol. 261:222-230[Medline].

VESTER, B. and R. A. GARRETT, 1988  The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA. EMBO J. 7:3577-3587[Medline].

WEISS-BRUMMER, B., A. ZOLLNER, A. HAID, and S. THOMPSON, 1995  Mutation of a highly conserved base in the yeast mitochondrial 21S rRNA restricts ribosomal frameshifting. Mol. Gen. Genet. 248:207-216[Medline].

WHEATLEY, D. N., S. T. CHRISTENSEN, P. SCHOUSBOE, and L. RASMUSSEN, 1993  Signalling in cell growth and death: adequate nutrition alone may not be sufficient for ciliates; a minireview. Cell Biol. Int. 17:817-823[Medline].

YAO, M.-C. and J. G. GALL, 1977  A single integrated gene for ribosomal RNA in a eucaryote, Tetrahymena pyriformis.. Cell 12:121-132[Medline].

YAO, M.-C. and C. H. YAO, 1989  Accurate processing and amplification of cloned germ line copies of ribosomal DNA injected into developing nuclei of Tetrahymena thermophila.. Mol. Cell. Biol. 9:1092-1099[Abstract/Free Full Text].

YAO, M.-C., A. R. KIMMEL, and M. A. GOROVSKY, 1974  A small number of cistrons for ribosomal RNA in the germinal nucleus of a eukaryote, Tetrahymena pyriformis.. Proc. Natl. Acad. Sci. USA 71:3082-3086[Abstract/Free Full Text].

YAO, M. C., C. H. YAO, and B. MONKS, 1990  The controlling sequence for site-specific chromosome breakage in Tetrahymena. Cell 63:763-772[Medline].




This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Cochella and R. Green
Isolation of antibiotic resistance mutations in the rRNA by using an in vitro selection system
PNAS, March 16, 2004; 101(11): 3786 - 3791.
[Abstract] [Full Text] [PDF]