Genetics, Vol. 149, 879-892, June 1998, Copyright © 1998

Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces cerevisiae

Anatoly V. Grishina, Michael Rothenberg1,a, Maureen A. Downsa, and Kendall J. Blumera
a Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110

Corresponding author: Anatoly V. Grishin, Department of Cell Biology and Physiology, Washington University School of Medicine, 660 S. Euclid Ave., Box 8228, St. Louis, MO 63110-1093, agrishin{at}cellbio.wustl.edu (E-mail).

Communicating editor: F. WINSTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

In the yeast Saccharomyces cerevisiae, mating pheromone response is initiated by activation of a G protein- and mitogen-activated protein (MAP) kinase-dependent signaling pathway and attenuated by several mechanisms that promote adaptation or desensitization. To identify genes whose products negatively regulate pheromone signaling, we screened for mutations that suppress the hyperadaptive phenotype of wild-type cells overexpressing signaling-defective G protein ß subunits. This identified recessive mutations in MOT3, which encodes a nuclear protein with two Cys2-His2 Zn fingers. MOT3 was found to be a dosage-dependent inhibitor of pheromone response and pheromone-induced gene expression and to require an intact signaling pathway to exert its effects. Several results suggested that Mot3 attenuates expression of pheromone-responsive genes by mechanisms distinct from those used by the negative transcriptional regulators Cdc36, Cdc39, and Mot2. First, a Mot3-lexA fusion functions as a transcriptional activator. Second, Mot3 is a dose-dependent activator of several genes unrelated to pheromone response, including CYC1, SUC2, and LEU2. Third, insertion of consensus Mot3 binding sites (C/A/T)AGG(T/C)A activates a promoter in a MOT3-dependent manner. These findings, and the fact that consensus binding sites are found in the 5' flanking regions of many yeast genes, suggest that Mot3 is a globally acting transcriptional regulator. We hypothesize that Mot3 regulates expression of factors that attenuate signaling by the pheromone response pathway.


THE pheromone response pathway of the yeast Saccharomyces cerevisiae is controlled by a complex interplay of positive and negative regulators of signal transduction (BARDWELL et al. 1994 Down). Secreted oligopeptide mating pheromones ({alpha}-factor and a-factor) induce the expression of genes required for mating, inhibit cell proliferation, and trigger a differentiation program necessary for conjugation of haploid yeast cells of opposite mating type. Pheromones exert their effects by activating a conserved signal transduction pathway consisting of cell surface receptors, a heterotrimeric guanine nucleotide-binding protein (G protein), and a mitogen-activated protein (MAP) kinase cascade, ultimately impinging on a cyclin-dependent kinase inhibitor (Far1) that induces growth arrest and a transcription factor (Ste12) that activates expression of pheromone-responsive genes.

Negative regulation of the pheromone response pathway allows cells to adapt or become desensitized to a signal of constant intensity. This is thought to be important for cells to respond chemotropically to pheromone gradients, allowing mating to occur preferentially between partners that produce high levels of pheromone or to resume proliferation if mating is unsuccessful (JACKSON et al. 1991 Down; SEGALL 1993 Down; BARDWELL et al. 1994 Down). Desensitization or adaptation in yeast can occur by several mechanisms, including pheromone proteolysis (CIEJEK and THORNER 1979 Down; MACKAY et al. 1988 Down), receptor phosphorylation and downregulation (JENNESS and SPATRICK 1986 Down; RENEKE et al. 1988 Down; CHEN and KONOPKA 1996 Down), G protein deactivation by a putative GTPase-activating protein Sst2, a member of the regulators of G protein signaling (RGS) family (DOHLMAN et al. 1996 Down), and MAP kinase dephosphorylation by dual specificity and tyrosine-specific protein phosphatases (DOI et al. 1994 Down; ZHAN et al. 1997 Down). Because the expression of several of these negative regulatory factors is pheromone-inducible, transcriptional regulation is likely to be an important part of the adaptive process.

We have shown previously that adaptation is promoted strongly in wild-type cells that overexpress signaling-defective G protein ß subunits (GRISHIN et al. 1994 Down). The mechanism of this "hyperadaptive" phenotype may be novel because it does not involve pheromone degradation, receptor phosphorylation or endocytosis, Sst2, or the dual-specificity phosphatase encoded by MSG5. From our previous studies we hypothesized that overexpression of mutant Gß subunits in wild-type cells promotes an adaptive process that attenuates pheromone response. As part of an effort to define this adaptive mechanism, we report the identification of mutations that abrogate the hyperadaptive phenotype. This has identified the MOT3 gene, a previously uncharacterized gene that encodes a member of the Cys2-His2 Zn finger family of transcription factors. We present evidence that Mot3 is a transcriptional regulator of several yeast genes, possibly including those involved in attenuating the activity of the pheromone response pathway.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and media:
Yeast strains used in this study are listed in Table 1. Growth media (YPD, YPG, supplemented SD, and sporulation media) were prepared as described previously (SHERMAN 1991 Down). SGal contains galactose (2%) and sucrose (0.2%) instead of glucose. Synthetic {alpha}-factor (Washington University Protein Chemistry Laboratory, St. Louis, MO) was added to media to a final concentration of 1 µM, unless indicated otherwise.


 
View this table:
In this window
In a new window

 
Table 1. Yeast strains used in this study

Plasmids:
The following plasmids were used as promoter-lacZ fusion reporters: pLGD312s (CYC1-lacZ; GUARENTE and HOAR 1984 Down), pBM2773 (SUC2-lacZ), pBM2636 (HXT1-lacZ), pBM2717 (HXT2-lacZ), pBM2819 (HXT3-lacZ), pBM2800 (HXT4-lacZ), pBM2832 (LEU2-lacZ; OZCAN and JOHNSTON 1996A Down), pJJ13 (PCK1-lacZ; MERCADO and GANCEDO 1992 Down); pD-lacZ R37 (GAL1-lacZ; SINGER et al. 1990 Down); pSL307 and its LEU2-marked derivative pRS425 FUS1-lacZ (FUS1-lacZ; MCCAFFREY et al. 1987 Down); pMR1300 (KAR3-lacZ; MELUH and ROSE 1990 Down). Other newly constructed promoter-lacZ fusions were made by using BamHI and EcoRI-cut YEp357R (MYERS et al. 1986 Down) as a recipient for PCR-generated promoter DNA fragments with the following endpoints relative to translation starts: -517 to +132 (CUP1), -245 to +243 (FUS3), -811 to +60 (SST2), and -335 to +182 (AGA1), resulting in plasmids pAG33, pAG34, pAG35, and pAG36. ß-Galactosidase levels for these plasmids have been reported by others or confirmed by us (unpublished results) to correlate with transcript levels. pAG37 was constructed by inserting four lexA operators (KELEHER et al. 1992 Down) into the SalI site upstream of the GAL1 promoter of pD-lacZ R37 (SINGER et al. 1990 Down). To construct pAG38, the oligonucleotides (CTAGAAGCAGGCATTACAAGGCACTGACAGGTAAAACAGGTAAAGGCA and CTAGTGCCTTTACCTGTTTTACCTGTCAGTGCCTTGTAATGCCTGCTT; Mot3 binding sites are underlined) were annealed and the resulting duplex inserted into the XbaI site of pAG33. pAG40 was constructed by inserting a 2.4-kb EcoRI-SalI fragment encompassing the entire MOT3 gene and its promoter into EcoRI and SalI-cut pFAT-RS303'b' (provided by D. GOTTSCHLING, Fred Hutchinson Cancer Center, Seattle, WA). To construct pAG44, the 3' part of MOT3 was amplified with primers CCGCTCGAGTCATCAGACCATAAATATATCC and CGGGATCCTTGTTAAATGAGTGGGAAGGG and cloned into XhoI and BamHI-cut pET-15b (Novagen). pAG41 was constructed by amplifying the complete MOT3 open reading frame (ORF) with primers GGATCCGGACATATCATATTTGAG and ATCGATTTTGTTGTGACTAACAATAAGGTT and cloning the PCR product into BamHI and ClaI-cut pGFP-C-FUS (NIEDENTHAL et al. 1996 Down). pAG42 was constructed by amplifying the entire MOT3 coding sequence with primers GGAATTCGGGACATATCATATTCGAGCAATGAATGCGG and GGATCCTTGTTAAATGAGTGGGAAGGG and by cloning the amplification product into EcoRI and BamHI-cut pSH2-1 (MA and PTASHNE 1987 Down). pBM3306 (OZCAN and JOHNSTON 1996B Down) and pAG3-26 (GRISHIN et al. 1994 Down) were described previously. A YCp50-based yeast genomic DNA library (ROSE et al. 1987 Down) was used to clone the MOT3 gene.

Genetic methods:
Ethylmethane sulfonate (EMS) mutagenesis, crosses, and asci dissection were performed as described previously (GUTHRIE and FINK 1991 Down). Hyperadaptation-defective mutants that retain the ability to overexpress signaling-defective Gß subunits were identified based on their ability to adopt shmoo-like morphologies when grown on galactose. Based on our previous studies (GRISHIN et al. 1994 Down), this partial constitutive activation of the pathway apparently occurs because mutant Gß{gamma} complexes sequester G{alpha} subunits, liberating sufficient wild-type Gß{gamma} complexes to cause partial constitutive activation of the pathway. Spheroplasts were fused in the presence of polyethylene glycol according to published methods (VAN SOLINGEN and VAN DER PLATT 1977 Down). One of the parents carried pAG3-26 and the other parent carried YCp50, allowing fusion diploids to be selected by plating on media lacking uracil and histidine. Gene disruptions were performed by using the one-step replacement technique (ROTHSTEIN 1991 Down). The plasmid pBMK8 (provided by D. LEVIN, Johns Hopkins University) was used to disrupt MOT3 with URA3. This plasmid is a derivative of YEp352 (HILL et al. 1986 Down) carrying a 3-kb genomic BamHI-SphI MOT3 fragment in which a central NotI-NheI 800-bp portion of the coding sequence (encoding amino acids 116–424, which includes both Zn fingers) was replaced with a 1.1-kb URA3 fragment. A 3-kb SphI-EcoRI fragment containing the disrupted MOT3 gene was isolated and used for one-step gene replacement. The STE20 gene was disrupted as follows. A 5.5-kb EcoRI-KpnI partial digestion product of yeast genomic DNA carrying the STE20 gene was cloned into EcoRI and KpnI-cut pRS314 (SIKORSKI and HIETER 1989 Down) to make pAG5. A 3.2-kb SphI-KpnI fragment encompassing the entire STE20 gene was replaced with a 1.1-kb URA3 fragment, resulting in pAG6. pAG6 was cleaved with EcoRI and HindIII and used for one-step gene replacement. The STE4, STE11, and STE12 genes were disrupted using the following plasmids: PstI and XhoI-cut pAG4 (GRISHIN et al. 1994 Down), XbaI-cut pNC276 (RHODES et al. 1990 Down), and SacI and SphI-cut pSUL16 (FIELDS and HERSKOWITZ 1987 Down). All disruptions were confirmed by PCR or Southern blotting. Derivatives of the strain AG65 carrying ste18 or ste7 mutations were selected among spontaneous pheromone-resistant mutants and identified by complementation with M91p1 (STE18) (WHITEWAY et al. 1989 Down) and pSTE7.2 (STE7) (TEAGUE et al. 1986 Down), respectively.

Purification of recombinant His-tagged Mot3{Delta}N protein, electrophoretic mobility shift assays (EMSA), and methylation interference assays:
Escherichia coli [BL21(DE3); Novagen] carrying pAG44 were grown to late-log phase, and His-tagged Mot3{Delta}N (residues 339-490, including both Zn fingers) was purified by affinity chromatography on Ni2+-NTA resin, as described previously (WATSON et al. 1996 Down). Promoter DNA fragments for EMSA were prepared by using T4 polynucleotide kinase and [{gamma}-32P]ATP to end-label PCR fragments with the following endpoints relative to translation starts: -295 to +40 (CYC1), -636 to +34 (SUC2), -462 to +42 (FUS1), -517 to +132 (CUP1), -410 to +13 (LEU2), -263 to -17 (FUS3), and -811 to +60 (SST2). Double-stranded oligonucleotide probes were prepared by annealing two completely or partially overlapping complementary oligonucleotides, one of which was labeled at the 5' end, and by filling in recessed 3' ends with Klenow polymerase and deoxynucleoside triphosphates (dNTPs), if necessary. For experiments designed to define a consensus Mot3 binding site, a set of labeled probes having the same specific activity was prepared in the following way. Oligonucleotides with the sequences GCAACCAGXXXXXXGACGACAACAACTGTGCTGCTGA, where XXXXXX are variants of the sequence CAGGCA (2 pmol each) were annealed to 0.1 pmol of the primer TCAGCAGCACAGTTGTTGTCGTC, which had been 5'-end-labeled (the same preparation of labeled primer was used to generate each probe); the primer was extended with Klenow polymerase and dNTPs. Binding reactions (20 µl) contained labeled probe (20,000 Cerenkov counts; 0.1 ng or less), purified His-tagged Mot3{Delta}N (0.2 µg, unless indicated otherwise) or His-tagged Go{alpha} (0.2 µg), bovine serum albumin (1 µg), competitor DNA as indicated, Tris pH 7.5 (10 mM), KCl (50 mM), MgCl2 (10 mM), ZnSO4 (10 µM), and glycerol (10%). Samples were incubated 15 min at 30° and separated by electrophoresis through 4% polyacrylamide gels (80:1 acrylamide:bis) in 0.5x Tris-acetate-EDTA (TAE) buffer. Gels were dried and exposed to X-ray film; alternatively, images were acquired on a Phosphorimager II and quantified using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Methylation interference experiments used as a probe a double-stranded oligonucleotide corresponding to the region of the CYC1 promoter between bases -195 and -119 (relative to the translational start). This 5'-labeled DNA was treated with dimethyl sulfate and subjected to EMSA, as described above. Samples were fractionated electrophoretically through a 1.5% agarose gel in 0.5x TAE buffer; shifted and unshifted bands were located by autoradiography and excised. These DNA samples were cleaved at guanosine residues by using Maxam-Gilbert chemistry and resolved on sequencing gels.

Pheromone response assays:
Quantitative mating tests, halo assays, morphological response assays, and measurement of pheromone-induced gene expression were performed as described previously (GRISHIN et al. 1994 Down). The following assay was also used to detect differences in adaptation capacity. Exponentially growing cultures were diluted to 500 cells/ml in YPD and 100-µl aliquots of this diluted culture were dispensed into wells of a sterile 96-well plate. After various amounts of synthetic {alpha}-factor were added to the wells, the plate was covered and incubated at 30° for 2 days. The absence of growth indicated the inability to adapt to a given pheromone concentration.

Other methods:
RNA isolation from yeast and Northern blotting were performed as described (FLICK and JOHNSTON 1990 Down). As a hybridization probe, a 32P-labeled 800-bp PstI-SacII fragment from MOT3 ORF was used. For fluorescence microscopy, wild-type cells (strain 31K) were transformed with pAG41, transformants grown overnight in SD-uracil, and transferred into SD-uracil-methionine for 5–6 hr to induce expression of the Mot3-GFP fusion protein. Cells were harvested by centrifugation at 1000 rpm, fixed with 3.8% formaldehyde for 5 min, and stained with DAPI (0.1 µg/ml) for 15 min. Images were obtained using BX60 microscope (x100 objective) equipped with BX-FLA reflected light fluorescence attachment (Olympus, Lake Success, NY) and VE-470 camera (Optronics, Goleta, CA).

Nucleotide sequence accession number:
The nucleotide sequence of the MOT3 gene was deposited in GenBank under the accession number U25279 (MADISON et al. 1998 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Isolation of suppressors of hyperadaptation:
Hyperadaptation to pheromone promoted by overexpression of signaling-defective Gß subunits is independent of several known adaptive mechanisms in yeast (GRISHIN et al. 1994 Down). We therefore reasoned that identifying genes whose functions are required for hyperadaptation may reveal new negative controls of the pheromone response pathway. We used the following approach to isolate mutants in which the hyperadaptive phenotype is abrogated. Wild-type MATa cells (AG56) overexpressing signaling-defective Gß subunits (from the inducible GAL promoter on pAG3-26) were treated with EMS to induce mutations and grown to form colonies. Approximately 50,000 colonies were screened by replica plating for mutants that have lost the ability to grow on media containing {alpha}-factor at a concentration that inhibits growth of normal but not hyperadaptive cells. Phenotypic analysis indicated that the majority of these mutants failed to overexpress signaling-defective Gß subunits, as expected (see MATERIALS AND METHODS). However, eight isolates (AG56-5, -46, -58, -80, -102, -119, -138 and -143) were putative hyperadaptation-defective mutants because they retained the ability to overexpress mutant Gß subunits. This was confirmed by performing pheromone-induced growth arrest (halo) assays under conditions where signaling-defective Gß subunits were overexpressed. The eight mutants responded relatively normally to pheromone (halo sizes were normal), but they failed to adapt rapidly (halos were clear instead of being turbid; Figure 1 shows the halo phenotype of mutant AG56-5, which was similar to that of the seven other mutants). The failure to form turbid halos was not due to decreased viability upon treatment with pheromone (data not shown).



View larger version (117K):
In this window
In a new window
Download PPT slide
 
Figure 1. —Pheromone response phenotypes of wild-type cells, hyperadaptation-defective mutants, and MOT3-overexpressing cells. Pheromone-induced growth arrest (halo) assays were performed using Sgal -histidine -uracil medium. {alpha}-Factor (1, 0.2, 0.04, 0.008, and 0.0016 µg, clockwise from top) was applied on nascent lawns. Plates were incubated 2 days at 30° and photographed. (A) Wild-type cells (AG56) containing control plasmids YCp50 and pRS313. (B) Wild-type cells (AG56) overexpressing signaling-defective Gß subunits (from pAG3-26) and carrying YCp50. (C) Hyperadaptation-defective mutant (AG56-5) overexpressing signaling-defective Gß subunits (from pAG3-26) and carrying YCp50. (D) Hyperadaptation-defective mutant (AG56-5) overexpressing signaling-defective Gß subunits (from pAG3-26) and carrying a genomic library plasmid (pAG50{Delta}R) that corrects the hyperadaptation defect. (E) A mot3::ura3 mutant (AG65) overexpressing signaling-defective Gß subunits and carrying YCp50. (F) Wild-type cells (AG56) overexpressing MOT3 from 2µ-based plasmid pAG40 and carrying YCp50.

To determine whether the mutations responsible for the hyperadaptation defects were dominant or recessive and to assign complementation groups, we fused spheroplasts of each mutant with spheroplasts of wild-type MATa cells, or with spheroplasts of the other mutants. The hyperadaptation phenotypes of the resultant fusion diploid cells were determined by performing halo assays under conditions where signaling-defective Gß subunits were overexpressed. All of the mutations appeared to be recessive, because MATa/MATa diploids produced by fusion of mutants with wild-type cells formed turbid halos (data not shown). Assays of diploids produced by pairwise fusions of the mutants defined two complementation groups: seven mutants belong to one complementation group and one mutant belongs to the other complementation group (data not shown). The following sections describe the identification and characterization of the gene corresponding to the larger complementation group; studies of the second complementation group will be reported elsewhere.

Cloning, sequencing, and expression of MOT3:
A YCp50-based yeast genomic DNA library was screened for plasmids that corrected the hyperadaptation defect of mutant AG56-5 (restored the ability of cells to form colonies on plates containing {alpha}-factor). Of the eight plasmids isolated, partial sequencing revealed that seven contained either the MAT{alpha} or HML{alpha} genes. These plasmids caused pheromone resistance because they result in expression of the a1/{alpha}2 repressor that turns off expression of mating-specific genes. The remaining plasmid contained a 4.5-kb fragment from the right arm of chromosome XIII. The minimum complementing region of this 4.5-kb fragment (a 2.4-kb EcoRI-SalI subfragment) contained a single ORF corresponding to YMR070W. This ORF encodes a polypeptide of 490 amino acids with two Cys2-His2 Zn finger motifs (consensus CX(2-4)CX(9)LX(2)HX(3-4)H (KLUG and RHODES 1987 Down) in the C-terminal half of the molecule (Figure 2). Zn fingers of this class form DNA binding domains of a large family of transcription factors (EVANS and HOLLENBERG 1988 Down), which suggests that the cloned gene encodes a transcription factor. The Zn fingers are most similar to those of several mammalian Zn finger transcription factors, including MAZ and Zfp64 (Figure 2). The yeast gene product has other features of a transcription factor, including regions rich in glutamine or proline (TJIAN and MANIATIS 1994 Down), and high concentration of positively charged and polar amino acids in the Zn finger domain (KLUG and RHODES 1987 Down). We named the gene MOT3 because subsequent experiments indicated that it is a modulator of transcription. Northern blotting revealed that MOT3 was expressed at similar levels regardless of cell type or pheromone exposure (data not shown).



View larger version (47K):
In this window
In a new window
Download PPT slide
 
Figure 2. —Structure of Mot3 and its similarity to other Zn finger proteins. (A) Structural features of Mot3. Black, Zn fingers; vertical lines, glutamine-rich region; shaded, asparagine-rich regions; hatched, region rich in proline residues. The positions of the N and the C termini are indicated (positions 1 and 490, respectively). (B) Alignment of the Zn fingers of Mot3 with related Zn finger transcription factors. Amino acid sequences are aligned to match the conserved cysteine and histidine residues. Gaps were introduced to maximize similarity. Identical and similar residues are boxed in black. Asterisks mark residues involved in DNA recognition according to the Zn finger recognition code. PLAG1, human Zn finger protein (accession number U65002); ROAZ, rat Zn finger protein (U92564); ZNF6, human transcription factor (S25409); ZFP64, mouse Zn finger protein (U49046); MAZ, human Zn finger protein (U33819). Numbers on the right indicate positions of Zn fingers in the amino acid sequence of each protein.

To determine whether mutations in the MOT3 gene are responsible for the hyperadaptation defects of the original mutants, we studied genetic linkage between one of the mutations and the MOT3 locus. MOT3 was disrupted with the URA3 gene (in W303-1B; the disruptants were viable), and the resultant strain was crossed with the mutant AG56-5. Twenty haploid MATa Ura- meiotic segregants derived from this cross were transformed with a plasmid (pAG3-26) that overexpresses signaling-defective Gß subunits. The results of halo assays showed that all 20 Ura- segregants were hyperadaptation-defective (clear halos; data not shown), indicating that the original mutation in AG56-5 and the mot3::URA3 disruption are tightly linked. We also found that mutants carrying the mot3::URA3 allele and the original AG56-5 mutant displayed equivalent defects in hyperadaptation, as indicated by halo assays (Figure 1E). Therefore, MOT3 appeared to be defective in the original mutants. Subsequently, the properties of mot3 mutations were studied using mot3 disruption strains.

MOT3 negatively regulates pheromone signaling:
To determine whether MOT3 influences pheromone responses in cells that do not overexpress signaling-defective Gß subunits, we examined the effects of mot3 mutations on several signaling-related phenotypes. First, in quantitative mating assays or halo assays, mot3 mutants were indistinguishable from isogenic wild-type controls (data not shown). However, because it can be difficult to detect modest differences in adaptation phenotypes by halo assay, a second type of adaptation assay was used (see MATERIALS AND METHODS). The results indicated that wild-type cells were able to grow (adapt) at a two-fold higher concentration of {alpha}-factor than could mot3 mutants (Figure 3). Similarly, mot3 mutants were threefold more sensitive to pheromone, as indicated by dose-response curves for pheromone-induced morphological changes (shmoo formation; data not shown).



View larger version (59K):
In this window
In a new window
Download PPT slide
 
Figure 3. —Adaptation phenotypes of wild-type, mot3::ura3 mutant, and MOT3-overexpressing cells. Wild-type (AG56), mot3::ura3 (AG65), and MOT3-overexpressing (AG56 containing MOT3 on the high-copy plasmid pAG40) cells were analyzed. Wells of a 96-well plate were inoculated with ~100 cells of the indicated genotypes in 100 µl of YPD, and the indicated levels of {alpha}-factor were added. The plate was incubated 2 days at 30° and photographed. Cells that adapted to a given level of pheromone grew to form turbid cultures, which appear black when photographed in transmitted light; cultures that did not adapt and failed to grow appear white.

MOT3 overexpression had the opposite effects. It markedly decreased sensitivity to pheromone and/or stimulated adaptation, as judged by the formation of smaller, turbid halos (Figure 1F) and by the ability of cells to grow in liquid media containing higher concentrations of {alpha}-factor (Figure 3). These lines of evidence suggest that MOT3 is a dosage-dependent regulator of pheromone signaling and/or adaptation.

MOT3 represses expression of pheromone-induced genes and activates expression of other yeast genes:
Consistent with the effects of MOT3 on pheromone-induced growth arrest and morphological changes, we found that MOT3 negatively regulates expression of pheromone-induced genes. In mot3 mutants, basal and pheromone-induced (at low pheromone concentration) expression of FUS1-lacZ and SST2-lacZ reporters was increased (Figure 4). Similar increases in basal gene expression were observed with several other pheromone-inducible promoters (AGA1, FUS3, and KAR3) driving expression of lacZ (Table 2), indicating that a mot3 mutation is likely to have similar effects on most, if not all, pheromone-induced promoters. Conversely, MOT3 overexpression inhibited expression of pheromone-induced genes about threefold, as indicated by shifts in dose-response curves (Figure 4B) and basal expression levels (Table 2).



View larger version (19K):
In this window
In a new window
Download PPT slide
 
Figure 4. —Effects of MOT3 on pheromone responses. Dose-response curves for {alpha}-factor-induced expression of SST2-lacZ (A) and FUS1-lacZ (B). The strains used were AG56 (WT), AG65 (mot3{Delta}), and AG56[pAG40] (2µ-MOT3). Cells grown to early log phase (Klett = 10) in appropriately supplemented SD media were incubated for 2 hr at the indicated pheromone concentrations prior to assaying ß-galactosidase activity. Squares, mot3{Delta}; circles, 2µ-MOT3; diamonds, wild type.


 
View this table:
In this window
In a new window

 
Table 2. Effects of MOT3 disruption and overexpression on gene expression

To determine whether MOT3 specifically regulates pheromone-inducible genes, we examined the expression of genes unrelated to pheromone response or mating. As shown in Table 2 and Figure 5, the expression of several genes was affected by MOT3. Surprisingly, the effects of MOT3 on these promoters were opposite of what was observed with pheromone-responsive promoters. A mot3 mutation decreased expression from the CYC1, SUC2, and LEU2 promoters an average of threefold. Conversely, MOT3 overexpression increased expression from the CYC1, SUC2, LEU2, HXT2, HXT3, and HXT4 promoters, with HXT2 being induced most strongly (eightfold). However, the expression of other genes, including PKC1, HXT1, GAL1, and CUP1, was unaffected by MOT3. Therefore, MOT3 represses pheromone-inducible genes and activates a subset of genes unrelated to pheromone signaling or mating.



View larger version (31K):
In this window
In a new window
Download PPT slide
 
Figure 5. —Effects of MOT3 on CYC1 and SUC2 transcript levels. Total RNA (10 µg per lane) from AG64 (mot3{Delta}), AG56 [YCp50] (WT), and AG56 [YEp352-MOT3] was treated with glyoxal, electrophoresed through a 1.2% agarose gel, and transferred to a charged Nylon membrane. Northern blots were hybridized to end-labeled 50-mer antisense oligonucleotides corresponding to coding sequences of the indicated genes. Radioactivity present in each band was measured using a Phosphorimager; relative radioactivity values are shown below each panel.

Because MOT3 regulates a significant proportion of the promoters we examined, it may affect expression of many yeast genes. Accordingly, we examined mot3 mutants for a variety of phenotypes, including growth rate in YPD, YPD + 1 M KCl, YP + glycerol, and synthetic media; growth at 37° or 14°; sensitivity to heat shock (45° for 30 min); survival rate after transfer from 1 M sorbitol to water; survival upon irradiation with short-wave ultraviolet light at 20 mJ/cm2; survival in stationary phase; and effects on cell morphology or sporulation efficiency. Wild-type cells and mot3 mutants were indistinguishable with regard to these phenotypes (data not shown). However, when isogenic wild-type and mot3 mutants were continuously cocultivated in YPD for 100 generations, the proportion of mutant cells dropped from 50 to 30%, indicating a slight selective disadvantage conferred by the disruption.

MOT3 requires an intact signaling pathway to affect expression of pheromone-induced genes:
Previous investigations have revealed that basal expression of pheromone-induced genes is controlled in part by mechanisms that require an intact signaling pathway, as well as mechanisms that do not (BARDWELL et al. 1994 Down). To determine which of these mechanisms may be affected by MOT3, we constructed a set of isogenic strains in which a mot3::ura3 disruption was combined with recessive mutations affecting various components of the pheromone response pathway [G protein ß- and {gamma}-subunits (ste4 and ste18 mutations, respectively), a PAK homolog (ste20 mutation), an MEKK homolog (ste11 mutation), MEK homolog (ste7 mutation), or the pheromone-regulated transcription factor (ste12 mutation)]. These strains were used to measure the basal expression of a pheromone-inducible reporter (FUS1-lacZ). Unlike what we observed with cells containing an intact signaling pathway, disruption of MOT3 failed to increase basal gene expression when the pathway was disrupted at the G protein level or points downstream (Table 3). Therefore, the effects of a mot3 mutation were similar to those of cdc36, cdc39, and mot2 mutations, which elevate basal expression of pheromone-responsive genes in a pathway-dependent manner (DE BARROS LOPES et al. 1990 Down; NEIMAN et al. 1990 Down; CADE and ERREDE 1994 Down; IRIE et al. 1994 Down; LEBERER et al. 1994 Down). This is distinct from the effects of a mot1 mutation, which elevates basal transcription of pheromone-responsive genes independently of the pheromone response pathway (DAVIS et al. 1992 Down).


 
View this table:
In this window
In a new window

 
Table 3. Effects of ste mutations on basal expression of FUS1-lacZ in mot3 null mutants

Mot3-GFP localizes to the nucleus:
We fused green fluorescent protein (GFP) to the C terminus of Mot3 (the chimeric protein was functional, as indicated by its ability to correct the hyperadaptation defect of a mot3 null mutant). Mot3-GFP fluorescence was restricted mostly to the nucleus, as indicated by costaining with DAPI (Figure 6), consistent with Mot3 functioning as a transcription factor.



View larger version (80K):
In this window
In a new window
Download PPT slide
 
Figure 6. —Nuclear localization of Mot3-GFP. Wild-type cells (31K) containing pAG41 (top), pGFP-C-FUS (middle), or YCp50 (bottom) were grown overnight in SD-uracil and then for 6 hr in SD -uracil -methionone. Cells were fixed with formaldehyde, stained with DAPI, and observed under the fluorescence microscope.

Mot3 is a transcriptional activator:
The preceding results indicate that Mot3 is a nuclear protein that represses or activates gene expression, depending on the promoter being examined. To investigate whether transcriptional repressor and/or activator function is intrinsic to the Mot3 polypeptide, we determined whether Mot3 activates or represses gene expression when it is recruited to a heterologous promoter. This was done by fusing Mot3 to the C terminus of the lexA DNA binding domain (amino acids 1–87). To test for activator function, we used a GAL1-lacZ reporter in which lexA binding sites replace the normal GAL1 upstream activation sequence (UAS). As shown in Table 4, this reporter was induced ~fivefold in cells expressing the lexA-Mot3 fusion protein. To test for repressor activity, we used a GAL1-lacZ reporter plasmid in which lexA binding sites were placed immediately upstream of the GAL1 UAS. Expression from this reporter was unaffected by the presence of lexA-Mot3. In contrast, this reporter was repressed about twofold when Rgt1, a known repressor protein, was fused to lexA. Expression of either lexA or Mot3 alone had no effect on either reporter. These results suggest that Mot3 can function as a transcriptional activator. They do not rule out that Mot3 can also function as a transcriptional repressor.


 
View this table:
In this window
In a new window

 
Table 4. Effects of Mot3-lexA on expression from promoters containing lexA operators

DNA binding activity of Mot3:
To determine whether Mot3 is likely to function as a sequence-specific transcription factor, we examined the ability of purified His-tagged Mot3{Delta}N (residues 339–490, containing both Zn fingers) to bind DNA in electrophoretic mobility shift assays (EMSA). Four promoter probes were used: CYC1, SUC2, and FUS1, which are affected by MOT3, and CUP1, which is not. Promoter DNA fragments from all four genes bound His-tagged Mot3{Delta}N, as indicated by the appearance of one or more slower migrating bands relative to unbound DNA probe bands. A control protein (His-tagged Go{alpha} purified in an identical manner) did not bind the probes. Binding was specific because unlabeled probe DNAs were effective competitors, whereas poly(dA)·poly(dT) and poly(dIdC)·poly(dIdC) were not (Figure 7). Poly(dG)·poly(dC) was an effective competitor for binding to the SUC2 probe (Figure 7 and Figure 8) or other labeled probes (data not shown), suggesting that Mot3 binding sites may be GC-rich.



View larger version (40K):
In this window
In a new window
Download PPT slide
 
Figure 7. —Electrophoretic mobility shift assays (EMSA) using His-tagged Mot3{Delta}N and various promoter DNA fragments. DNA fragments derived from the indicated promoters were amplified from genomic DNA using PCR. These fragments were end-labeled with 32P for use as probes or left unlabeled for use as cold competitor DNAs. Binding reactions were resolved on acrylamide gels, and gels were dried and subjected to autoradiography. Arrowheads indicate positions of unbound probes.



View larger version (21K):
In this window
In a new window
Download PPT slide
 
Figure 8. —Competition of various DNAs for binding His-tagged Mot3{Delta}N. Binding reactions were performed with a 32P-labeled DNA fragment from the SUC2 promoter, His-tagged Mot3{Delta}N, and varying amounts of the indicated unlabeled promoter DNA fragments as competitor DNAs. Promoter fragments used as probes and competitors were the same as those in Figure 7. Binding reactions were resolved on a native polyacrylamide gel, and the amounts of label migrating at the positions of bound and unbound probes were determined using a Phosphorimager. Data (average of three experiments, with individual points differing 20% or less) are presented as the percentage of the probe that was unbound.

Although all four promoters we tested bound His-tagged Mot3{Delta}N, several pieces of evidence suggested that their relative binding affinities differ. First, the CYC1 and SUC2 probes were shifted to multiple retarded positions, whereas FUS1 and CUP1 probes were only shifted to a single retarded position (Figure 7). Second, at a concentration of Mot3{Delta}N that was sufficient to bind nearly all of the CYC1 and SUC2 probes, only a fraction of the FUS1 or CUP1 probes was shifted (Figure 7). Third, competition experiments indicated that unlabeled CYC1 and SUC2 promoter fragments were efficient competitors for binding to a labeled SUC2 promoter fragment, whereas FUS1 and CUP1 fragments were inefficient competitors (Figure 8). Similarly, a fragment of the LEU2 promoter, which is positively regulated by MOT3, bound His-tagged Mot3{Delta}N relatively efficiently (multiple shifted bands) and was an effective competitor for binding to the SUC2 probe (data not shown). Therefore, efficient binding of Mot3{Delta}N to the CYC1, SUC2, and LEU2 promoters in vitro correlated with the ability of MOT3 to stimulate expression of these genes, suggesting that Mot3 may bind these promoters to activate them.

Identification of a consensus Mot3 binding site:
To identify promoter elements that may be bound by Mot3, we initially used the recognition code for Cys2-His2 Zn finger proteins to deduce a putative Mot3 binding site (CHOO and KLUG 1997 Down). The sequence of the Mot3 Zn fingers suggested that the Mot3 binding site is a 6-bp element in which the second, third, fourth, and sixth positions are likely to be A, G, G, and G, respectively.

Because the other two positions of the putative recognition site could not be deduced by the Zn finger recognition code, and because Zn finger-DNA interactions could differ from predictions (GRIESMAN and PABO 1997), we determined the recognition sequence of Mot3 empirically. First, we analyzed small fragments of one of the promoters (CYC1) that appeared to contain multiple Mot3 binding sites (yielded multiple shifted bands), with the goal of identifying several single binding sites whose sequences could be compared. We started with a 335-bp CYC1 fragment (-295 to +40; designated here and elsewhere relative to the translational start) that yielded the EMSA pattern shown in Figure 7. Synthetic DNA duplexes corresponding to smaller portions of this fragment were used in EMSA to identify putative Mot3 binding sites. This identified three 30-bp fragments (-195 to -166, -104 to -75, and -75 to -46), each containing at least one Mot3 binding site (data not shown). As predicted by the code, each of these DNA fragments contained the sequence AGG. However, none matched the predicted NAGGNG motif, because they contained A, T, or C at position 6. The fragment that displayed the strongest binding (-195 to -166; data not shown) contained the sequence CAGGCA.

To determine whether the sequence CAGGCA in the CYC1 promoter actually binds Mot3, we used the methylation interference assay. The probe was a synthetic duplex spanning positions -195 to -119. The results indicated that Mot3 binds the CAGGCA sequence, because methylation of the two central guanosine residues of this sequence interfered with Mot3 binding (Figure 9).



View larger version (11K):
In this window
In a new window
Download PPT slide
 
Figure 9. —Methylation interference mapping of a Mot3 binding site in the CYC1 promoter. An oligonucleotide corresponding to a region of the CYC1 promoter (-195 to -119; top strand) was labeled at the 5' end and annealed with the unlabeled complementary oligonucleotide. Guanosine residues were methylated substoichiometrically with dimethylsulfate, and the double-stranded DNA fragment was subjected to EMSA using His-tagged Mot3{Delta}N. DNAs migrating at the positions of bound and free probe were excised individually from an agarose gel, extracted, and cleaved with piperidine. Cleavage products were resolved on a sequencing gel. U, DNA from unshifted (free probe); S, DNA from shifted (bound) band. Arrowheads indicate two guanosine residues whose methylation appears to inhibit the binding of His-tagged Mot3{Delta}N. The sequence spanning these residues is marked by the vertical line. Part of the sequence is shown on the left (5' end is at the bottom).

To define a Mot3 binding site further, we prepared a set of duplex DNAs in which variants of the CAGGCA sequence were placed in a DNA fragment that otherwise does not bind His-tagged Mot3{Delta}N, and used them as probes in EMSA experiments. The labeled probes we used had the same specific activities (see MATERIALS AND METHODS), allowing direct comparisons of relative binding efficiencies to be made. Binding efficiencies were expressed as the percentage of the total probe that was shifted to a reduced mobility.

The results of these experiments are shown in Figure 10, leading to the following conclusions. First, the AGG core sequence (positions 2–4) was important because Mot3{Delta}N bound poorly to derivatives in which any position in this sequence was altered (CBGGCA, CAHGCA, or CAGHCA, where B is G, C, or T in equal proportion, and H is A, C, or T in equal proportion). Second, an A at position 6 was strongly preferred over other bases. Third, C, A, or T at position 1 and T or C at position 5 permitted relatively high affinity binding, with CAGGTA showing the highest apparent affinity. The results therefore suggested that a consensus binding site for Mot3 is (C>A>T)AGG(T>C)A.



View larger version (58K):
In this window
In a new window
Download PPT slide
 
Figure 10. —Determination of a consensus binding site of His-tagged Mot3{Delta}N. Labeled double-stranded oligonucleotides containing the indicated 6-bp sequences were used as probes for EMSA with His-tagged Mot3{Delta}N. The percentage of each labeled probe migrating at the position of bound and unbound DNA was determined using a Phosphorimager. (Top) Autoradiogram showing representative results. Arrowheads indicate the positions of the unbound probes. (Bottom) Quantitation of the amount of each probe that was bound.

Consensus Mot3 binding sites confer MOT3-dependent activation of a heterologous promoter:
To establish a causal relationship between Mot3 binding and transcriptional regulation, we inserted five artificial Mot3 binding sites into the CUP1 promoter in a CUP1-lacZ reporter plasmid. This promoter was chosen because its transcription is independent of MOT3 (Table 2) and it lacks close matches to a consensus Mot3 binding site. We found that expression of this reporter was four- to fivefold higher in wild-type cells than in mot3 mutants (Table 2). Thus, Mot3 binding sites can function as upstream activation sequences to drive gene expression.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have identified the MOT3 gene, which encodes a member of the Cys2-His2 Zn finger protein family, in a screen for mutations that abrogate the hyperadaptive phenotype of yeast cells overexpressing signaling-defective G protein ß subunits. We have shown that Mot3 is a nuclear DNA binding protein that can function as a transcriptional activator; we cannot rule out repressor function for Mot3. Whereas Mot3 directly or indirectly represses expression of pheromone-responsive genes, it activates expression of several yeast genes unrelated to pheromone response and mating. The implications of these findings in terms of the regulatory mechanisms that control gene expression and mating pheromone signaling in yeast are discussed below.

Mot3 is a globally acting transcription factor:
Based on several findings, Mot3 appears to be a globally acting transcription factor that affects the expression of several yeast genes. First, a Mot3 binding site matching the consensus sequence (C/T/A)AGG(T/C)A promotes Mot3-dependent transcriptional activation when present in multiple copies in a promoter that otherwise is insensitive to Mot3. Based on this consensus, Mot3 binding sites should occur on average every 724 bp in the yeast genome, such that many promoter regions are likely to contain at least one putative Mot3 binding site. Indeed, examination of the promoter sequences of 45 yeast genes, which control a variety of processes including mating, proliferation, transcription, cytoskeletal function, and stress response, reveals that several contain three or more consensus Mot3 binding sites (STE2, FAR1, CLN1, MOT2, MYO1, and SSA4). Interestingly, the 5'-flanking region upstream of the MOT3 ORF has three sites, suggesting that autoregulation of the gene could occur.

More strikingly, approximately half of the promoters we studied that contain putative Mot3 binding sites are affected by MOT3. Three patterns of MOT3-dependent regulation have been found. Class 1 promoters (e.g., HXT2, HXT3, and HXT4) show relatively weak positive regulation because they are unaffected by a mot3 null mutation, but they are stimulated upon MOT3 overexpression. Class 2 promoters (e.g., CYC1, SUC2, and LEU2) exhibit stronger positive regulation because their activities are decreased in mot3 mutants and increased in cells overexpressing MOT3. The stronger positive regulation of Class 2 promoters correlates with strong Mot3 binding and multiple shifted bands in EMSA. Class 2 promoters may be regulated more strongly because they apparently contain more consensus Mot3 binding sites (three to five sites) than Class 1 promoters (one or two sites). We currently favor this explanation because other than the number of consensus Mot3 binding sites, there are no clear differences between Class 1 and Class 2 promoters in terms of the location of Mot3 binding sites relative to TATA elements or binding sites of other known transcription factors. However, because we do not know whether Mot3 binds either type of promoter in vivo, we cannot rule out that more complex, indirect effects of Mot3 are responsible for the differences we observe between Class 1 and Class 2 promoters.

In contrast to Class 1 and Class 2 promoters, Class 3 promoters (e.g., FUS1, FUS3, AGA1, SST2, and KAR3, which are all induced by mating pheromone) show modest negative regulation by MOT3. Their basal activities are increased in mot3 mutants and decreased in cells overexpressing MOT3. Whether Mot3 directly represses these promoters is unclear. Although we found that a Mot3-lexA fusion lacks detectable repressor activity, the repressor activity of Mot3 could be promoter-specific. Indeed, in mot3 mutants the expression of genes with promoter insertions of Ty or {delta}-elements is elevated (MADISON et al. 1998 Down). Alternatively, Mot3 could function indirectly to inhibit expression from pheromone-responsive promoters (see below).

Finally, some promoters (e.g., CUP1, PCK1, HXT1, and GAL1) are unaffected by Mot3. All these promoters lack matches (CUP1, GAL1) or have only one match (PCK1, HXT1) to the Mot3 consensus binding site we have defined. The CUP1 promotor displays weak binding of Mot3 in EMSA, which may be explained by the presence of a number of weaker noncanonical sites. It is possible that low affinity binding of Mot3 to these promotors is insufficient to cause detectable changes in their expression.

Consistent with its proposed function as a globally acting transcription factor, Mot3 has been identified by others as a high copy suppressor in two different contexts. MOT3 overexpression suppresses the cell wall integrity defect of mpk1{Delta} mutants (D. LEVIN, personal communication), which are defective in a MAP kinase-dependent signaling pathway. MOT3 overexpression also suppresses the lethal phenotype of mot1 spt3 double mutants (MADISON et al. 1998 Down), which are defective in factors that regulate the distribution of TATA-binding protein (TBP) at strong vs. weak promoters (COLLART 1996 Down; MADISON and WINSTON 1997 Down).

Although Mot3 is likely to affect the expression of a number of yeast genes, it may have a modulatory rather than an essential role in governing the efficiency of transcription. We suggest this because mot3 null mutants exhibit only mild defects in growth rate, and because none of the Cys2-His2 Zn-finger proteins encoded by the yeast genome is an obvious structural homolog that might be functionally redundant with Mot3. Potentially, Mot3 is used to "fine tune" or coordinate expression of a number of yeast genes. Mot3 could also be the major transcriptional activator of genes that are important for physiological functions we have not yet investigated.

Role of MOT3 in pheromone signaling:
Disruption of MOT3 has a relatively modest effect (two- to threefold) on pheromone signaling. It increases pheromone sensitivity and the basal expression of pheromone-responsive promoters and causes a slight defect in adaptation. However, this does not necessarily indicate that Mot3 has a relatively minor role in regulating pheromone signaling. For example, Mot3 could functionally overlap with structurally distinct transcription factors, which together exert a relatively prominent effect on pheromone signaling. This would be analogous to the overlapping functions of structurally distinct classes of protein phosphatases (the dual-specificity phosphatase Msg5 and the tyrosine phosphatases Ptp2 and Ptp3), which together have an important role in attenuating pheromone signaling by dephosphorylating the MAP kinase homologs, Fus3 and Kss1 (DOI et al. 1994 Down; ZHAN et al. 1997 Down).

In principle, Mot3 could be functionally redundant with other transcriptional regulators, such as Cdc36, Cdc39, or Mot2, that are known to negatively regulate the expression of pheromone-induced genes. Indeed, the effects of a mot3 mutation on pheromone-regulated promoters are similar to those caused by cdc36, cdc39, or mot2 mutations (DE BARROS LOPES et al. 1990 Down; NEIMAN et al. 1990 Down; CADE and ERREDE 1994 Down; IRIE et al. 1994 Down; LEBERER et al. 1994 Down), all of which affect expression of a number of yeast genes. Furthermore, mot3, cdc36, cdc39, and mot2 mutations all require an intact pheromone signaling pathway to increase basal activity of pheromone-inducible promoters. However, whether Mot3 regulates pheromone signaling by a mechanism similar to that used by Cdc36, Cdc39, or Mot2 is presently unclear because the biochemical functions of these proteins remain to be determined.

How might Mot3 negatively regulate the expression of pheromone-inducible genes? Because currently there is no direct evidence that Mot3 can act as a repressor, we suggest that it negatively regulates signaling by inducing the expression of factors that inhibit pheromone response. The target genes activated by Mot3 to inhibit signaling are probably not GPA1, SST2, or MSG5, which encode known negative regulators of the pheromone response pathway. This is suggested by our finding that Mot3 inhibits rather than activates basal expression of these or other pheromone-inducible genes. Mot3 may therefore promote the expression of other negative regulatory factors that impinge on the pheromone response pathway. An example of such a negative factor could be the G1 cyclin Cln2, whose overexpression has been shown to inhibit the pheromone response pathway at some point downstream of the G protein (OEHLEN and CROSS 1994 Down).

What is the role of Mot3 in mediating the hyperadaptive phenotype caused by overexpression of signaling-defective Gß subunits? One possibility is that mot3 mutations suppress the hyperadaptive phenotype nonspecifically simply by increasing pheromone sensitivity, allowing the signal to be sustained longer. This is an unlikely explanation because the hyperadaptive phenotype is not suppressed by other mutations, such as sst2 or receptor tail truncations, that increase pheromone sensitivity much more dramatically (10- to 100-fold) than mot3 mutations (GRISHIN et al. 1994 Down). Alternatively, certain target genes activated by MOT3 may be required specifically to mediate hyperadaptation. Defining these genes and characterizing their products may reveal new mechanisms that control the pheromone response pathway and other G protein and MAP kinase-dependent signaling pathways.


*  FOOTNOTES

1 Present address: University of California School of Medicine, San Francisco, CA 94143. Back


*  ACKNOWLEDGMENTS

We thank DAVID LEVIN and FRED WINSTON for communicating results prior to publication; DAVID LEVIN, MARK JOHNSTON, BEVERLY ERREDE, and MARK ROSE for gifts of plasmids, and MARK JOHNSTON for critical reading of the manuscript. This work was supported by grants from the National Institutes of Health and the American Cancer Society (K.J.B.). K.J.B. is an Established Investigator of the American Heart Association.

Manuscript received January 13, 1998; Accepted for publication March 4, 1998.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BARDWELL, L., J. G. COOK, C. J. INOUYE, and J. THORNER, 1994  Signal propagation and regulation in the mating pheromone response pathway of the yeast Saccharomyces cerevisiae.. Dev. Biol. 166:363-379[Medline].

CADE, R. M. and B. ERREDE, 1994  MOT2 encodes a negative regulator of gene expression that affects basal expression of pheromone-responsive genes in Saccharomyces cerevisiae.. Mol. Cell. Biol. 14:3139-3149[Abstract/Free Full Text].

CHEN, Q. and J. B. KONOPKA, 1996  Regulation of the G-protein-couple alpha-factor pheromone receptor by phosphorylation. Mol. Cell. Biol. 16:247-257[Abstract].

CHOO, Y. and A. KLUG, 1997  Physical basis of a protein-DNA recognition code. Curr. Op. Struct. Biol. 7:117-125[Medline].

CIEJEK, E. and J. THORNER, 1979  Recovery of S. cerevisiae a cells from G1 arrest by alpha factor phermone requires endopeptidase action. Cell 18:623-635[Medline].

COLLART, M. A., 1996  The NOT, SPT3, and MOT1 genes functionally interact to regulate transcription at core promoters. Mol. Cell. Biol. 16:6668-6676[Abstract].

DAVIS, J. L., R. KUNISAWA, and J. THORNER, 1992  A presumptive helicase (MOT1 gene product) affects gene expression and is require for ivability in the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:1879-1892[Abstract/Free Full Text].

DE BARROS LOPES, M., J. Y. HO, and S. I. REED, 1990  Mutations in cell division cycle genes CDC36 and CDC39 activate the Saccharomyces cerevisiae mating pheromone response pathway. Mol. Cell. Biol. 10:2966-2972[Abstract/Free Full Text].

DOHLMAN, H. G., J. SONG, D. MA, W. E. COURCHESNE, and J. THORNER, 1996  Sst2, a negative regulator of pheromone signaling in the yeast Saccharomyces cerevisiae: expression, localization, genetic interaction and physical association with Gpa1 (G protein alpha subunit). Mol. Cell. Biol. 16:5194-5209[Abstract].

DOI, K., A. GARTNER, G. AMMERER, B. ERREDE, and H. SHINKAWA et al., 1994  MSG5, a novel protein phosphatase promotes adaption to pheromone response in S. cerevisiae.. EMBO J. 13:61-70[Medline].

EVANS, R. M. and S. M. HOLLENBERG, 1988  Zinc fingers: gilt by association. Cell 52:1-3[Medline].

FIELDS, S. and I. HERSKOWITZ, 1987  Regulation by the yeast mating-type locus of STE12, a gene required for cell-type-specific expression. Mol. Cell. Biol. 7:3818-3821[Abstract/Free Full Text].

FLICK, J. S. and M. JOHNSTON, 1990  Two systems of glucose repression of the GAL1 promoter in Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:4757-4569[Abstract/Free Full Text].

GREISMAN, H. A. and C. O. PABO, 1997  A general strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites. Science 275:657-661[Abstract/Free Full Text].

GRISHIN, A. V., J. L. WEINER, and K. J. BLUMER, 1994  Control of adaptation to mating pheromone by G protein beta subunites of Sacchraomyces cerevisiae.. Genetics 138:1081-1092[Abstract].

GUARENTE, L. and E. HOAR, 1984  Upstream activation sites of the CYC1 gene of Saccharomyces cerevisiae are active when inverted but not when placed downstream of the "TATA box. " Proc. Natl. Acad. Sci. USA 81:7860-7864[Abstract/Free Full Text].

GUTHRIE, C. and G. R. FINK, 1991  Guide to Yeast Genetics and Molecular Biology. Meth. Enzymol. 194:1-933[Medline].

HILL, J. E., A. M. MYERS, T. J. KOERNER, and A. TZAGOLOFF, 1986  Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167[Medline].

IRIE, K., K. YAMAGUCHI, K. KAWASE, and K. MATSUMOTO, 1994  The yeast MOT2 gene encodes a putative zinc finger protein that serves as a global negative regulator affecting expression of several categories of genes, including mating-pheromone-responsive genes. Mol. Cell. Biol. 14:3150-3157[Abstract/Free Full Text].

JACKSON, C. L., J. B. KONOPKA, and L. H. HARTWELL, 1991  S. cerevisiae alpha pheromone receptors activate a novel signal transduction pathway for mating partner discrimination. Cell 67:389-402[Medline].

JENNESS, D. D. and P. SPATRICK, 1986  Down regulation of the alpha-factor pheromone recpetor in S. cerevisiae.. Cell 46:345-353[Medline].

KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992  Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].

KLUG, A. and D. RHODES, 1987  Zinc fingers: a novel protein fold for nucleic acid recognition. Cold Spring Harbor Symp. Quant. Biol. 52:473-482[Abstract/Free Full Text].

LEBERER, E., D. DIGNARD, D. HARCUS, M. WHITEWAY, and D. Y. THOMAS, 1994  Molecular characterization of SIG1, a Saccharomyces cerevisiae gene involved in negative regulation of G-protein-mediated signal transduction. EMBO J. 13:3050-3064[Medline].

MA, J. and M. PTASHNE, 1987  A new class of yeast transcriptional activators. Cell 51:113-119[Medline].

MACKAY, V. L., S. K. WELCH, M. Y. INSLEY, T. R. MANNEY, and J. HOLLY et al., 1988  The Sacchraomyces cerevisiae BAR1 gene encodes an exported protein with homology to pepsin. Proc. Natl. Acad. Sci. USA 85:55-59[Abstract/Free Full Text].

MADISON, J. M. and F. WINSTON, 1997  Evidence that Spt3 functionally interacts with Mot1, TFIIA, and TATA-binding protein to confer promoter-specific transcriptional control in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:287-295[Abstract].

MADISON, J. M., A. DUDLEY, C. HONGAY, and F. WINSTON, 1998  Identification and analysis of Mot3, a zinc finger protein that binds retrotransposon Ty LTR ({delta}) in Saccharomyces cerevisiae.. Mol. Cell. Biol. 18:1879-1890[Abstract/Free Full Text].

MCCAFFREY, G., F. J. CLAY, K. KELSAY, and G. J. SPRAGUE, 1987  Identification and regulation of a gene required for cell fusion during mating of the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 7:2680-2690[Abstract/Free Full Text].

MELUH, P. B. and M. D. ROSE, 1990  KAR3, a kinesin-related gene required for yeast nuclear fusion. Cell 60:1029-1041[Medline].

MERCADO, J. J. and J. M. GANCEDO, 1992  Regulatory regions in the yeast FBP1 and PCK1 genes. FEBS Lett. 311:110-114[Medline].

MYERS, A. M., A. TZAGOLOFF, D. M. KINNEY, and C. J. LUSTY, 1986  Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions. Gene 45:299-310[Medline].

NEIMAN, A. M., F. CHANG, K. KOMACHI, and I. HERSKOWITZ, 1990  CDC36 and CDC39 are negative elements in the signal transduction pathway of yeast. Cell Reg. 1:391-401[Medline].

NIEDENTHAL, R. K., L. RILES, M. JOHNSTON, and J. H. HEGEMANN, 1996  Green fluorescent protein as a marker for gene expression and subcellular localization in budding yeast. Yeast 12:773-786[Medline].

OEHLEN, L. J. W. M. and F. R. CROSS, 1994  G1 cyclins Cln1 and Cln2 repress the mating factor response pathway at Start in the yeast cell cycle. Genes Dev. 8:1058-1070[Abstract/Free Full Text].

OZCAN, S. and M. JOHNSTON, 1996a  Two different repressors collaborate to restrict expression of the yeast glucose transporter genes HXT2 and HXT4 to low levels of glucose. Mol. Cell. Biol. 16:5536-5545[Abstract].

OZCAN, S. and M. JOHNSTON, 1996b  Rgt1p of Saccharomyces cerevisiae, a key regulator of glucose-induced genes, is both an activator and a repressor of transcription. Mol. Cell. Biol. 16:6419-6424[Abstract].

RENEKE, J. E., K. J. BLUMER, W. E. COURCHESNE, and J. THORNER, 1988  The carboxy-terminal segment of the yeast alpha-factor receptor is a regulatory domain. Cell 55:221-234[Medline].

RHODES, N., L. CONNELL, and B. ERREDE, 1990  STE11 is a protein kinase required for cell-type-specific transcription and signal transduction in yeast. Genes Dev. 4:1862-1874[Abstract/Free Full Text].

ROSE, M. D., P. NOVICK, J. H. THOMAS, D. BOTSTEIN, and G. R. FINK, 1987  A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243[Medline].

ROTHSTEIN, R., 1991  Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Meth. Enzymol. 194:281-301[Medline].

SEGALL, J. E., 1993  Polarization of yeast cells in spatial gradients of alpha mating factor. Proc. Natl. Acad. Sci. USA 90:8332-8336[Abstract/Free Full Text].

SHERMAN, F., 1991  Getting started with yeast. Meth. Enzymol. 194:3-21[Medline].

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27[Abstract/Free Full Text].

SINGER, V. L., C. R. WOBBE, and K. STRUHL, 1990  A wide variety of DNA sequences can functionally replace a yeast TATA element for transcriptional activation. Genes Dev. 4:636-645[Abstract/Free Full Text].

TEAGUE, M. A., D. T. CHALEFF, and B. ERREDE, 1986  Nucleotide sequence of the yeast regulatory gene STE7 predicts a protein homologous to protein kinases. Proc. Natl. Acad. Sci. USA 83:7371-7375[Abstract/Free Full Text].

TJIAN, R. and T. MANIATIS, 1994  Transcriptional activation: a complex puzzle with few easy pieces. Cell 77:5-8[Medline].

VAN SOLINGEN, P. and J. B. VAN DER PLATT, 1977  Fusion of yeast spheroplasts. J. Bacteriol. 130:946-947[Abstract/Free Full Text].

WATSON, N., M. E. LINDER, K. M. DRUEY, J. H. KEHRL, and K. J. BLUMER, 1996  RGS family members: GTPase-activating proteins for heterotrimeric G-protein alpha-subunites. Nature 383:172-175[Medline].

WEINER, J. L., C. GUTTIEREZ-STEIL, and K. J. BLUMER, 1993  Disruption of receptor-G protein coupling in yeast promotes the function of an SST2-dependent adaptation pathway. J. Biol. Chem. 268:8070-8077[Abstract/Free Full Text].

WHITEWAY, M., L. HOUGAN, D. DIGNARD, D. Y. THOMAS, and L. BELL et al., 1989  The STE4 and STE18 genes of yeast encode potential beta and gamma subunits of the mating factor receptor-coupled G protein. Cell 56:467-477[Medline].

ZHAN, X. L., R. J. DESCHENES, and K. L. GUAN, 1997  Differential regulation of Fus3 MAP kinase by tyrosine-specific phosphatases Ptp2/Ptp3 and dual-specificity phosphatase Msg5 in Saccharomyces cerevisiae.. Genes Dev. 11:1690-1702[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
Eukaryot CellHome page
L.-C. Lai, A. L. Kosorukoff, P. V. Burke, and K. E. Kwast
Metabolic-State-Dependent Remodeling of the Transcriptome in Response to Anoxia and Subsequent Reoxygenation in Saccharomyces cerevisiae.
Eukaryot. Cell, September 1, 2006; 5(9): 1468 - 1489.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. S. J. Davies and J. Rine
A Role for Sterol Levels in Oxygen Sensing in Saccharomyces cerevisiae
Genetics, September 1, 2006; 174(1): 191 - 201.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
L. G. Klinkenberg, T. Webb, and R. S. Zitomer
Synergy among Differentially Regulated Repressors of the Ribonucleotide Diphosphate Reductase Genes of Saccharomyces cerevisiae.
Eukaryot. Cell, July 1, 2006; 5(7): 1007 - 1017.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Germann, C. Gallo, T. Donahue, R. Shirzadi, J. Stukey, S. Lang, C. Ruckenstuhl, S. Oliaro-Bosso, V. McDonough, F. Turnowsky, et al.
Characterizing Sterol Defect Suppressors Uncovers a Novel Transcriptional Signaling Pathway Regulating Zymosterol Biosynthesis
J. Biol. Chem., October 28, 2005; 280(43): 35904 - 35913.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
L. G. Klinkenberg, T. A. Mennella, K. Luetkenhaus, and R. S. Zitomer
Combinatorial Repression of the Hypoxic Genes of Saccharomyces cerevisiae by DNA Binding Proteins Rox1 and Mot3
Eukaryot. Cell, April 1, 2005; 4(4): 649 - 660.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
N. Bachman, Y. Eby, and J. D. Boeke
Local Definition of Ty1 Target Preference by Long Terminal Repeats and Clustered tRNA Genes
Genome Res., July 1, 2004; 14(7): 1232 - 1247.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Hon, A. Dodd, R. Dirmeier, N. Gorman, P. R. Sinclair, L. Zhang, and R. O. Poyton
A Mechanism of Oxygen Sensing in Yeast: MULTIPLE OXYGEN-RESPONSIVE STEPS IN THE HEME BIOSYNTHETIC PATHWAY AFFECT Hap1 ACTIVITY
J. Biol. Chem., December 12, 2003; 278(50): 50771 - 50780.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
O. Sertil, R. Kapoor, B. D. Cohen, N. Abramova, and C. V. Lowry
Synergistic repression of anaerobic genes by Mot3 and Rox1 in Saccharomyces cerevisiae
Nucleic Acids Res., October 15, 2003; 31(20): 5831 - 5837.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Blackwell, I. M. Halatek, H.-J. N. Kim, A. T. Ellicott, A. A. Obukhov, and D. E. Stone
Effect of the Pheromone-Responsive G{alpha} and Phosphatase Proteins of Saccharomyces cerevisiae on the Subcellular Localization of the Fus3 Mitogen-Activated Protein Kinase
Mol. Cell. Biol., February 15, 2003; 23(4): 1135 - 1150.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
N. Abramova, O. Sertil, S. Mehta, and C. V. Lowry
Reciprocal Regulation of Anaerobic and Aerobic Cell Wall Mannoprotein Gene Expression in Saccharomyces cerevisiae
J. Bacteriol., May 1, 2001; 183(9): 2881 - 2887.
[Abstract] [Full Text]


Home page
GeneticsHome page
N. E. Abramova, B. D. Cohen, O. Sertil, R. Kapoor, K. J. A. Davies, and C. V. Lowry
Regulatory Mechanisms Controlling Expression of the DAN/TIR Mannoprotein Genes During Anaerobic Remodeling of the Cell Wall in Saccharomyces cerevisiae
Genetics, March 1, 2001; 157(3): 1169 - 1177.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
B. D. Cohen, O. Sertil, N. E. Abramova, K. J. A. Davies, and C. V. Lowry
Induction and repression of DAN1 and the family of anaerobic mannoprotein genes in Saccharomyces cerevisiae occurs through a complex array of regulatory sites
Nucleic Acids Res., February 1, 2001; 29(3): 799 - 808.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. J. Kastaniotis, T. A. Mennella, C. Konrad, A. M. R. Torres, and R. S. Zitomer
Roles of Transcription Factor Mot3 and Chromatin in Repression of the Hypoxic Gene ANB1 in Yeast
Mol. Cell. Biol., October 1, 2000; 20(19): 7088 - 7098.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
M. Blondel, P. M. Alepuz, L. S. Huang, S. Shaham, G. Ammerer, and M. Peter
Nuclear export of Far1p in response to pheromones requires the export receptor Msn5p/Ste21p
Genes & Dev., September 1, 1999; 13(17): 2284 - 2300.
[Abstract] [Full Text]