- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Grishin, A. V.
- Articles by Blumer, K. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Grishin, A. V.
- Articles by Blumer, K. J.
Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces cerevisiae
Anatoly V. Grishina, Michael Rothenberg1,a, Maureen A. Downsa, and Kendall J. Blumeraa Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110
Corresponding author: Anatoly V. Grishin, Department of Cell Biology and Physiology, Washington University School of Medicine, 660 S. Euclid Ave., Box 8228, St. Louis, MO 63110-1093, agrishin{at}cellbio.wustl.edu (E-mail).
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
In the yeast Saccharomyces cerevisiae, mating pheromone response is initiated by activation of a G protein- and mitogen-activated protein (MAP) kinase-dependent signaling pathway and attenuated by several mechanisms that promote adaptation or desensitization. To identify genes whose products negatively regulate pheromone signaling, we screened for mutations that suppress the hyperadaptive phenotype of wild-type cells overexpressing signaling-defective G protein ß subunits. This identified recessive mutations in MOT3, which encodes a nuclear protein with two Cys2-His2 Zn fingers. MOT3 was found to be a dosage-dependent inhibitor of pheromone response and pheromone-induced gene expression and to require an intact signaling pathway to exert its effects. Several results suggested that Mot3 attenuates expression of pheromone-responsive genes by mechanisms distinct from those used by the negative transcriptional regulators Cdc36, Cdc39, and Mot2. First, a Mot3-lexA fusion functions as a transcriptional activator. Second, Mot3 is a dose-dependent activator of several genes unrelated to pheromone response, including CYC1, SUC2, and LEU2. Third, insertion of consensus Mot3 binding sites (C/A/T)AGG(T/C)A activates a promoter in a MOT3-dependent manner. These findings, and the fact that consensus binding sites are found in the 5' flanking regions of many yeast genes, suggest that Mot3 is a globally acting transcriptional regulator. We hypothesize that Mot3 regulates expression of factors that attenuate signaling by the pheromone response pathway.
THE pheromone response pathway of the yeast Saccharomyces cerevisiae is controlled by a complex interplay of positive and negative regulators of signal transduction (![]()
-factor and a-factor) induce the expression of genes required for mating, inhibit cell proliferation, and trigger a differentiation program necessary for conjugation of haploid yeast cells of opposite mating type. Pheromones exert their effects by activating a conserved signal transduction pathway consisting of cell surface receptors, a heterotrimeric guanine nucleotide-binding protein (G protein), and a mitogen-activated protein (MAP) kinase cascade, ultimately impinging on a cyclin-dependent kinase inhibitor (Far1) that induces growth arrest and a transcription factor (Ste12) that activates expression of pheromone-responsive genes.
Negative regulation of the pheromone response pathway allows cells to adapt or become desensitized to a signal of constant intensity. This is thought to be important for cells to respond chemotropically to pheromone gradients, allowing mating to occur preferentially between partners that produce high levels of pheromone or to resume proliferation if mating is unsuccessful (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We have shown previously that adaptation is promoted strongly in wild-type cells that overexpress signaling-defective G protein ß subunits (![]()
| MATERIALS AND METHODS |
|---|
Strains and media:
Yeast strains used in this study are listed in Table 1. Growth media (YPD, YPG, supplemented SD, and sporulation media) were prepared as described previously (![]()
-factor (Washington University Protein Chemistry Laboratory, St. Louis, MO) was added to media to a final concentration of 1 µM, unless indicated otherwise.
|
Plasmids:
The following plasmids were used as promoter-lacZ fusion reporters: pLGD312s (CYC1-lacZ; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Genetic methods:
Ethylmethane sulfonate (EMS) mutagenesis, crosses, and asci dissection were performed as described previously (![]()
![]()
complexes sequester G
subunits, liberating sufficient wild-type Gß
complexes to cause partial constitutive activation of the pathway. Spheroplasts were fused in the presence of polyethylene glycol according to published methods (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Purification of recombinant His-tagged Mot3
N protein, electrophoretic mobility shift assays (EMSA), and methylation interference assays:
Escherichia coli [BL21(DE3); Novagen] carrying pAG44 were grown to late-log phase, and His-tagged Mot3
N (residues 339-490, including both Zn fingers) was purified by affinity chromatography on Ni2+-NTA resin, as described previously (![]()
-32P]ATP to end-label PCR fragments with the following endpoints relative to translation starts: -295 to +40 (CYC1), -636 to +34 (SUC2), -462 to +42 (FUS1), -517 to +132 (CUP1), -410 to +13 (LEU2), -263 to -17 (FUS3), and -811 to +60 (SST2). Double-stranded oligonucleotide probes were prepared by annealing two completely or partially overlapping complementary oligonucleotides, one of which was labeled at the 5' end, and by filling in recessed 3' ends with Klenow polymerase and deoxynucleoside triphosphates (dNTPs), if necessary. For experiments designed to define a consensus Mot3 binding site, a set of labeled probes having the same specific activity was prepared in the following way. Oligonucleotides with the sequences GCAACCAGXXXXXXGACGACAACAACTGTGCTGCTGA, where XXXXXX are variants of the sequence CAGGCA (2 pmol each) were annealed to 0.1 pmol of the primer TCAGCAGCACAGTTGTTGTCGTC, which had been 5'-end-labeled (the same preparation of labeled primer was used to generate each probe); the primer was extended with Klenow polymerase and dNTPs. Binding reactions (20 µl) contained labeled probe (20,000 Cerenkov counts; 0.1 ng or less), purified His-tagged Mot3
N (0.2 µg, unless indicated otherwise) or His-tagged Go
(0.2 µg), bovine serum albumin (1 µg), competitor DNA as indicated, Tris pH 7.5 (10 mM), KCl (50 mM), MgCl2 (10 mM), ZnSO4 (10 µM), and glycerol (10%). Samples were incubated 15 min at 30° and separated by electrophoresis through 4% polyacrylamide gels (80:1 acrylamide:bis) in 0.5x Tris-acetate-EDTA (TAE) buffer. Gels were dried and exposed to X-ray film; alternatively, images were acquired on a Phosphorimager II and quantified using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Methylation interference experiments used as a probe a double-stranded oligonucleotide corresponding to the region of the CYC1 promoter between bases -195 and -119 (relative to the translational start). This 5'-labeled DNA was treated with dimethyl sulfate and subjected to EMSA, as described above. Samples were fractionated electrophoretically through a 1.5% agarose gel in 0.5x TAE buffer; shifted and unshifted bands were located by autoradiography and excised. These DNA samples were cleaved at guanosine residues by using Maxam-Gilbert chemistry and resolved on sequencing gels.
Pheromone response assays:
Quantitative mating tests, halo assays, morphological response assays, and measurement of pheromone-induced gene expression were performed as described previously (![]()
-factor were added to the wells, the plate was covered and incubated at 30° for 2 days. The absence of growth indicated the inability to adapt to a given pheromone concentration.
Other methods:
RNA isolation from yeast and Northern blotting were performed as described (![]()
Nucleotide sequence accession number:
The nucleotide sequence of the MOT3 gene was deposited in GenBank under the accession number U25279 (![]()
| RESULTS |
|---|
Isolation of suppressors of hyperadaptation:
Hyperadaptation to pheromone promoted by overexpression of signaling-defective Gß subunits is independent of several known adaptive mechanisms in yeast (![]()
-factor at a concentration that inhibits growth of normal but not hyperadaptive cells. Phenotypic analysis indicated that the majority of these mutants failed to overexpress signaling-defective Gß subunits, as expected (see MATERIALS AND METHODS). However, eight isolates (AG56-5, -46, -58, -80, -102, -119, -138 and -143) were putative hyperadaptation-defective mutants because they retained the ability to overexpress mutant Gß subunits. This was confirmed by performing pheromone-induced growth arrest (halo) assays under conditions where signaling-defective Gß subunits were overexpressed. The eight mutants responded relatively normally to pheromone (halo sizes were normal), but they failed to adapt rapidly (halos were clear instead of being turbid; Figure 1 shows the halo phenotype of mutant AG56-5, which was similar to that of the seven other mutants). The failure to form turbid halos was not due to decreased viability upon treatment with pheromone (data not shown).
|
To determine whether the mutations responsible for the hyperadaptation defects were dominant or recessive and to assign complementation groups, we fused spheroplasts of each mutant with spheroplasts of wild-type MATa cells, or with spheroplasts of the other mutants. The hyperadaptation phenotypes of the resultant fusion diploid cells were determined by performing halo assays under conditions where signaling-defective Gß subunits were overexpressed. All of the mutations appeared to be recessive, because MATa/MATa diploids produced by fusion of mutants with wild-type cells formed turbid halos (data not shown). Assays of diploids produced by pairwise fusions of the mutants defined two complementation groups: seven mutants belong to one complementation group and one mutant belongs to the other complementation group (data not shown). The following sections describe the identification and characterization of the gene corresponding to the larger complementation group; studies of the second complementation group will be reported elsewhere.
Cloning, sequencing, and expression of MOT3:
A YCp50-based yeast genomic DNA library was screened for plasmids that corrected the hyperadaptation defect of mutant AG56-5 (restored the ability of cells to form colonies on plates containing
-factor). Of the eight plasmids isolated, partial sequencing revealed that seven contained either the MAT
or HML
genes. These plasmids caused pheromone resistance because they result in expression of the a1/
2 repressor that turns off expression of mating-specific genes. The remaining plasmid contained a 4.5-kb fragment from the right arm of chromosome XIII. The minimum complementing region of this 4.5-kb fragment (a 2.4-kb EcoRI-SalI subfragment) contained a single ORF corresponding to YMR070W. This ORF encodes a polypeptide of 490 amino acids with two Cys2-His2 Zn finger motifs (consensus CX(2-4)CX(9)LX(2)HX(3-4)H (![]()
![]()
![]()
![]()
|
To determine whether mutations in the MOT3 gene are responsible for the hyperadaptation defects of the original mutants, we studied genetic linkage between one of the mutations and the MOT3 locus. MOT3 was disrupted with the URA3 gene (in W303-1B; the disruptants were viable), and the resultant strain was crossed with the mutant AG56-5. Twenty haploid MATa Ura- meiotic segregants derived from this cross were transformed with a plasmid (pAG3-26) that overexpresses signaling-defective Gß subunits. The results of halo assays showed that all 20 Ura- segregants were hyperadaptation-defective (clear halos; data not shown), indicating that the original mutation in AG56-5 and the mot3::URA3 disruption are tightly linked. We also found that mutants carrying the mot3::URA3 allele and the original AG56-5 mutant displayed equivalent defects in hyperadaptation, as indicated by halo assays (Figure 1E). Therefore, MOT3 appeared to be defective in the original mutants. Subsequently, the properties of mot3 mutations were studied using mot3 disruption strains.
MOT3 negatively regulates pheromone signaling:
To determine whether MOT3 influences pheromone responses in cells that do not overexpress signaling-defective Gß subunits, we examined the effects of mot3 mutations on several signaling-related phenotypes. First, in quantitative mating assays or halo assays, mot3 mutants were indistinguishable from isogenic wild-type controls (data not shown). However, because it can be difficult to detect modest differences in adaptation phenotypes by halo assay, a second type of adaptation assay was used (see MATERIALS AND METHODS). The results indicated that wild-type cells were able to grow (adapt) at a two-fold higher concentration of
-factor than could mot3 mutants (Figure 3). Similarly, mot3 mutants were threefold more sensitive to pheromone, as indicated by dose-response curves for pheromone-induced morphological changes (shmoo formation; data not shown).
|
MOT3 overexpression had the opposite effects. It markedly decreased sensitivity to pheromone and/or stimulated adaptation, as judged by the formation of smaller, turbid halos (Figure 1F) and by the ability of cells to grow in liquid media containing higher concentrations of
-factor (Figure 3). These lines of evidence suggest that MOT3 is a dosage-dependent regulator of pheromone signaling and/or adaptation.
MOT3 represses expression of pheromone-induced genes and activates expression of other yeast genes:
Consistent with the effects of MOT3 on pheromone-induced growth arrest and morphological changes, we found that MOT3 negatively regulates expression of pheromone-induced genes. In mot3 mutants, basal and pheromone-induced (at low pheromone concentration) expression of FUS1-lacZ and SST2-lacZ reporters was increased (Figure 4). Similar increases in basal gene expression were observed with several other pheromone-inducible promoters (AGA1, FUS3, and KAR3) driving expression of lacZ (Table 2), indicating that a mot3 mutation is likely to have similar effects on most, if not all, pheromone-induced promoters. Conversely, MOT3 overexpression inhibited expression of pheromone-induced genes about threefold, as indicated by shifts in dose-response curves (Figure 4B) and basal expression levels (Table 2).
|
|
To determine whether MOT3 specifically regulates pheromone-inducible genes, we examined the expression of genes unrelated to pheromone response or mating. As shown in Table 2 and Figure 5, the expression of several genes was affected by MOT3. Surprisingly, the effects of MOT3 on these promoters were opposite of what was observed with pheromone-responsive promoters. A mot3 mutation decreased expression from the CYC1, SUC2, and LEU2 promoters an average of threefold. Conversely, MOT3 overexpression increased expression from the CYC1, SUC2, LEU2, HXT2, HXT3, and HXT4 promoters, with HXT2 being induced most strongly (eightfold). However, the expression of other genes, including PKC1, HXT1, GAL1, and CUP1, was unaffected by MOT3. Therefore, MOT3 represses pheromone-inducible genes and activates a subset of genes unrelated to pheromone signaling or mating.
|
Because MOT3 regulates a significant proportion of the promoters we examined, it may affect expression of many yeast genes. Accordingly, we examined mot3 mutants for a variety of phenotypes, including growth rate in YPD, YPD + 1 M KCl, YP + glycerol, and synthetic media; growth at 37° or 14°; sensitivity to heat shock (45° for 30 min); survival rate after transfer from 1 M sorbitol to water; survival upon irradiation with short-wave ultraviolet light at 20 mJ/cm2; survival in stationary phase; and effects on cell morphology or sporulation efficiency. Wild-type cells and mot3 mutants were indistinguishable with regard to these phenotypes (data not shown). However, when isogenic wild-type and mot3 mutants were continuously cocultivated in YPD for 100 generations, the proportion of mutant cells dropped from 50 to 30%, indicating a slight selective disadvantage conferred by the disruption.
MOT3 requires an intact signaling pathway to affect expression of pheromone-induced genes:
Previous investigations have revealed that basal expression of pheromone-induced genes is controlled in part by mechanisms that require an intact signaling pathway, as well as mechanisms that do not (![]()
-subunits (ste4 and ste18 mutations, respectively), a PAK homolog (ste20 mutation), an MEKK homolog (ste11 mutation), MEK homolog (ste7 mutation), or the pheromone-regulated transcription factor (ste12 mutation)]. These strains were used to measure the basal expression of a pheromone-inducible reporter (FUS1-lacZ). Unlike what we observed with cells containing an intact signaling pathway, disruption of MOT3 failed to increase basal gene expression when the pathway was disrupted at the G protein level or points downstream (Table 3). Therefore, the effects of a mot3 mutation were similar to those of cdc36, cdc39, and mot2 mutations, which elevate basal expression of pheromone-responsive genes in a pathway-dependent manner (![]()
![]()
![]()
![]()
![]()
![]()
|
Mot3-GFP localizes to the nucleus:
We fused green fluorescent protein (GFP) to the C terminus of Mot3 (the chimeric protein was functional, as indicated by its ability to correct the hyperadaptation defect of a mot3 null mutant). Mot3-GFP fluorescence was restricted mostly to the nucleus, as indicated by costaining with DAPI (Figure 6), consistent with Mot3 functioning as a transcription factor.
|
Mot3 is a transcriptional activator:
The preceding results indicate that Mot3 is a nuclear protein that represses or activates gene expression, depending on the promoter being examined. To investigate whether transcriptional repressor and/or activator function is intrinsic to the Mot3 polypeptide, we determined whether Mot3 activates or represses gene expression when it is recruited to a heterologous promoter. This was done by fusing Mot3 to the C terminus of the lexA DNA binding domain (amino acids 187). To test for activator function, we used a GAL1-lacZ reporter in which lexA binding sites replace the normal GAL1 upstream activation sequence (UAS). As shown in Table 4, this reporter was induced ~fivefold in cells expressing the lexA-Mot3 fusion protein. To test for repressor activity, we used a GAL1-lacZ reporter plasmid in which lexA binding sites were placed immediately upstream of the GAL1 UAS. Expression from this reporter was unaffected by the presence of lexA-Mot3. In contrast, this reporter was repressed about twofold when Rgt1, a known repressor protein, was fused to lexA. Expression of either lexA or Mot3 alone had no effect on either reporter. These results suggest that Mot3 can function as a transcriptional activator. They do not rule out that Mot3 can also function as a transcriptional repressor.
|
DNA binding activity of Mot3:
To determine whether Mot3 is likely to function as a sequence-specific transcription factor, we examined the ability of purified His-tagged Mot3
N (residues 339490, containing both Zn fingers) to bind DNA in electrophoretic mobility shift assays (EMSA). Four promoter probes were used: CYC1, SUC2, and FUS1, which are affected by MOT3, and CUP1, which is not. Promoter DNA fragments from all four genes bound His-tagged Mot3
N, as indicated by the appearance of one or more slower migrating bands relative to unbound DNA probe bands. A control protein (His-tagged Go
purified in an identical manner) did not bind the probes. Binding was specific because unlabeled probe DNAs were effective competitors, whereas poly(dA)·poly(dT) and poly(dIdC)·poly(dIdC) were not (Figure 7). Poly(dG)·poly(dC) was an effective competitor for binding to the SUC2 probe (Figure 7 and Figure 8) or other labeled probes (data not shown), suggesting that Mot3 binding sites may be GC-rich.
|
|
Although all four promoters we tested bound His-tagged Mot3
N, several pieces of evidence suggested that their relative binding affinities differ. First, the CYC1 and SUC2 probes were shifted to multiple retarded positions, whereas FUS1 and CUP1 probes were only shifted to a single retarded position (Figure 7). Second, at a concentration of Mot3
N that was sufficient to bind nearly all of the CYC1 and SUC2 probes, only a fraction of the FUS1 or CUP1 probes was shifted (Figure 7). Third, competition experiments indicated that unlabeled CYC1 and SUC2 promoter fragments were efficient competitors for binding to a labeled SUC2 promoter fragment, whereas FUS1 and CUP1 fragments were inefficient competitors (Figure 8). Similarly, a fragment of the LEU2 promoter, which is positively regulated by MOT3, bound His-tagged Mot3
N relatively efficiently (multiple shifted bands) and was an effective competitor for binding to the SUC2 probe (data not shown). Therefore, efficient binding of Mot3
N to the CYC1, SUC2, and LEU2 promoters in vitro correlated with the ability of MOT3 to stimulate expression of these genes, suggesting that Mot3 may bind these promoters to activate them.
Identification of a consensus Mot3 binding site:
To identify promoter elements that may be bound by Mot3, we initially used the recognition code for Cys2-His2 Zn finger proteins to deduce a putative Mot3 binding site (![]()
Because the other two positions of the putative recognition site could not be deduced by the Zn finger recognition code, and because Zn finger-DNA interactions could differ from predictions (GRIESMAN and PABO 1997), we determined the recognition sequence of Mot3 empirically. First, we analyzed small fragments of one of the promoters (CYC1) that appeared to contain multiple Mot3 binding sites (yielded multiple shifted bands), with the goal of identifying several single binding sites whose sequences could be compared. We started with a 335-bp CYC1 fragment (-295 to +40; designated here and elsewhere relative to the translational start) that yielded the EMSA pattern shown in Figure 7. Synthetic DNA duplexes corresponding to smaller portions of this fragment were used in EMSA to identify putative Mot3 binding sites. This identified three 30-bp fragments (-195 to -166, -104 to -75, and -75 to -46), each containing at least one Mot3 binding site (data not shown). As predicted by the code, each of these DNA fragments contained the sequence AGG. However, none matched the predicted NAGGNG motif, because they contained A, T, or C at position 6. The fragment that displayed the strongest binding (-195 to -166; data not shown) contained the sequence CAGGCA.
To determine whether the sequence CAGGCA in the CYC1 promoter actually binds Mot3, we used the methylation interference assay. The probe was a synthetic duplex spanning positions -195 to -119. The results indicated that Mot3 binds the CAGGCA sequence, because methylation of the two central guanosine residues of this sequence interfered with Mot3 binding (Figure 9).
|
To define a Mot3 binding site further, we prepared a set of duplex DNAs in which variants of the CAGGCA sequence were placed in a DNA fragment that otherwise does not bind His-tagged Mot3
N, and used them as probes in EMSA experiments. The labeled probes we used had the same specific activities (see MATERIALS AND METHODS), allowing direct comparisons of relative binding efficiencies to be made. Binding efficiencies were expressed as the percentage of the total probe that was shifted to a reduced mobility.
The results of these experiments are shown in Figure 10, leading to the following conclusions. First, the AGG core sequence (positions 24) was important because Mot3
N bound poorly to derivatives in which any position in this sequence was altered (CBGGCA, CAHGCA, or CAGHCA, where B is G, C, or T in equal proportion, and H is A, C, or T in equal proportion). Second, an A at position 6 was strongly preferred over other bases. Third, C, A, or T at position 1 and T or C at position 5 permitted relatively high affinity binding, with CAGGTA showing the highest apparent affinity. The results therefore suggested that a consensus binding site for Mot3 is (C>A>T)AGG(T>C)A.
|
Consensus Mot3 binding sites confer MOT3-dependent activation of a heterologous promoter:
To establish a causal relationship between Mot3 binding and transcriptional regulation, we inserted five artificial Mot3 binding sites into the CUP1 promoter in a CUP1-lacZ reporter plasmid. This promoter was chosen because its transcription is independent of MOT3 (Table 2) and it lacks close matches to a consensus Mot3 binding site. We found that expression of this reporter was four- to fivefold higher in wild-type cells than in mot3 mutants (Table 2). Thus, Mot3 binding sites can function as upstream activation sequences to drive gene expression.
| DISCUSSION |
|---|
We have identified the MOT3 gene, which encodes a member of the Cys2-His2 Zn finger protein family, in a screen for mutations that abrogate the hyperadaptive phenotype of yeast cells overexpressing signaling-defective G protein ß subunits. We have shown that Mot3 is a nuclear DNA binding protein that can function as a transcriptional activator; we cannot rule out repressor function for Mot3. Whereas Mot3 directly or indirectly represses expression of pheromone-responsive genes, it activates expression of several yeast genes unrelated to pheromone response and mating. The implications of these findings in terms of the regulatory mechanisms that control gene expression and mating pheromone signaling in yeast are discussed below.
Mot3 is a globally acting transcription factor:
Based on several findings, Mot3 appears to be a globally acting transcription factor that affects the expression of several yeast genes. First, a Mot3 binding site matching the consensus sequence (C/T/A)AGG(T/C)A promotes Mot3-dependent transcriptional activation when present in multiple copies in a promoter that otherwise is insensitive to Mot3. Based on this consensus, Mot3 binding sites should occur on average every 724 bp in the yeast genome, such that many promoter regions are likely to contain at least one putative Mot3 binding site. Indeed, examination of the promoter sequences of 45 yeast genes, which control a variety of processes including mating, proliferation, transcription, cytoskeletal function, and stress response, reveals that several contain three or more consensus Mot3 binding sites (STE2, FAR1, CLN1, MOT2, MYO1, and SSA4). Interestingly, the 5'-flanking region upstream of the MOT3 ORF has three sites, suggesting that autoregulation of the gene could occur.
More strikingly, approximately half of the promoters we studied that contain putative Mot3 binding sites are affected by MOT3. Three patterns of MOT3-dependent regulation have been found. Class 1 promoters (e.g., HXT2, HXT3, and HXT4) show relatively weak positive regulation because they are unaffected by a mot3 null mutation, but they are stimulated upon MOT3 overexpression. Class 2 promoters (e.g., CYC1, SUC2, and LEU2) exhibit stronger positive regulation because their activities are decreased in mot3 mutants and increased in cells overexpressing MOT3. The stronger positive regulation of Class 2 promoters correlates with strong Mot3 binding and multiple shifted bands in EMSA. Class 2 promoters may be regulated more strongly because they apparently contain more consensus Mot3 binding sites (three to five sites) than Class 1 promoters (one or two sites). We currently favor this explanation because other than the number of consensus Mot3 binding sites, there are no clear differences between Class 1 and Class 2 promoters in terms of the location of Mot3 binding sites relative to TATA elements or binding sites of other known transcription factors. However, because we do not know whether Mot3 binds either type of promoter in vivo, we cannot rule out that more complex, indirect effects of Mot3 are responsible for the differences we observe between Class 1 and Class 2 promoters.
In contrast to Class 1 and Class 2 promoters, Class 3 promoters (e.g., FUS1, FUS3, AGA1, SST2, and KAR3, which are all induced by mating pheromone) show modest negative regulation by MOT3. Their basal activities are increased in mot3 mutants and decreased in cells overexpressing MOT3. Whether Mot3 directly represses these promoters is unclear. Although we found that a Mot3-lexA fusion lacks detectable repressor activity, the repressor activity of Mot3 could be promoter-specific. Indeed, in mot3 mutants the expression of genes with promoter insertions of Ty or
-elements is elevated (![]()
Finally, some promoters (e.g., CUP1, PCK1, HXT1, and GAL1) are unaffected by Mot3. All these promoters lack matches (CUP1, GAL1) or have only one match (PCK1, HXT1) to the Mot3 consensus binding site we have defined. The CUP1 promotor displays weak binding of Mot3 in EMSA, which may be explained by the presence of a number of weaker noncanonical sites. It is possible that low affinity binding of Mot3 to these promotors is insufficient to cause detectable changes in their expression.
Consistent with its proposed function as a globally acting transcription factor, Mot3 has been identified by others as a high copy suppressor in two different contexts. MOT3 overexpression suppresses the cell wall integrity defect of mpk1
mutants (D. LEVIN, personal communication), which are defective in a MAP kinase-dependent signaling pathway. MOT3 overexpression also suppresses the lethal phenotype of mot1 spt3 double mutants (![]()
![]()
![]()
Although Mot3 is likely to affect the expression of a number of yeast genes, it may have a modulatory rather than an essential role in governing the efficiency of transcription. We suggest this because mot3 null mutants exhibit only mild defects in growth rate, and because none of the Cys2-His2 Zn-finger proteins encoded by the yeast genome is an obvious structural homolog that might be functionally redundant with Mot3. Potentially, Mot3 is used to "fine tune" or coordinate expression of a number of yeast genes. Mot3 could also be the major transcriptional activator of genes that are important for physiological functions we have not yet investigated.
Role of MOT3 in pheromone signaling:
Disruption of MOT3 has a relatively modest effect (two- to threefold) on pheromone signaling. It increases pheromone sensitivity and the basal expression of pheromone-responsive promoters and causes a slight defect in adaptation. However, this does not necessarily indicate that Mot3 has a relatively minor role in regulating pheromone signaling. For example, Mot3 could functionally overlap with structurally distinct transcription factors, which together exert a relatively prominent effect on pheromone signaling. This would be analogous to the overlapping functions of structurally distinct classes of protein phosphatases (the dual-specificity phosphatase Msg5 and the tyrosine phosphatases Ptp2 and Ptp3), which together have an important role in attenuating pheromone signaling by dephosphorylating the MAP kinase homologs, Fus3 and Kss1 (![]()
![]()
In principle, Mot3 could be functionally redundant with other transcriptional regulators, such as Cdc36, Cdc39, or Mot2, that are known to negatively regulate the expression of pheromone-induced genes. Indeed, the effects of a mot3 mutation on pheromone-regulated promoters are similar to those caused by cdc36, cdc39, or mot2 mutations (![]()
![]()
![]()
![]()
![]()
How might Mot3 negatively regulate the expression of pheromone-inducible genes? Because currently there is no direct evidence that Mot3 can act as a repressor, we suggest that it negatively regulates signaling by inducing the expression of factors that inhibit pheromone response. The target genes activated by Mot3 to inhibit signaling are probably not GPA1, SST2, or MSG5, which encode known negative regulators of the pheromone response pathway. This is suggested by our finding that Mot3 inhibits rather than activates basal expression of these or other pheromone-inducible genes. Mot3 may therefore promote the expression of other negative regulatory factors that impinge on the pheromone response pathway. An example of such a negative factor could be the G1 cyclin Cln2, whose overexpression has been shown to inhibit the pheromone response pathway at some point downstream of the G protein (![]()
What is the role of Mot3 in mediating the hyperadaptive phenotype caused by overexpression of signaling-defective Gß subunits? One possibility is that mot3 mutations suppress the hyperadaptive phenotype nonspecifically simply by increasing pheromone sensitivity, allowing the signal to be sustained longer. This is an unlikely explanation because the hyperadaptive phenotype is not suppressed by other mutations, such as sst2 or receptor tail truncations, that increase pheromone sensitivity much more dramatically (10- to 100-fold) than mot3 mutations (![]()
| FOOTNOTES |
|---|
1 Present address: University of California School of Medicine, San Francisco, CA 94143. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank DAVID LEVIN and FRED WINSTON for communicating results prior to publication; DAVID LEVIN, MARK JOHNSTON, BEVERLY ERREDE, and MARK ROSE for gifts of plasmids, and MARK JOHNSTON for critical reading of the manuscript. This work was supported by grants from the National Institutes of Health and the American Cancer Society (K.J.B.). K.J.B. is an Established Investigator of the American Heart Association.
Manuscript received January 13, 1998; Accepted for publication March 4, 1998.
| LITERATURE CITED |
|---|
BARDWELL, L., J. G. COOK, C. J. INOUYE, and J. THORNER, 1994 Signal propagation and regulation in the mating pheromone response pathway of the yeast Saccharomyces cerevisiae.. Dev. Biol. 166:363-379[Medline].
CADE, R. M. and B. ERREDE, 1994 MOT2 encodes a negative regulator of gene expression that affects basal expression of pheromone-responsive genes in Saccharomyces cerevisiae.. Mol. Cell. Biol. 14:3139-3149
CHEN, Q. and J. B. KONOPKA, 1996 Regulation of the G-protein-couple alpha-factor pheromone receptor by phosphorylation. Mol. Cell. Biol. 16:247-257[Abstract].
CHOO, Y. and A. KLUG, 1997 Physical basis of a protein-DNA recognition code. Curr. Op. Struct. Biol. 7:117-125[Medline].
CIEJEK, E. and J. THORNER, 1979 Recovery of S. cerevisiae a cells from G1 arrest by alpha factor phermone requires endopeptidase action. Cell 18:623-635[Medline].
COLLART, M. A., 1996 The NOT, SPT3, and MOT1 genes functionally interact to regulate transcription at core promoters. Mol. Cell. Biol. 16:6668-6676[Abstract].
DAVIS, J. L., R. KUNISAWA, and J. THORNER, 1992 A presumptive helicase (MOT1 gene product) affects gene expression and is require for ivability in the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:1879-1892
DE BARROS LOPES, M., J. Y. HO, and S. I. REED, 1990 Mutations in cell division cycle genes CDC36 and CDC39 activate the Saccharomyces cerevisiae mating pheromone response pathway. Mol. Cell. Biol. 10:2966-2972
DOHLMAN, H. G., J. SONG, D. MA, W. E. COURCHESNE, and J. THORNER, 1996 Sst2, a negative regulator of pheromone signaling in the yeast Saccharomyces cerevisiae: expression, localization, genetic interaction and physical association with Gpa1 (G protein alpha subunit). Mol. Cell. Biol. 16:5194-5209[Abstract].
DOI, K., A. GARTNER, G. AMMERER, B. ERREDE, and H. SHINKAWA et al., 1994 MSG5, a novel protein phosphatase promotes adaption to pheromone response in S. cerevisiae.. EMBO J. 13:61-70[Medline].
EVANS, R. M. and S. M. HOLLENBERG, 1988 Zinc fingers: gilt by association. Cell 52:1-3[Medline].
FIELDS, S. and I. HERSKOWITZ, 1987 Regulation by the yeast mating-type locus of STE12, a gene required for cell-type-specific expression. Mol. Cell. Biol. 7:3818-3821
FLICK, J. S. and M. JOHNSTON, 1990 Two systems of glucose repression of the GAL1 promoter in Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:4757-4569
GREISMAN, H. A. and C. O. PABO, 1997 A general strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites. Science 275:657-661
GRISHIN, A. V., J. L. WEINER, and K. J. BLUMER, 1994 Control of adaptation to mating pheromone by G protein beta subunites of Sacchraomyces cerevisiae.. Genetics 138:1081-1092[Abstract].
GUARENTE, L. and E. HOAR, 1984 Upstream activation sites of the CYC1 gene of Saccharomyces cerevisiae are active when inverted but not when placed downstream of the "TATA box. " Proc. Natl. Acad. Sci. USA 81:7860-7864
GUTHRIE, C. and G. R. FINK, 1991 Guide to Yeast Genetics and Molecular Biology. Meth. Enzymol. 194:1-933[Medline].
HILL, J. E., A. M. MYERS, T. J. KOERNER, and A. TZAGOLOFF, 1986 Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167[Medline].
IRIE, K., K. YAMAGUCHI, K. KAWASE, and K. MATSUMOTO, 1994 The yeast MOT2 gene encodes a putative zinc finger protein that serves as a global negative regulator affecting expression of several categories of genes, including mating-pheromone-responsive genes. Mol. Cell. Biol. 14:3150-3157
JACKSON, C. L., J. B. KONOPKA, and L. H. HARTWELL, 1991 S. cerevisiae alpha pheromone receptors activate a novel signal transduction pathway for mating partner discrimination. Cell 67:389-402[Medline].
JENNESS, D. D. and P. SPATRICK, 1986 Down regulation of the alpha-factor pheromone recpetor in S. cerevisiae.. Cell 46:345-353[Medline].
KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992 Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].
KLUG, A. and D. RHODES, 1987 Zinc fingers: a novel protein fold for nucleic acid recognition. Cold Spring Harbor Symp. Quant. Biol. 52:473-482
LEBERER, E., D. DIGNARD, D. HARCUS, M. WHITEWAY, and D. Y. THOMAS, 1994 Molecular characterization of SIG1, a Saccharomyces cerevisiae gene involved in negative regulation of G-protein-mediated signal transduction. EMBO J. 13:3050-3064[Medline].
MA, J. and M. PTASHNE, 1987 A new class of yeast transcriptional activators. Cell 51:113-119[Medline].
MACKAY, V. L., S. K. WELCH, M. Y. INSLEY, T. R. MANNEY, and J. HOLLY et al., 1988 The Sacchraomyces cerevisiae BAR1 gene encodes an exported protein with homology to pepsin. Proc. Natl. Acad. Sci. USA 85:55-59
MADISON, J. M. and F. WINSTON, 1997 Evidence that Spt3 functionally interacts with Mot1, TFIIA, and TATA-binding protein to confer promoter-specific transcriptional control in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:287-295[Abstract].
MADISON, J. M., A. DUDLEY, C. HONGAY, and F. WINSTON, 1998 Identification and analysis of Mot3, a zinc finger protein that binds retrotransposon Ty LTR (
) in Saccharomyces cerevisiae.. Mol. Cell. Biol. 18:1879-1890
MCCAFFREY, G., F. J. CLAY, K. KELSAY, and G. J. SPRAGUE, 1987 Identification and regulation of a gene required for cell fusion during mating of the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 7:2680-2690
MELUH, P. B. and M. D. ROSE, 1990 KAR3, a kinesin-related gene required for yeast nuclear fusion. Cell 60:1029-1041[Medline].
MERCADO, J. J. and J. M. GANCEDO, 1992 Regulatory regions in the yeast FBP1 and PCK1 genes. FEBS Lett. 311:110-114[Medline].
MYERS, A. M., A. TZAGOLOFF, D. M. KINNEY, and C. J. LUSTY, 1986 Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions. Gene 45:299-310[Medline].
NEIMAN, A. M., F. CHANG, K. KOMACHI, and I. HERSKOWITZ, 1990 CDC36 and CDC39 are negative elements in the signal transduction pathway of yeast. Cell Reg. 1:391-401[Medline].
NIEDENTHAL, R. K., L. RILES, M. JOHNSTON, and J. H. HEGEMANN, 1996 Green fluorescent protein as a marker for gene expression and subcellular localization in budding yeast. Yeast 12:773-786[Medline].
OEHLEN, L. J. W. M. and F. R. CROSS, 1994 G1 cyclins Cln1 and Cln2 repress the mating factor response pathway at Start in the yeast cell cycle. Genes Dev. 8:1058-1070
OZCAN, S. and M. JOHNSTON, 1996a Two different repressors collaborate to restrict expression of the yeast glucose transporter genes HXT2 and HXT4 to low levels of glucose. Mol. Cell. Biol. 16:5536-5545[Abstract].
OZCAN, S. and M. JOHNSTON, 1996b Rgt1p of Saccharomyces cerevisiae, a key regulator of glucose-induced genes, is both an activator and a repressor of transcription. Mol. Cell. Biol. 16:6419-6424[Abstract].
RENEKE, J. E., K. J. BLUMER, W. E. COURCHESNE, and J. THORNER, 1988 The carboxy-terminal segment of the yeast alpha-factor receptor is a regulatory domain. Cell 55:221-234[Medline].
RHODES, N., L. CONNELL, and B. ERREDE, 1990 STE11 is a protein kinase required for cell-type-specific transcription and signal transduction in yeast. Genes Dev. 4:1862-1874
ROSE, M. D., P. NOVICK, J. H. THOMAS, D. BOTSTEIN, and G. R. FINK, 1987 A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243[Medline].
ROTHSTEIN, R., 1991 Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Meth. Enzymol. 194:281-301[Medline].
SEGALL, J. E., 1993 Polarization of yeast cells in spatial gradients of alpha mating factor. Proc. Natl. Acad. Sci. USA 90:8332-8336
SHERMAN, F., 1991 Getting started with yeast. Meth. Enzymol. 194:3-21[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27
SINGER, V. L., C. R. WOBBE, and K. STRUHL, 1990 A wide variety of DNA sequences can functionally replace a yeast TATA element for transcriptional activation. Genes Dev. 4:636-645
TEAGUE, M. A., D. T. CHALEFF, and B. ERREDE, 1986 Nucleotide sequence of the yeast regulatory gene STE7 predicts a protein homologous to protein kinases. Proc. Natl. Acad. Sci. USA 83:7371-7375
TJIAN, R. and T. MANIATIS, 1994 Transcriptional activation: a complex puzzle with few easy pieces. Cell 77:5-8[Medline].
VAN SOLINGEN, P. and J. B. VAN DER PLATT, 1977 Fusion of yeast spheroplasts. J. Bacteriol. 130:946-947
WATSON, N., M. E. LINDER, K. M. DRUEY, J. H. KEHRL, and K. J. BLUMER, 1996 RGS family members: GTPase-activating proteins for heterotrimeric G-protein alpha-subunites. Nature 383:172-175[Medline].
WEINER, J. L., C. GUTTIEREZ-STEIL, and K. J. BLUMER, 1993 Disruption of receptor-G protein coupling in yeast promotes the function of an SST2-dependent adaptation pathway. J. Biol. Chem. 268:8070-8077
WHITEWAY, M., L. HOUGAN, D. DIGNARD, D. Y. THOMAS, and L. BELL et al., 1989 The STE4 and STE18 genes of yeast encode potential beta and gamma subunits of the mating factor receptor-coupled G protein. Cell 56:467-477[Medline].
ZHAN, X. L., R. J. DESCHENES, and K. L. GUAN, 1997 Differential regulation of Fus3 MAP kinase by tyrosine-specific phosphatases Ptp2/Ptp3 and dual-specificity phosphatase Msg5 in Saccharomyces cerevisiae.. Genes Dev. 11:1690-1702
This article has been cited by other articles:
![]() |
L.-C. Lai, A. L. Kosorukoff, P. V. Burke, and K. E. Kwast Metabolic-State-Dependent Remodeling of the Transcriptome in Response to Anoxia and Subsequent Reoxygenation in Saccharomyces cerevisiae. Eukaryot. Cell, September 1, 2006; 5(9): 1468 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. J. Davies and J. Rine A Role for Sterol Levels in Oxygen Sensing in Saccharomyces cerevisiae Genetics, September 1, 2006; 174(1): 191 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Klinkenberg, T. Webb, and R. S. Zitomer Synergy among Differentially Regulated Repressors of the Ribonucleotide Diphosphate Reductase Genes of Saccharomyces cerevisiae. Eukaryot. Cell, July 1, 2006; 5(7): 1007 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Germann, C. Gallo, T. Donahue, R. Shirzadi, J. Stukey, S. Lang, C. Ruckenstuhl, S. Oliaro-Bosso, V. McDonough, F. Turnowsky, et al. Characterizing Sterol Defect Suppressors Uncovers a Novel Transcriptional Signaling Pathway Regulating Zymosterol Biosynthesis J. Biol. Chem., October 28, 2005; 280(43): 35904 - 35913. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Klinkenberg, T. A. Mennella, K. Luetkenhaus, and R. S. Zitomer Combinatorial Repression of the Hypoxic Genes of Saccharomyces cerevisiae by DNA Binding Proteins Rox1 and Mot3 Eukaryot. Cell, April 1, 2005; 4(4): 649 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bachman, Y. Eby, and J. D. Boeke Local Definition of Ty1 Target Preference by Long Terminal Repeats and Clustered tRNA Genes Genome Res., July 1, 2004; 14(7): 1232 - 1247. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hon, A. Dodd, R. Dirmeier, N. Gorman, P. R. Sinclair, L. Zhang, and R. O. Poyton A Mechanism of Oxygen Sensing in Yeast: MULTIPLE OXYGEN-RESPONSIVE STEPS IN THE HEME BIOSYNTHETIC PATHWAY AFFECT Hap1 ACTIVITY J. Biol. Chem., December 12, 2003; 278(50): 50771 - 50780. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Sertil, R. Kapoor, B. D. Cohen, N. Abramova, and C. V. Lowry Synergistic repression of anaerobic genes by Mot3 and Rox1 in Saccharomyces cerevisiae Nucleic Acids Res., October 15, 2003; 31(20): 5831 - 5837. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Blackwell, I. M. Halatek, H.-J. N. Kim, A. T. Ellicott, A. A. Obukhov, and D. E. Stone Effect of the Pheromone-Responsive G{alpha} and Phosphatase Proteins of Saccharomyces cerevisiae on the Subcellular Localization of the Fus3 Mitogen-Activated Protein Kinase Mol. Cell. Biol., February 15, 2003; 23(4): 1135 - 1150. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Abramova, O. Sertil, S. Mehta, and C. V. Lowry Reciprocal Regulation of Anaerobic and Aerobic Cell Wall Mannoprotein Gene Expression in Saccharomyces cerevisiae J. Bacteriol., May 1, 2001; 183(9): 2881 - 2887. [Abstract] [Full Text] |
||||
![]() |
N. E. Abramova, B. D. Cohen, O. Sertil, R. Kapoor, K. J. A. Davies, and C. V. Lowry Regulatory Mechanisms Controlling Expression of the DAN/TIR Mannoprotein Genes During Anaerobic Remodeling of the Cell Wall in Saccharomyces cerevisiae Genetics, March 1, 2001; 157(3): 1169 - 1177. [Abstract] [Full Text] |
||||
![]() |
B. D. Cohen, O. Sertil, N. E. Abramova, K. J. A. Davies, and C. V. Lowry Induction and repression of DAN1 and the family of anaerobic mannoprotein genes in Saccharomyces cerevisiae occurs through a complex array of regulatory sites Nucleic Acids Res., February 1, 2001; 29(3): 799 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Kastaniotis, T. A. Mennella, C. Konrad, A. M. R. Torres, and R. S. Zitomer Roles of Transcription Factor Mot3 and Chromatin in Repression of the Hypoxic Gene ANB1 in Yeast Mol. Cell. Biol., October 1, 2000; 20(19): 7088 - 7098. [Abstract] [Full Text] |
||||
![]() |
M. Blondel, P. M. Alepuz, L. S. Huang, S. Shaham, G. Ammerer, and M. Peter Nuclear export of Far1p in response to pheromones requires the export receptor Msn5p/Ste21p Genes & Dev., September 1, 1999; 13(17): 2284 - 2300. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Grishin, A. V.
- Articles by Blumer, K. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Grishin, A. V.
- Articles by Blumer, K. J.
















