Activation of Latent Transgenes in Arabidopsis Using a Hybrid Transcription Factor

Corresponding author: Eric Ward, Novartis Agricultural Biotechnology Research, 3054 Cornwallis Road, P.O. Box 12257, Research Triangle Park, NC 27709, eric.ward{at}cp.novartis.com (E-mail).

Communicating editor: D. PREUSS

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

A hybrid transcription factor comprising a fusion of the DNA-binding domain of Saccharomyces cerevisiae GAL4 and the transcription activation domain of maize C1 was expressed in stably transformed Arabidopsis. Additional transgenic lines were created containing test genes controlled by a synthetic promoter consisting of concatemeric copies of the cis-acting site recognized by GAL4 (UAS_G) fused to a minimal promoter. The GAL4/C1 effector line was crossed to two lines containing a synthetic promoter/GUS fusion. Both histochemical staining and GUS activity assays indicate strong activation of GUS expression was achieved only after crossing. The GAL4/C1 effector line was also crossed to 15 lines containing a synthetic promoter/antisense adenylosuccinate synthetase gene. Severely retarded growth, and in some cases lethality, was observed in 40% of the F₁ lines. This system of activation by crossing is generally useful for activating expression of test transgenes.

THE tools of plant biotechnology allow introduction of foreign genes into many species and regulation of their expression in developmental time and space. However, tight, inducible control of the expression of introduced genes has been difficult to achieve in whole plants (for review, see WARD et al. 1993 ; GATZ 1996 ). Such control could have several uses, including practical ones such as regulating genes for controlling fertility, and more basic ones such as probing function by antisense knock-out of a novel gene. One method to effect this type of transgene regulation is through the use of heterologous transcription factors and promoters that respond to them.

Many positive transcriptional regulatory factors are modular, consisting of a DNA-binding domain and an activation domain that interacts with components of the transcriptional machinery assembling at the promoter (PTASHNE 1988 ; SWAFFIELD et al. 1995 ). Fusing combinations of these elements, derived from different kingdoms, has resulted in production of diverse hybrid factors having defined DNA-binding specificity and transcriptional activation function for the target organism in question. For instance, in transient expression experiments in tobacco protoplasts, transcription factors derived from the yeast GAL4 transcriptional activator have been shown to activate transcription from a reporter gene controlled by a synthetic promoter consisting of multiple copies of the upstream activating sequence recognized by GAL4 (UAS_G), and a TATA element derived from a promoter recognized in plant cells (MA et al. 1988 ). The function of hybrid transcriptional activators and activator mutants has also been studied through high-velocity microprojectile delivery of genes into the aleurone layer of maize seed. A GAL4 DNA-binding domain fused to the acidic activation domain of herpes simplex virus VP16 protein or the structurally related maize regulatory protein C1 was shown to stimulate the expression of a GAL4-dependent reporter gene when both transactivator and reporter genes were introduced on microprojectiles (GOFF et al. 1991 ). A chimeric transcriptional activator composed of the DNA-binding domain of bacteriophage 434 fused to the VP16 activation domain was shown to activate gene expression of a reporter gene driven by a synthetic promoter consisting of phage 434 operators fused to a minimal 35S promoter when transiently introduced into tobacco protoplasts (WILDE et al. 1994 ). Together these studies establish that DNA-binding domains from heterologous factors can bind to synthetic promoters containing appropriate binding sites on naked DNA templates introduced into plant cells, and nonplant activation domains can productively interact with the transcription machinery of the plant when covalently linked to a DNA-binding domain.

Although analysis of transgenes introduced transiently into host cells can be useful to make preliminary determinations of gene function, stable transformation is a more broadly applicable system for studying plant gene expression. A heterologous hybrid transcription factor has previously been shown to function in transgenic tobacco and Arabidopsis (AOYAMA and CHUA 1997 ). Following glucocorticoid treatment, a GAL4/VP16 hybrid transcription factor fused to the hormone-binding domain of the glucocorticoid receptor is capable of activating transcription of a luciferase reporter gene controlled by a synthetic promoter. We pursued an alternative approach, in which a stably integrated hybrid transcription factor and activatable transgene are brought together by fertilization. This strategy would transform a latent transgene into a constitutive one, without the requirement of chemical induction. We show here that crossing a transgenic plant line expressing a GAL4/C1 hybrid factor to a line containing a reporter transgene controlled by an appropriate synthetic promoter can result in strong induction of reporter gene expression. Moreover, we show that such a system can be used to address gene function, by specifically inactivating expression of a test gene.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Recombinant plasmids:
pSGZL1 was constructed by ligating the GAL4-C1 EcoRI fragment from pGALC1 (GOFF et al. 1991 ) into the EcoRI site of pIC20H (MARSH et al. 1984 ). The GAL4-C1 fragment of pSGZL1 was excised with BamHI-BglII and inserted into the BamHI site of pCIB770 (ROTHSTEIN et al. 1987 ) yielding pAT53.

The 10 UAS_G sites and the minimal CaMV 35S promoter (-59 to +1) were excised from pGALLuc2 (GOFF et al. 1991 ) as an EcoRI-PstI fragment and inserted into the respective sites of pBluescript, yielding pAT52. pAT66 was constructed with a three-way ligation between the HindIII-PstI fragment of pAT52, a PstI-EcoRI fragment of pCIB1716 (containing a CaMV 35S untranslated leader, GUS gene, CaMV 35S terminator) and HindIII-EcoRI cut pUC18. The CaMV 35S leader of pAT66 was excised with PstI-NcoI and replaced with a PCR-generated 35S leader extending from +1 to +48 to yield pAT71.

pCIB921 contains a dihydrofolate reductase (dhfr) plant selectable marker gene inserted in the BamHI site of pCIB710 (ROTHSTEIN et al. 1987 ). The CaMV 35S promoter/dhfr gene cassette of pCIB921 was excised with XbaI-EcoRI and inserted into the respective sites of pCIB730 (ROTHSTEIN et al. 1987 ) to make pAT58. pAT73 was constructed by inserting the EcoRI fragment from pAT71 containing 10 UAS_G/minimal CaMV 35S promoter/GUS/35S terminator into EcoRI site of pAT58.

Plasmid pBS SK+ (Stratagene, La Jolla, CA) was linearized with SacI, treated with mung bean nuclease to remove the SacI site, and religated with T4 ligase to make pJG201. The UAS_G/CaMV 35S minimal promoter/GUS gene/CaMV terminator cassette was removed from pAT71 with KpnI and cloned into the KpnI site of pJG201 to make pJG304. pJG304 was partially digested with restriction endonuclease Asp718 to isolate a full-length linear fragment. This fragment was ligated with a molar excess of the oligonucleotide 5' GTA CCT CGA GTC TAG ACT CGA G 3'. Restriction analysis was used to identify a clone with this linker, inserted 5' to the site, and this plasmid was designated pJG304XhoI.

A fragment of the AdSS cDNA clone described previously (FONNE-PFISTER et al. 1996 ; GenBank accession no. U49389) was PCR amplified with the oligonucleotide primers 5' GATTCGAGCTCATGTCTCTCTCTTCCCTC 3' and 5' GATTCCCATGGTGGACCTGAACCAACTC 3'. The vector pJG304XhoI was digested with SacI and NcoI to excise the GUS gene coding sequence. The AdSS PCR fragment was digested with SacI and NcoI and ligated into pJG304XhoI to make pJG304AntiAdSS.

Vector pGPTV (BECKER et al. 1992 ) was digested with EcoRI and HindIII to remove the nopaline synthase promoter/GUS cassette. Concurrently, the superlinker was excised from pSE380 (Invitrogen, San Diego) with EcoRI and HindIII and cloned into the EcoRI/HindIII linearized pGPTV, to make pJG261.

pJG304AntiAdSS was cut with XhoI to excise the cassette containing the UAS_G/35S minimal promoter/antisense AdSS/CaMV terminator fusion. This cassette was ligated into XhoI-digested pJG261, such that transcription was divergent from that of the bar selectable marker, producing pJG261AntiAdSS.

Transgenic plants:
pJG261AntiAdSS was electro-transformed into Agrobacterium tumefaciens strain GV3101 (pMP90; KONCZ and SCHELL 1986 ), and Arabidopsis plants (ecotype Columbia) were transformed by infiltration (BECHTOLD et al. 1993 ) using the resulting strain. Seeds from the infiltrated plants were selected on agar germination medium (Murashige-Skoog salts at 4.3 g/liter, MES at 0.5 g/liter, 1% sucrose, thiamine at 10 µg/liter, pyridoxine at 5 µg/liter, nicotinic acid at 5 µg/liter, myoinositol at 1 mg/liter, pH 5.8) containing glufosinate (Basta; AgrEvo, Berlin) at 15 mg/liter.

Arabidopsis root explants (ecotype Nossen) were transformed with pAT53 and pAT73 as described (VALVEKENS et al. 1988 ).

Fifteen transgenic plants containing the UAS_G/minimal CaMV 35S promoter/antisense AdSS construct were transplanted to soil and grown to maturity in the greenhouse. Flowers borne on the primary transformants were crossed with pollen from the homozygous GAL4/C1 transactivator line pAT53-103. F₁ seeds were plated on germination medium containing 50 mg/liter kanamycin.

ß-glucuronidase (GUS) assays:
Histochemical and fluorometric GUS assays were performed on Arabidopsis leaves as previously described (JEFFERSON 1987 ). Following a visible histochemical reaction, chlorophyll was cleared from the leaves with 70% ethanol.

Nucleic acid analysis:
RNA was isolated by phenol/chloroform extraction followed by LiCl precipitation as described (LAGRIMINI et al. 1987 ). RNA gel blots were performed as described (WARD et al. 1991 ). Hybridization probes were labeled with ³²P-dCTP by the random priming method using a PrimeTime kit (International Biotechnologies, Inc., New Haven, CT). Hybridization conditions were 7% sodium dodecyl sulfate (SDS); 0.5 M NaPO₄, pH 7.0; 1 mM EDTA; and 1% bovine albumin at 65°. After hybridization overnight, the filters were washed with 1% SDS, 50 mM NaPO₄, 1 mM EDTA at 65° (CHURCH and GILBERT 1984 ).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

An ideal regulatory system for controlling transgene expression in plants would have no background expression in the absence of the activator gene and high expression in the presence of the activator gene. To determine if a GAL4/C1 hybrid activator and a GAL4-dependent promoter can meet these requirements in stable transformants, we constructed appropriate genes for testing the system in Arabidopsis. A hybrid transcription factor gene was constructed from components of the GAL4 and C1 genes previously shown to contain the DNA-binding and transcriptional activation functions, respectively (Figure 1A). The N-terminal 147 amino acids of the encoded protein derived from GAL4, and the C-terminal 101 amino acids are derived from the carboxy-terminal amino acids 173-273 of C1. A similar combination had previously been shown to function in transient assays (GOFF et al. 1991 ). A synthetic promoter designed to be activatable by this factor was constructed from a truncated CaMV 35S promoter, containing the TATA element (nucleotides -59 to +48 relative to the start of transcription), fused at its 5' end to 10 concatemeric copies of UAS_G (Figure 1B). To evaluate the efficacy of the system in stable transformants, a reporter gene was constructed consisting of a modified Escherichia coli uidA (ß-glucuronidase; GUS) coding sequence driven by the synthetic UAS_G/TATA promoter.

View larger version (14K): In this window In a new window Download PPT slide   Figure 1. —T-DNA regions of constructs used for plant transformation. LB, left T-DNA border; RB, right T-DNA border; pNos, nopaline synthase promoter; DHFR, dihydrofolate reductase gene conferring methotrexate resistance; NPT, neomycin phosphotransferase II gene; BAR, phosphinothricin acetyltransferase gene.

Transgenic Arabidopsis plant lines containing the hybrid transcription factor gene (effector lines) were created using Agrobacterium-mediated transformation. Primary transformants (T₁ generation) were screened for ability to activate expression from the synthetic UAS_G/TATA promoter by transiently transforming them with a luciferase reporter construct. Approximately half of the T₁ transformants tested showed luciferase activity after microprojectile bombardment. RNA gel blot analysis confirmed that these transformants expressed the GAL4/C1 gene (Figure 2A). These lines were further tested in the T₂ generation for segregation of kanamycin resistance (the selectable marker gene carried on the T-DNA) as a single locus after selfing. Presence of a single T-DNA insert was confirmed by genomic DNA gel blot analysis in lines that showed 3:1 segregation (data not shown). These lines were further analyzed for expression of the GAL4/C1 gene by RNA gel blot analysis (Figure 2B). A single effector line, designated pAT53-103, was chosen for further experiments, and several T₂ plants were selfed to obtain T₃ progeny which were screened for homozygosity of the T-DNA insert.

View larger version (112K): In this window In a new window Download PPT slide   Figure 2. —Expression of hybrid GAL4/C1 gene. RNA gel blot analysis of (A) primary (T1) transformants (lanes are labeled with line numbers), and (B) subsequent generations of single copy lines.

In addition, transgenic lines containing the UAS_G/TATA/GUS gene were selected on methotrexate and screened for homozygosity. Two lines, designated pAT-73-309 and pAT73-346, were analyzed for GUS activity (Figure 3), and found to have very low amounts, not significantly different from assay background (Table 1). F₁ plants containing both the hybrid transactivator gene and the activatable reporter gene were generated by cross-pollination and selected on kanamycin. In contrast to plants containing the reporter gene alone, the F₁ plants produced high levels of GUS activity (Figure 3; Table 1).

View larger version (124K): In this window In a new window Download PPT slide   Figure 3. —Histochemical analysis of GUS expression. Leaves of untransformed No-0 (well 1), pAT73-309 (reporter line 309 alone, well 2), pAT73-346 (reporter line 346 alone, well 3), a 35S/GUS transformant (well 4), pAT73-309 x pAT53-103 F1 (well 5), and pAT73-346 x pAT53-103 F1 (well 6).

We wished to investigate whether this system of activation by crossing could be used to eliminate gene function. As a test gene, we used adenylosuccinate synthetase (AdSS), one of two steps in de novo purine biosynthesis that converts IMP to AMP. AdSS has recently been implicated as the target of the potently herbicidal natural product hydantocidin (CSEKE et al. 1996 ; FONNE-PFISTER et al. 1996 ; SIEHL et al. 1996 ). We have determined by Southern blot analysis that the full-length cDNA used here represents a single gene in the Arabidopsis genome (S. POTTER, unpublished results). Thus, gene inactivation should result in lethality, by analogy with the herbicidal effect of hydantocidin.

Fifteen transgenic plants containing a UAS_G/TATA/antisense AdSS construct (Figure 1C) were generated by Agrobacterium transformation. Flowers borne on the primary transformants were crossed with pollen from the homozygous effector line pAT53-103. F₁ seeds were plated on kanamycin to select for the outcrossed progeny. These primary transformants are hemizygous for the introduced T-DNA (containing the antisense gene), which in most cases will segregate as a single Mendelian trait (Figure 4). Thus, in the F₁ the antisense gene should segregate 1:1 against a background that always contains the transactivator in the hemizygous state (except in rare contaminants from selfing, which are selected against by germination on kanamycin). In six lines, approximately 50% of the F₁ seedlings produced by crossing with the effector line were severely retarded in growth (Figure 5), in some cases failing to germinate completely. Five other lines gave rise to F₁ progeny that survived through true leaf expansion, but showed various growth anomalies after transfer to soil. A final four lines showed little or no abnormal phenotype in the F₁.

View larger version (12K): In this window In a new window Download PPT slide   Figure 4. —Scheme for activation of antisense gene by crossing, comprising a homozygous effector pollinator and hemizygous antisense recipient.

View larger version (62K): In this window In a new window Download PPT slide   Figure 5. —F1 seedlings from a cross of antisense AdSS line 6 x pAT53-103. Seedlings are shown at (a) 10 and (b) 14 days after plating on agar medium.

To confirm that the severe growth retardation and lethality seen was due to presence of the antisense transgene, polymerase chain reactions were carried out using primers designed to amplify a region between the 5' end of the AdSS cDNA and the UAS_G/TATA promoter. Figure 6 shows that a one-to-one correlation was observed between abnormal seedlings and the antisense gene. To examine the variation in phenotype among different antisense lines, we carried out RNA gel blot hybridizations on F₁ plants derived from different antisense lines. Figure 7 shows that little AdSS RNA was detected in a line with a severe phenotype. (The most severe seedling lethal lines had to be omitted from the analysis because so little tissue was available for RNA extraction.)

View larger version (28K): In this window In a new window Download PPT slide   Figure 6. —PCR products derived from amplification with primers specific for the UASG/TATA/AdSS antisense transgene. Samples were taken from individual healthy (lanes 1–5) and unhealthy (lanes 6–10) seedlings.

View larger version (76K): In this window In a new window Download PPT slide   Figure 7. —Gel blot probed with AdSS probe containing RNA from untransformed Col-0 plants (lane 1), pAT53-103 plants (lane 2), and F1 plants derived from crossing antisense AdSS line 6 x pAT53-103 (lane 3).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

We used a scheme based on crossing to achieve inducible gene activation, relying on an effector line to activate expression of a latent transgene under the control of a synthetic, activatable promoter. Traits whose expression can be controlled with this system include both novel, nonplant genes (e.g., GUS), and antisense genes to knock out expression of endogenous genes (e.g., AdSS). Presumably, any gene of interest can be controlled in this way. This system is especially useful for allowing expression of traits that might otherwise be unrecoverable as constitutively driven transgenes. For instance, foreign genes with potentially lethal effect, or antisense genes or dominant negative mutations designed to abolish function of essential genes, while of great interest in basic studies of plant biology, present inherent experimental problems. Decreased transformation frequencies are often cited as evidence of lethality associated with a particular constitutively driven transgene, but negative results of this type are laden with alternative trivial explanations. A system of the type described here allows stable maintenance and propagation of a test transgene separate from its expression. This ability to separate transgene insertion from expression is crucial for firm conclusions about essentiality of gene function to be drawn.

If the silent transgene can exert a dominant phenotype, it can exist in either a hemi- or homozygous state in plants to be crossed to the effector for activation. However, hemizygous material presents the advantage of providing an internal control for the cross-pollination; namely, the female gametes not inheriting the T-DNA containing the test gene give rise to normal seeds and seedlings, while the progeny from the same silique that contain the test transgene will display the phenotype resulting from transgene expression.

Variation in severity of phenotype can be achieved by examining the phenotypes of multiple independent activatable lines crossed to a single activator. By relying on position effect to provide varying levels of expressibility from the different transgenic loci, it is possible to obtain a phenocopy of an allelic series for a specific trait. Here, we have shown that this diversity of expression levels from an antisense gene designed to knock out an essential metabolic function can result in plant lines with varying severity of phenotype. Experiments carried out with additional constructs resulting in lethality show that severity of phenotype generally correlates with level of expression from the transgene. Interestingly, this result implies that position effect influences transgenes driven not only by natural promoters recognized by endogenous trans-acting factors, but also synthetic promoters recognized by nonplant factors.

Further refinements in expression for particular traits could be achieved by controlling the expression of the hybrid activator gene with appropriate promoters, for example promoters regulated in developmental time or space. Depending on the stringency of control of the promoter in question, assessing the function of a gene of interest in specific cell types, tissues, or organs or at specific times in development should be possible. Such an approach has been widely used in Drosophila, usually by inserting the GAL4 effector construct at random to obtain fusions to various genomic enhancers directing expression in different cell and tissue types (BRAND and PERRIMON 1993 ).

Further levels of modulation of expression should be afforded by choosing an activation domain of appropriate strength for a specific application. Recently, plant transcriptional activation domains of net positive or negative charge were identified in a yeast functional screen (ESTRUCH et al. 1994 ). Fusion of these domains to the DNA-binding domain of GAL4 yielded proteins capable of activating a GAL4-dependent promoter gene when both were introduced into maize or tobacco cells on microprojectiles. Thus, a variety of different activation domains are identifiable by direct functional or structural screens.

In cases where the test transgene is not necessarily deleterious to plant growth and development, this "transactivation by crossing" system may still provide advantages over expression under direct control by a natural promoter. Provided that the hybrid factor is expressed well in the target species, it could provide amplification compared to direct expression under the control of the promoter used to drive the hybrid factor. Although the work described here is confined to Arabidopsis, the transactivation per se is not limited to one species. Using appropriate promoters, and possibly altering primary structure of the gene to increase its expression in the target species, the system described here should function in any species, including commercially important crops.

	FOOTNOTES

¹ These authors contributed equally to this work.
² Present address: Paradigm Genetics, Research Triangle Park, NC 27709.
³ Present address: Monsanto Corp., St. Louis, MO 63176.

	ACKNOWLEDGMENTS

We thank J. LEVIN and D. PATTON for critically reading the manuscript, C. KONCZ for providing strain GV3101 (pMP90), M. MINET for the Arabidopsis cDNA expression library, D. BECKER for vector pGPTV, J. WATKINS and L. TAN for preparation of media, and M. BLAIR and D. MCNAMARA for assistance with plant care.

Manuscript received December 30, 1997; Accepted for publication March 24, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

AOYAMA, T. and N. CHUA, 1997  A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant J. 11:605-612[Medline].

BECHTOLD, N., J. ELLIS, and G. PELLETIER, 1993  In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C. R. Acad. Sci. 316:1194-1199.

BECKER, D., E. KEMPER, J. SCHELL, and R. MASTERSON, 1992  New plant binary vectors with selectable markers located proximal to the left T-DNA border. Plant Mol. Biol. 20:1195-1197[Medline].

BRAND, A. H. and N. PERRIMON, 1993  Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415[Abstract].

CHURCH, G. M. and W. GILBERT, 1984  Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995[Abstract/Free Full Text].

CSEKE, C., B. C. GERWICK, G. D. CROUSE, M. G. MURDOCH, and S. B. GREEN et al., 1996  2-alpha-phosphohydantocidin: the in vivo adenylosuccinate synthetase inhibitor responsible for hydantocidin phytotoxicity. Pestic. Biochem. Physiol. 55:210-217.

ESTRUCH, J. J., L. CROSSLAND, and S. GOFF, 1994  Plant activating sequences: positively charged peptides are functional as transcriptional activation domains. Nucleic Acids Res. 22:3983-3989[Abstract/Free Full Text].

FONNE-PFISTER, R., P. CHEMLA, E. WARD, M. GIRADET, and K. KREUZ et al., 1996  The mode of action and the structure of a herbicide with its target—binding of activated hydantocidin to the feedback regulation site of adenylosuccinate synthetase. Proc. Natl. Acad. Sci. USA 93:9431-9436[Abstract/Free Full Text].

GATZ, C., 1996  Chemically inducible promoters in transgenic plants. Curr. Opin. Biotechnol. 7:168-172.

GOFF, S., K. C. CONE, and M. E. FROMM, 1991  Identification of functional domains in the maize transcriptional activator C1: comparison of wild-type and dominant inhibitor proteins. Genes Dev. 5:298-309[Abstract/Free Full Text].

JEFFERSON, R. A., 1987  Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5:387-405.

KONCZ, C. and J. SCHELL, 1986  The promoter of the T_L-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204:383-396.

LAGRIMINI, L. M., W. BURKHART, M. MOYER, and S. ROTHSTEIN, 1987  Molecular cloning of complementary DNA encoding the lignin-forming peroxidase from tobacco: molecular analysis and tissue-specific expression. Proc. Natl. Acad. Sci. USA 84:7542-7546[Abstract/Free Full Text].

MA, J., E. PRZIBILLA, J. HU, L. BOGORAD, and M. PTASHNE, 1988  Yeast activators stimulate plant gene expression. Nature 334:631-633[Medline].

MARSH, J. L., M. ERFLE, and E. J. WYKES, 1984  The pIC plasmid and phage vectors with versatile cloning sites for recombinant selection by insertional inactivation. Gene 32:481-485[Medline].

PTASHNE, M., 1988  How eukaryotic transcriptional activators work. Nature 335:683-689[Medline].

ROTHSTEIN, S. J., K. N. LAHNERS, R. J. LOTSTEIN, N. B. CAROZZI, and S. M. JAYNE et al., 1987  Promoter cassettes, antibiotic-resistance genes, and vectors for plant transformation. Gene 53:153-161[Medline].

SIEHL, D., M. V. SUBRAMANIAN, E. W. WALTERS, S.-F. LEE, and R. J. ANDERSON et al., 1996  Adenylosuccinate synthetase: site of action of hydantocidin, a microbial phytotoxin. Plant Physiol. 110:753-758[Abstract].

SWAFFIELD, J. C., K. MELCHER, and S. A. JOHNSTON, 1995  A highly conserved ATPase protein as a mediator between acidic activation domains and the TATA-binding protein. Nature 374:88-91[Medline].

VALVEKENS, D., M. VAN MONTAGU, and M. VAN LIJSEBETTENS, 1988  Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. Proc. Natl. Acad. Sci. USA 85:5536-5540[Abstract/Free Full Text].

WARD, E. R., S. J. UKNES, S. C. WILLIAMS, S. S. DINCHER, and D. L. WIEDERHOLD et al., 1991  Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant Cell 3:1085-1094[Abstract/Free Full Text].

WARD, E. R., J. A. RYALS, and B. J. MIFLIN, 1993  Chemical regulation of transgene expression in plants. Plant Mol. Biol. 22:361-366[Medline].

WILDE, R. J., S. E. COOKE, W. J. BRAMMAR, and W. SCHUCH, 1994  Control of gene expression in plant cells using a 434/VP16 chimeric protein. Plant Mol. Biol. 24:381-388[Medline].

This article has been cited by other articles:

				B. C. Thomas, L. Rapaka, E. Lyons, B. Pedersen, and M. Freeling Arabidopsis intragenomic conserved noncoding sequence PNAS, February 27, 2007; 104(9): 3348 - 3353. [Abstract] [Full Text] [PDF]

				M. Imamura, J. Nakai, S. Inoue, G. X. Quan, T. Kanda, and T. Tamura Targeted Gene Expression Using the GAL4/UAS System in the Silkworm Bombyx mori Genetics, November 1, 2003; 165(3): 1329 - 1340. [Abstract] [Full Text] [PDF]

				J. Booker, S. Chatfield, and O. Leyser Auxin Acts in Xylem-Associated or Medullary Cells to Mediate Apical Dominance PLANT CELL, February 1, 2003; 15(2): 495 - 507. [Abstract] [Full Text] [PDF]

				P. Tornero, R. A. Chao, W. N. Luthin, S. A. Goff, and J. L. Dangl Large-Scale Structure -Function Analysis of the Arabidopsis RPM1 Disease Resistance Protein PLANT CELL, February 1, 2002; 14(2): 435 - 450. [Abstract] [Full Text] [PDF]

				G. J. Budziszewski, S. P. Lewis, L. W. Glover, J. Reineke, G. Jones, L. S. Ziemnik, J. Lonowski, B. Nyfeler, G. Aux, Q. Zhou, et al. Arabidopsis Genes Essential for Seedling Viability: Isolation of Insertional Mutants and Molecular Cloning Genetics, December 1, 2001; 159(4): 1765 - 1778. [Abstract] [Full Text] [PDF]

				C. Boisnard-Lorig, A. Colon-Carmona, M. Bauch, S. Hodge, P. Doerner, E. Bancharel, C. Dumas, J. Haseloff, and F. Berger Dynamic Analyses of the Expression of the HISTONE::YFP Fusion Protein in Arabidopsis Show That Syncytial Endosperm Is Divided in Mitotic Domains PLANT CELL, March 1, 2001; 13(3): 495 - 509. [Abstract] [Full Text]