- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Paulin, R. P.
- Articles by Holliday, R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Paulin, R. P.
- Articles by Holliday, R.
Gene Silencing by DNA Methylation and Dual Inheritance in Chinese Hamster Ovary Cells
R. P. Paulin1,a, T. Hoa, H. J. Balzer2,a, and R. Hollidayaa CSIRO Division of Molecular Science, Sydney Laboratory, North Ryde, NSW 2113, Australia
Corresponding author: R. Holliday, CSIRO Division of Molecular Science, PO Box 184, North Ryde, NSW 2113, Australia, thu.ho{at}molsci.csiro.au (E-mail).
Communicating editor: P. J. PUKKILA
| ABSTRACT |
|---|
Chinese hamster ovary (CHO) cells strain D422, which has one copy of the adenine phosphoribosyl transferase (APRT) gene, were permeabilized by electroporation and treated with 5-methyl deoxycytidine triphosphate. Cells with a silenced APRT gene were selected on 2, 6-diaminopurine. Colonies were isolated and shown to be reactivated to APRT+ by 5-aza-cytidine and by selection in medium containing adenine, aminopterin and thymidine. Genomic DNA was prepared from eight isolates of independent origin and subjected to bisulphite treatment. This deaminates cytosine to uracil in single-stranded DNA but does not deaminate 5-methyl cytosine. PCR, cloning and sequencing revealed the methylation pattern of CpG doublets in the promoter region of the APRT- gene, whereas the active APRT gene had nonmethylated DNA. CHO strain K1, which has two copies of the APRT+ gene, could also be silenced by the same procedure but at a lower frequency. The availability of the 5-methyl dCTP-induced silencing, 5-aza-CR and a standard mutagen, ethyl methane sulphonate, makes it possible to follow concomitantly the inheritance of active, mutant or silenced gene copies. This analysis demonstrates "dual inheritance" at the APRT locus in CHO cells.
TWO types of inheritance exist in transformed mammalian cells. The first is due to classic gene mutations that change the DNA sequence or to rearrangements of chromosomal DNA. The second is often referred to as an epigenetic mechanism because heritable changes in gene activity are not due to alteration in DNA sequence (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Many questions remain about the relationship between DNA methylation of promoter sequences and gene silencing. For example, are there specific sites that when methylated prevent or inhibit transcription? Some studies indicate that such critical sites exist (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The opportunity for genetic and epigenetic analysis now exists in CHO cells. We have chosen the APRT gene for a detailed study of gene silencing in relation to methylation of the promoter region. We have used the bisulphite genomic sequencing procedure that determines which cytosines are methylated in the region of interest (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Strains and cell culture:
CHO K1 cells were the same as previously used (![]()
![]()
Selection procedures:
APRT- cells were selected in 40 µg/ml 2,6-diaminopurine (DAPR) from populations of 4 x 105 cells in 10-cm plates. Individual colonies were picked using cloning rings or stained with Giemsa to determine the frequencies of DAPR cells. DAPR clones were tested for reactivation to APRT+ using 5-aza-CR. 105 cells were incubated 24 hr in a 25-cm2 flask before the addition of 1 µg/ml 5-aza-CR (Sigma, St. Louis), from a freshly prepared solution of 1 mg/ml. After 24 hr, the medium was replaced with MEM (Eagle's minimum essential medium), and the cells incubated for 46 days. The semiquantitative method was used to score reactivation (![]()
![]()
Electroporation:
The procedure used was the same as previously described (![]()
|
Mutagenesis with ethyl methane sulphonate (EMS):
105 cells were incubated for 24 hr in 25-cm2 flasks, before the addition of 300 µg/ml EMS. The medium was changed to MEM after 24 hr, and the cells subsequently incubated for 46 days, before plating on DAP medium. In strain D422, colonies arose at a frequency of ~10-3, and individual colonies were picked using cloning rings, as required.
Genomic DNA isolation:
A culture of 5 x 1072 x 108 cells was washed in PBS, trypsinized, washed in PBS again and pelleted by centrifugation at 1000 rpm for 2 min. Cells were resuspended by hand agitation in 2 ml of ice-cold N-lysis solution (10 mM MgCl2, 30 mM HEPES pH 7.0, 10% (w/v) sucrose) to lyse the outer cell membrane. Intact nuclei and cellular organelles were pelleted by centrifugation at 7000 rpm for 5 min. The pellet was resuspended by hand agitation or pipetting in 200 µl of N-lysis solution, then lysed in 1.4 ml of lysis solution [10 mM Tris-HCl, 100 mM EDTA, 50 mM NaCl, 0.5% (w/v) SDS] containing 1 mg/ml proteinase K added from powdered stock. The lysate was transferred to a 15-ml polypropylene tube and incubated at 37° overnight on a roller or with gentle shaking. The overnight lysate was extracted once with phenol-chloroform-isoamyl alcohol (25:24:1) w/v, and once with chloroform-isoamyl alcohol (24:1 w/v). Powdered cesium chloride (Chemetall AG, Frankfurt, Germany) was added to an optical density of 1.391 (achieved by adding exactly 1.65 g of cesium chloride to 1.5 ml of lysate, then adding 100 µl of 10 mg/ml of ethidium bromide). The solution was sealed into a mini ultracentrifuge tube (Beckman Instrs., Inc., Fullerton, CA) and isopycnic cesium gradient ultracentrifugation performed overnight at 100,000 rpm or 100,000 rpm for 6 hr. The DNA band was removed from the gradient by a syringe fitted with a clean 19-gauge needle. The DNA was transferred to an Eppendorf tube and extracted repeatedly with an equal volume of CsCl-saturated isopropanol until the ethidium bromide was removed. The solution was transferred to a 15-ml polypropylene tube. DNA fibers were spooled, washed in 70% (w/v) ethanol, air-dried, and dissolved in a minimal volume of TE buffer (10 mM Tris, 0.1 mM EDTA), usually 200 µl in an Eppendorf tube. DNA concentration was measured by A260/280.
Primer synthesis:
The primers were synthesized on a 391 synthesizer (Applied Biosystems, Foster City, CA) as per the manufacturer's recommended protocol. The oligonucleotides were deprotected by incubating in concentrated ammonia solution at 55° overnight. A 50-µl aliquot was dried by vacuum centrifugation, redissolved in 80% acetic acid for detritylation, dried, redissolved in distilled water and then used directly for PCR.
Oligonucleotides complementary to bisulphite-converted DNA were synthesized based on the sequence obtained from the cloned APRT gene (30) and tested on bisulphite-treated DNA of the plasmid pD422B, kindly provided by Dr. MARK MEUTH (University of Utah, Salt Lake City).
Bisulphite primers: first round primers were A4, GGATTTGGATAATATTTATATTGGTTT, (upper strand) and B7, CACCAACTACAACTCAAATTCCACCATAAC (lower strand). Second round: A1, AAAATATCAACAAACTAAAATCATACCAA (upper strand) and B2, AGGTTTAGAAAGTTGGTTTTGTGAGAAG (lower strand).
Bisulphite genomic sequencing:
This was based on published procedures (![]()
![]()
![]()
Freshly prepared NaOH (BDH) was added to a final concentration of 0.3 N and incubated at 37° for 15 min. The solution was neutralized by addition of NH4OAc to 3 M. The DNA was ethanol precipitated, dried and redissolved in 100 µl of DNA buffer and stored at -20°.
PCR Amplification was performed in two rounds with nested primers, in 25-µl reaction mixtures containing 200 ng of treated genomic DNA, 200 µmol dNTPs (Boehringer Mannheim, Indianapolis), 1 µmol primers, commercially supplied buffer (Advanced Biotechnologies, Surrey, UK) with 2.5 units thermostable DNA polymerase (Advanced Biotechnologies) stabilized beforehand by the addition of Taqstart antibody (Clontech, Palo Alto, CA) as per the manufacturer's instructions. A FTS 320 thermocycler (Corbett Research) was used for the PCR under the following conditions: 94°/3 min x 1 cycle; 94°/1 min, 55°/2 min, 72°/3 min x 5 cycles; 94°/0.5 min, 50°/2 min, 72°/1.5 min x 25 cycles; 72°/5 min x 1 cycle.
Amplified DNA was cleaned using a Wizard PCR preps purification kit (Promega) and treated with 5 units of Pfu polymerase/1 mM dNTPs at 72° for 30 min to produce blunt ends. The blunt-ended product was kinased with 20 units of polynucleotide kinase (Boehringer Mannheim), buffer and 1 mM ATP. The mixture was incubated at 37° for 1 hr, heated to 75° for 15 min, phenol chloroform extracted, ethanol precipitated, and ligated into commercial, SmaI cut dephosphorylated pUC18 (Pharmacia, Uppsala, Sweden). The ligation mix was used to transform commercial competent E.coli XL-1 Blue (Stratagene, La Jolla, CA). Clones were sequenced using the fmol cycle sequencing kit (Promega).
Cell extracts and APRT assay:
A total of 12 x 107 cells were harvested, pelleted and washed twice with isotonic saline. The pellet was suspended in 3 ml 0.03 M Tris-HCl buffer (pH 7.4) and the cells disrupted by sonication. A supernatant extract was prepared by 20-min centrifugation at 12,000 g at 4°. Protein was determined by the A260/280 nM absorption procedure.
The enzyme assay is based on the procedure of ![]()
| RESULTS |
|---|
Inactivation and reactivation of the APRT gene in strain D422:
We have used electroporation in the presence of 5-methyl dCTP to silence the APRT gene. These isolates are selected in medium containing DAP. Table 1 illustrates the frequencies of DAPR colonies under different inducing conditions. A number of clones were isolated, subjected to 5-aza-CR treatment, and plated on AAT medium. We used the semiquantitative assay for detecting reactivation, and in all cases reactivation of the silent metallothionein gene was also checked by plating treated cells in medium containing cadmium (![]()
Genomic sequencing of the promoter of the APRT gene:
The bisulphite genomic sequencing procedure is able to distinguish cytosine from 5-methyl cytosine (5-mC) in genomic DNA (![]()
![]()
![]()
The promoter region of the APRT gene is within a CpG island at the 5' end of the gene. Genomic DNA from the D422 DAPS strain consistently showed an absence of cytosine methylation in the promoter region. Genomic sequencing of CHO K1 DNA was also carried out, and the promoter region was consistently shown to be nonmethylated.
D422 DAPR isolates that are reactivable by 5-aza-CR, were grown to a population size of approximately 2 x 107 cells in selective medium, and the DNA was isolated. A single DNA preparation was subjected to bisulphite treatment and several clones from the PCR product were sequenced (PCR clones). We detected DNA methylation in the promoter region of all these isolates, and in almost all cases the 5-mC residues were in CpG doublets. These results are presented in Table 2. The sequence analyzed is 323 base pairs in length and this contains 16 CpG doublets. In some clones (1A, 1C, 3C and 5B), the pattern of methylation was the same in all PCR clones, in others (2B and 6B) a majority of PCR clones had the same pattern, and in two (4B and 8C) there was considerable heterogeneity among the PCR clones. This variability presumably arose by the loss or gain of methylation during the time the original isolate was growing prior to the extraction of DNA. The lowest number of methylated CpG doublets was 5 or 6 in clone 2B, and the highest was 16 in clone 4B(iv) and 4B(ix). Two CpG sites (180 and 292) were methylated in all cases.
|
Non-CpG methylation was occasionally seen, at random sites, which was probably the result of the failure of deamination of cytosine by bisulphite. We also examined DNA from 5-aza-CR reactivable DAPR isolates from CHO K1. In this case, one would expect two different methylated genes to be present, each with a somewhat different pattern. This demands more exhaustive analysis, and although we confirmed that these isolates contained methylated promoter DNA (results not shown), we decided to concentrate on the more straightforward investigation of the D422 hemizygous strain.
Dual inheritance at the APRT gene:
The D422 strain provides a simple system in which the APRT can be inactivated by DNA methylation and reactivated by 5-aza-CR. The CHO K1 strain with two APRT genes makes it possible to examine both methylated epimutants and mutations induced by EMS. Previously we reported that 5-methyl dCTP produced DAPR colonies with a frequency of about 7 x 10-4, which was comparable to the frequencies of BrdURTK- and TGR HPRT- colonies (![]()
![]()
|
The DAPR colonies obtained by 5-methyl dCTP-induced silencing in strain K1 presumably have two methylated APRT genes (Figure 1C). Of 22 isolates tested, all were reactivated by 5-aza-CR (Table 3; Figure 1D), but one would expect that in most cases only one of the genes would have become active, since this is sufficient for growth on AAT medium. Hemizygosity was confirmed by treatment with 5-methyl dCTP. DAP resistant strains arose with a frequency of 7 x 10-4 (Table 3; Figure 1E), which is about 20-fold higher than step C in Figure 1 and Table 3.
|
One of the hemizygous APRT isolates was treated with EMS, under conditions that induce TGR HPRT- mutants at a frequency of about 10-3. DAPR colonies were obtained at a comparable frequency (Table 3; Figure 1F) and these should now contain one silent and one mutant gene. If so, they should be reactivable by 5-aza-CR. Sixteen out of twenty such isolates were shown to be reactivated by this procedure (Table 3; Figure 1G). At this point in the pathway, the cells should contain one inactive mutant gene, and one active gene. One of these isolates was treated with EMS, and again DAPR colonies were obtained (Table 3; Figure 1H). The prediction is that these isolates have 2 mutant genes, which either do not complement each other, or complement weakly. Twenty colonies were picked and twelve were found to be leaky, that is, they grew on AAT medium. It is possible that this growth is due to interallelic complementation. The remaining eight colonies were found to be nonreactivable by 5-aza-CR (Table 3).
Thus, the results obtained are consistent with the pathways indicated in Figure 1. It should be noted that the mutation pathway (Figure 1A and Figure B) was previously documented (![]()
![]()
| DISCUSSION |
|---|
Many studies of DNA methylation state that there is a correlation between the methylation of cytosines in or near a gene and its lack of activity, and between the absence of methylation and gene activity. Where appropriate genetic analysis can be done, it is now reasonable to draw much stronger conclusions than this. The existence of epimutagens such as 5-methyl dCTP and 5-aza-CR makes it possible to silence and reactivate a given gene. There are similarities and differences between these procedures and the use of mutagens. The latter can inactivate a gene by forward mutation at reasonably high frequency and reactivate by back mutation, usually at very much lower frequency. Very successful genetic analysis was done over many decades using such mutations, without any molecular documentation. It was sufficient to have different heritable phenotypes, which could be characterized unambiguously. The same is now true of DNA methylation. Genes can be shut off or silenced by DNA methylation and activated by removing methylation. It is now reasonable to say that DNA methylation causes inactivation of genes, which results in a heritable phenotype (![]()
Turning genes on and off by changing DNA methylation does not mean that the molecular basis for the heritable epigenetic effects is fully understood. In an earlier molecular study, using a different genomic sequencing technique, the CpG island and promoter region of the phosphoglucokinase gene in the inactive X chromosome and active X chromosome were examined (PFEIFFER et al. 1990). In the region studied, 35 CpG sites were methylated in the inactive X and all were unmethylated in the active X. In cells treated with 5-aza-CR, about half the CpG sites in the inactive X were unmethylated, but the gene remained inactive. In our experiments, we commonly found that a high proportion of CpG sites were methylated. Two of the 16 sites were in the 323-bp region of the CpG island of the silenced APRT gene were always methylated, but it is not known whether they are critical for turning off gene activity. A detailed follow-up study of 5-aza-CR treated cells, with or without APRT activity, should determine whether or not critical sites exist. The data which we have obtained so far favor the possibility that DNA methylation is a nonspecific effect, namely, that it is only necessary to have a given number of methylated cytosines in a given region to shut off transcription. This is in agreement with other evidence that density of methylation and proteins that bind to these sites prevent transcription (![]()
![]()
![]()
It is surprising that 5-methyl dCTP treatment produces such a high density of DNA methylation in the promoter region of APRT (Table 2). According to the results of ![]()
Nevertheless, it is likely that the initial methylation produced by incorporation of 5-methyl dCTP is much less than is seen in the molecular analysis. This methylation may lead to a secondary spreading of methylation throughout the promoter region In particular, it may be that the initial methylation of the binding sites for the ubiquitous transcription factor SP1 (![]()
![]()
![]()
![]()
![]()
![]()
The dual inheritance we have demonstrated at the TK and APRT loci may be a unique feature of transformed cells. Even though these cells can maintain a given pattern of methylation during normal growth (![]()
![]()
![]()
![]()
![]()
The importance of studies of dual inheritance in transformed cell lines is its obvious relevance to tumor progression in vivo. Much of the attention in this field has focused on the existence of gene mutations in oncogenes or tumor suppressor genes. Several recent studies have demonstrated the importance of DNA methylation events in the silencing of tumor suppressor genes, such as Rb and p16 (![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: University of Technology, Department of Cell and Molecular Biology, Corner Pacific Highway & Westbourne St, Gore Hill NSW 2065, Sydney, Australia. ![]()
2 Present address: Laboratory Professor Seelig and Partners, Division of Molecular Genetics - PCR, Kriegsstrasse 99 D 76133 Karlsruhe, Germany. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank JENNY YOUNG for all her help in preparing the manuscript, and Gwynvill Pty. Ltd. for financial support.
| LITERATURE CITED |
|---|
BOYES, J. and A. P. BIRD, 1991 DNA methylation inhibits transcription indirectly via a methyl CpG binding protein. Cell 64:1123-1134[Medline].
BOYES, J. and A. P. BIRD, 1992 Repression of genes by DNA methylation depends on CpG density and promoter strength. EMBO J. 11:327-333[Medline].
BRADLEY, W. E. C. and D. LETOVANEC, 1982 High-frequency non-random mutational event at the adenine phosphoribosyl transferase (aprt) locus of sib-selected CHO variants heterozygous for aprt. Somat. Cell Mol. Genet. 8:51-60.
BRANDEIS, M., D. FRANK, I. KESHET, Z. SIEGFIELD, and M. MENDELSOHN et al., 1994 Sp1 elements protect a CpG island from de novo methylation. Nature 371:435-438[Medline].
CHASIN, L. A., 1974 Mutations affecting adenine phosphoribosyl transferase in Chinese hamster cells. Cell 2:37-41[Medline].
CLARK, S. J., J. HARRISON, C. L. PAUL, and M. FROMMER, 1994 High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 22:2990-2997
COOPER, G. E., N. H. KHATTAR, P. L. BISHOP, and M. S. TURKER, 1992 At least two distinct epigenetic mechanisms are correlated with high-frequency switching for APRT phenotypic expression in mouse embryonal carcinoma stem cells. Somat. Cell Mol. Genet. 18:215-225[Medline].
COOPER, G. E., P. L. BISHOP, and M.S. TURKER, 1993 Hemidemethylation is sufficient for chromatin relaxation and transcriptional activation of methylated aprt gene in mouse P19 embryonal carcinoma cell line. Somat. Cell Mol. Genet. 19:221-229[Medline].
EHRLICH, M., and K. C. EHRLICH, 1993 Effect of DNA methylation and the binding of vertebrate and plant proteins to DNA, pp. 145168 in DNA Methylation: Molecular Biology and Biological Significance, edited by J. P. JOST and H. P. SALUZ. Birkhauser, Basel.
FROMMER, M., L. E. MCDONALD, D. S. MILLAR, C. M. COLLIS, and F. WATT et al., 1992 A genomic sequencing protocol which yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA 89:1827-1831
GRAESSMAN, A., G. SANDBERG, E. GUHL, and N. GRAESSMAN, 1994 Methylation of single sites within the Herpes Simplex Virus tk coding region and the Simian virus 40T-antigen intron causes gene inactivation. Mol. Cell. Biol. 14:2004-2010
GRIGG, G. and S. CLARK, 1994 Sequencing 5-methyl cytosine residues in genomic DNA. BioEssays 16:431-436[Medline].
HOLLIDAY, R., 1987 Inheritance of epigenetic defects. Science 238:163-170
HOLLIDAY, R., 1991 Mutations and epimutations in mammalian cells. Mutat. Res. 250:345-363[Medline].
HOLLIDAY, R., 1993 Epigenetic inheritance based on DNA methylation, pp. 452468 in DNA Methylation: Molecular Biology and Biological Significance, edited by J. P. JOST and H. P. SALUZ. Birkhauser, Basel.
HOLLIDAY, R., 1996 DNA methylation in eukaryotes: 20 years on, pp. 527 in Epigenetic Mechanisms of Gene Regulation, edited by V. E. A. RUSSO, R. MARTIENSSEN, and A. D. RIGGS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
HOLLIDAY, R. and T. HO, 1990 Evidence for allelic exclusion in Chinese hamster ovary cells. New Biologist 2:719-726[Medline].
HOLLIDAY, R. and T. HO, 1991 Gene silencing in mammalian cells by uptake of 5-methyl deoxycytidine 5' phosphate. Somat. Cell Mol. Genet. 17:537-542[Medline].
HOLLIDAY, R. and T. HO, 1995 Evidence for gene silencing by DNA methylation in normal human diploid fibroblasts. Somatic Cell Mol. Genet. 21:215-218[Medline].
HOLLIDAY, R., T. HO and R. PAULIN, 1996 Gene silencing in mammalian cells, pp. 527 in Epigenetic Mechanisms of Gene Regulation, edited by V. E. A. RUSSO, R. MARTIENSSEN and A. D. RIGGS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
HSIEH, C.-L., 1994 Dependence of transcriptional repression on CpG methylation density. Mol. Cell. Biol. 14:5487-5494
JONES, G. E. and P. A. SARGENT, 1974 Mutants of cultured Chinese hamster cells deficient in adenine phosphoribosyl transferase. Cell 2:43-54[Medline].
JOST, J. P., and H. P. SALUZ, 1993 DNA Methylation: Molecular Biology and Biological Significance. Birkhauser Verlag, Basel.
KADONAGA, J., K. JONES, and T. TJIAN, 1986 Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biochem. Sci. 11:20-23.
MACLEOD, D., J. CHARLTON, J. MULLINS, and A. P. BIRD, 1994 Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev. 8:2282-2292
MERLO, A., J. G. HERMAN, L. MAO, D. J. LEE, and E. GABRIELSON et al., 1995 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nature Med. 1:686-692[Medline].
MEUTH, M., 1990 The structure of mutation in mammalian cells. Biochim. Biophys. Acta. 1032:1-17[Medline].
MOLLOY, P. L. and F. WATT, 1990 DNA methylation and specific protein-DNA interactions. Philos. Trans. R. Soc. Lond. B Biol. Sci. 326:267-275
MUMMANENI, P., K. A. WALKER, P. L. BISHOP, and M. S. TURKER, 1995 Epigenetic gene inactivation induced by a cis-acting methylation center. J. Biol. Chem. 270:788-792
NALBANTOGLU, J., O. GONCALVES, and M. MEUTH, 1983 Structure of mutant alleles at the aprt locus of Chinese hamster ovary cells. J. Mol. Biol. 167:575-594[Medline].
NALBANTOGLU, J., G. A. PHEAR and M. MEUTH, 1986 Nucleotide sequence of hamster phosphoribosyl transferase (aprt) gene. Nucleic Acids Res. 14: 1914.
NYCE, J., 1991 Gene silencing in mammalian cells by direct incorporation of electroporated 5-methyl-2'deoxycytidine 5'-phosphate. Somat. Cell Mol. Genet. 17:543-550[Medline].
OHTANI-FUJITA, N., T. FUJITA, A. AOIKA, N. E. OSIFCHIN, and P. D. ROBBINS et al., 1993 CpG methylation inactivates the promoter activity of the human retinoblastoma tumor-suppressor gene. Oncogene 8:1063-1067[Medline].
OREND, G., I. KUHLMANN, and W. DOERFLER, 1991 The spreading of DNA methylation across integrated foreign (adenovirus type 12) genomes in mammalian cells. J. Virol. 65:4301-4308
PARK, J.-H. and M. W. TAYLOR, 1988 Analysis of signals controlling expression of the Chinese hamster ovary aprt gene. Mol. Cell. Biol. 8:2536-2544
PFEIFER, G. P., S. D. STEIGERWALD, R. S. HANSEN, S. M. GARTLER, and A. D. RIGGS, 1990 Polymerase chain reaction-aided genomic sequencing of an X chromosome-linked CpG island: Methylation patterns suggest clonal inheritance, CpG site autonomy, and an explanation of activity state stability. Proc. Natl. Acad. Sci. USA 87:8252-8256
SAKAI, T., J. TOGUCHIDA, N. OHTANI, D. W. YANDELL, and J. M. RAPAPORT et al., 1991 Allele specific hypermethylation of the retinoblastoma tumor suppressor gene. Am. J. Hum. Genet. 48:880-888[Medline].
SANTI, D. V., A. NORMENT, and C. E. GARRETT, 1984 Covalent bond formation between a DNA-cytosine methyl transferase and DNA containing 5-aza-cytidine. Proc. Natl. Acad. Sci. USA 81:6993-6997
STEIN, R., A. RAZIN, and H. CEDAR, 1982 In vitro methylation of the hamster adenine phosphoribosyl transferase gene inhibits its expression in mouse C cells. Proc. Natl. Acad. Sci. USA 79:3418-3422
STIRZAKER, C., D. S. MILLAR, C. L. PAUL, P. M. WARNECKE, and J. HARRISON et al., 1997 Extensive DNA methylation spanning the R6 promoter in retinoblastoma tumors. Cancer Res. 57:2229-2237
TASSERON-DE JONG, J., J. AKER, H. DER DULK, P. VAN DE PUTTE, and M. GIPHART-GASSLER, 1989 Cytosine methylation in the EcoRI site of active and inactive herpes virus thymidine kinase promoters. Biochim. Biophys. Acta 1008:62-70[Medline].
TOTH, M., V. LICHTENBERG, and W. DOERFLER, 1989 Genomic sequencing reveals a 5 methyl cytosine-free domain in active promoters and the spreading of pre-imposed methylation patterns. Proc. Natl. Acad. Sci. USA 86:3728-3732
TOTH, M., U. MULLER, and W. DOERFLER, 1990 Establishmemt of de novo DNA methylation patterns. Transcription factor binding and deoxycytidine methylation at CpG and non-CpG sequences in an integrated adenovirus promoter. J. Mol. Biol. 214:673-683[Medline].
WILSON, V. L. and P. A. JONES, 1983 DNA methylation decreases in aging but not in immortal cells. Science 220:1055-1057
This article has been cited by other articles:
![]() |
A. T. Hammond and B. S. Glick Dynamics of Transitional Endoplasmic Reticulum Sites in Vertebrate Cells Mol. Biol. Cell, September 1, 2000; 11(9): 3013 - 3030. [Abstract] [Full Text] |
||||
![]() |
R. Holliday and T. Ho Evidence for gene silencing by endogenous DNA methylation PNAS, July 21, 1998; 95(15): 8727 - 8732. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Paulin, R. P.
- Articles by Holliday, R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Paulin, R. P.
- Articles by Holliday, R.


