Molecular Genetic Dissection of Mouse Unconventional Myosin-VA: Head Region Mutations

Corresponding author: Nancy A. Jenkins, ABL-Basic Research Program, P.O. Box B, Bldg. 539, Frederick, MD 21702-1201. Email: jenkins@ncifcrf.gov.

Communicating editor: C. KOZAK

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The mouse dilute (d) locus encodes unconventional myosin-VA (MyoVA). Mice carrying null alleles of dilute have a lightened coat color and die from a neurological disorder resembling ataxia and opisthotonus within three weeks of birth. Immunological and ultrastructural studies suggest that MyoVA is involved in the transport of melanosomes in melanocytes and smooth endoplasmic reticulum in cerebellar Purkinje cells. In studies described here, we have used an RT-PCR-based sequencing approach to identify the mutations responsible for 17 viable dilute alleles that vary in their effects on coat color and the nervous system. Seven of these mutations mapped to the MyoVA motor domain and are reported here. Crystallographic modeling and mutant expression studies were used to predict how these mutations might affect motor domain function and to attempt to correlate these effects with the mutant phenotype.

THE mouse dilute (d) locus encodes unconventional myosin-VA (MyoVA). Mice homozygous for null mutations at dilute have a lightened coat color and die from a neurological disorder resembling ataxia and opisthotonus (arching of the head and neck) within three weeks of birth. The pigment defect in dilute mice does not result from abnormal pigment production. Rather, the lightened coat color results from the irregular clumping of melanosomes within the perinuclear regions of the melanocyte and the subsequent uneven release of the granules into the hair shaft (RUSSELL and RUSSELL 1948 ). This phenotype is consistent with immunolocalization experiments suggesting that MyoVA functions in melanosome transport and/or melanosome tethering (PROVANCE et al. 1996 ; WU et al. 1997 ).

The neurological defects of dilute appear to result in part from defects in smooth endoplasmic reticulum (SER) transport. In both the dilute rat and the dilute mouse, SER has been reported to be missing from the dendritic spines of cerebellar Purkinje cells (DEKKER-OHNO et al. 1996 ; TAKAGISHI et al. 1996 ). Since SER is still present in the dendritic shaft, it has been proposed that MyoVA is required only for the short-range transport of SER into the dendritic spine and that another motor protein is used for the long-range transport of SER from the cell body to the dendritic shaft. This hypothesis is consistent with recent studies indicating that the movement of membranous organelles involves both actin- and microtubule-based motors and with current models suggesting that microtubules provide the tracks for movement over long distances while actin filaments provide for movement within local regions of the cytoplasm (ATKINSON et al. 1992 ; LANGFORD 1995 ). It is also consistent with immunofluorescence and immunoelectron microscopy studies showing that MyoVA-associated organelles are present on both microtubules and actin filaments (EVANS et al. 1997 ).

During the past century hundreds of forward mutations to dilute have been identified. Most of these alleles were produced in large-scale mutagenesis screens, first using ionizing radiations, which, in certain germ-cell stages, primarily make large deletions as well as other complex rearrangements, and later with chemicals such as ethylnitrosourea (ENU) which, when spermatogonia are treated, primarily make point mutations. The vast majority of these induced mutations [called dilute opisthotonus (d^op) or dilute lethal (d^l)] are homozygous lethal and presumably represent null alleles (RUSSELL 1971 ; STROBEL et al. 1990 ). Four viable classes of alleles were also recovered and presumably represent hypomorphic alleles. The first class, called dilute (d), produces a lightened coat color but no neurological defect. The second class, called dilute intermediate (d^x), is the most common class. The coat color of d^x mice is intermediate between wild type and d mice, and d^x mice are neurologically normal. The last two classes, called dilute neurological (dⁿ) and dilute intermediate neurological (d^xn), have a lightened coat color and a neurological defect that either disappears as the mice age or is mild and persists throughout life. These two classes are distinguished by coat color, which is like that of d (dⁿ) or d^x (d^xn) mice, respectively. In some cases, dⁿ mutations were originally classified as viable d^op alleles. To avoid confusion with the lethal d^op alleles, we consider them all dⁿ mutations in this report.

In studies described here, we have used an RT-PCR-based sequencing approach to identify the mutations responsible for 17 viable dilute alleles. We hoped that, by determining the nature and position of the mutations responsible for each dilue allele and by correlating this information with mutation phenotype, we could gain new insights into the functional domains of MyoVA. In these studies we focused primarily on ENU-induced alleles since they are most likely to be caused by point mutations, which are a very informative class of mutations for structure-function studies. Members of all four viable classes of dilute alleles were sequenced. In the case of the d, dⁿ, and d^xn alleles, some spontaneous and radiation-induced alleles were also included since few ENU-induced alleles from these classes were available for study. Seven of the mutations mapped to the MyoVA head and are reported here.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Mice:
The seven alleles reported in this study were generated by mutagenesis of (101/Rl x C3H/Rl) F₁ hybrid mice at Oak Ridge National Laboratory, Oak Ridge, TN. Six of the seven alleles are extinct and only frozen tissues were available for analysis. The Myo5a^2ENURcc allele is maintained at the National Cancer Institute-Frederick Cancer Research and Development Center by crossing carriers to C57BL/6J-d ^v se/d ^v se mice.

Northern analysis:
Total RNA was prepared from brain, spleen and skin of C57BL/6J, 101/Rl, C3H/Rl and dilute mutant mice by the RNAzol method (Tel-Test, Inc, Friendswood, TX). RNA was poly(A) selected once using the mRNA Purification kit from Pharmacia (Piscataway, NJ). For Northern analysis, the RNA was electrophoresed through a 0.8% agarose gel and then transferred to a Hybond-N+ membrane (Amersham, Arlington Heights, IL) by standard methods (AUSUBEL et al. 1997 ). Hybridizations and washes were performed according to CHURCH and GILBERT 1984 . The dilute cDNAs (1-1682, 1549-3928, 2904-7156) corresponding to the head and tail regions were mixed and used as probe (MERCER et al. 1991 ).

RT-PCR sequencing analysis:
Total RNA was reverse transcribed using SuperScript reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, MD) and amplified by PCR (94° denature, 55° hybridization, 72° elongation, 40 cycles). The resulting cDNA fragments were isolated from DNA, oligonucleotides and nucleotides with Centricon-100 sizing columns (Amicon, Beverly, MA). Purified fragments were directly sequenced with PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (Perkin Elmer, Norwalk, CT) and read-ready sequence was obtained with an automated sequencer (ABI). Fragments were sequenced from both directions. Differences between the mutant and wild-type sequences were identified with the GCG Sequence Analysis Software Package (Version 8) provided by Genetics Computer Group, University of Wisconsin (Madison). Point mutations, deletions and insertions in the cDNA can be easily detected by this method.

Preparation of protein samples and electrophoresis:
A small amount of frozen brain or spleen was chipped off the organ under liquid nitrogen and homogenized in 0.5 ml of 5% ice-cold trichloroacetic acid (TCA) with a hand-held homogenizer. A 10 µl aliquot was removed and the protein concentration was determined by the BCA assay (Pierce, Rockford IL). The TCA precipitates were pelleted by centrifugation at 12k x g for 10 min, 4°; the pellets were washed with water, respun and brought up in sample buffer (25 mM tris base, 38 mM glycine, 5% SDS, 5% beta-mercaptoethanol, 50% glycerol, and ~1 mg/ml bromophenol blue) for a final protein concentration of 1 mg/ml. Samples were loaded at 20 µg/lane onto 5–20% mini-gradient SDS-PAGE gels (LAEMMLI 1970 ), and transferred (TOWBIN et al. 1979 ) to PVDF membranes (Bio-Rad, Hercules CA). Blots were stained with antibodies directed against the head domain of myosin V (produced by F. S. ESPINDOLA). This antibody was produced in rabbits using a bacterially expressed fusion protein of the chicken myosin V head domain fused to maltose-binding protein (ESPREAFICO et al. 1992 ) and purified on an amylose affinity column. Maltose-binding protein reactivity was removed from the antisera by absorption to a maltose-binding protein column and then affinity-purified on a column constructed with the original fusion protein. The final antibody was used at 0.05 µg/ml. Blots were processed for chemiluminescence according to the manufacturer's directions (Boehringer Mannheim, Mannheim, Germany). For head alleles: In some experiments, antibody against the tail domain of myosin V (ESPREAFICO et al. 1992 ) was also used at 1 µg/ml. Blots were stripped and stained for myosin VI (assumed to be unaffected by the MyoVA mutations) as a loading control with anti-myosin-VI antibody (HASSON and MOOSEKER 1994 ) used at 1 µg/ml.

Quantification of myosin V:
Blots were scanned with a 600 dpi, 8 bit greyscale scanner (Microtek Lab Inc., Torrance CA); the relative amount of myosins V and VI per lane was determined with Image software (National Institute of Health, Bethesda, MD). In order to control for small differences in gel loading or transfer efficiency, the relative amount of myosin VI for each lane of a given tissue was determined and used to normalize the amount of myosin V per lane.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Mutant characterization:
Each of the viable dilute alleles sequenced in these studies was characterized as follows. First, DNA from each mutation in the homozygous condition was analyzed by Southern blot hybridization with at least ten different restriction enzymes to determine if the allele contained a large structural alteration in Myo5a that would compromise its use for structure/function studies. None of these viable mutations contained large structural alterations (data not shown), consistent with the fact that most were chemically-induced in spermatogonia. Next, Northern analysis was done to ensure that all alleles produced at least some RNA (see below). Mutant RNAs were then reverse transcribed and sequenced. RNA from two tissues, brain and skin or spleen, was sequenced for each mutation. These tissues express all of the known alternative splice forms of Myo5a (see below). Complete sequencing of the 5487 bp coding region of the brain-specific isoform of Myo5a (or any of the other isoforms expressed in skin and spleen) could be accomplished in as little as three days.

The RT-PCR based sequencing strategy is described in Figure 1. Oligonucleotide primers homologous to Myo5a cDNA were designed in such a way that any given region of the coding sequences is amplified in at least two independent PCR reactions with different primer sets. Oligonucleotide primers were also used as sequencing primers. Following PCR amplification, the RT-PCR products were used for direct sequencing as described in MATERIALS AND METHODS. Point mutations, deletions and insertions in the cDNA can easily be detected by this method. Any potential mutations were confirmed by analyzing tissues from a second animal. In control experiments, wild-type cDNA was sequenced from three strains, C57BL/6J, C3H/Rl, and 101/Rl. All but one of the mutations analyzed in these studies arose on one of these three backgrounds. All three wild-type sequences were identical (data not shown). One mutation, which did not map to the head region, arose on a strain closely related to C57BL/6J, C57BL/10SnJ (see accompanying article by HUANG et al. 1998 ).

View larger version (29K): In this window In a new window Download PPT slide   Figure 1. —Strategy for PCR amplification of the Myo5a cDNA. The top of the figure shows an agarose gel containing the Myo5a PCR amplification products. The middle of the figure shows the DNA fragments (open rectangles) amplified by different primer sets. Brain cDNA is used as a template. Note that each individual base pair in the Myo5a coding region is amplified by at least two independent PCR reactions. The bottom of the figure contains a schematic of the Myo5a cDNA showing the location of the primers on the cDNA (1 to 12 forward and 2' to 14' reverse). Untranslated regions are shown as hatched rectangles and the coding region as a blackened rectangle. The sequences of the primers are as follows: (1) GGCA CGAGCCTAGGCGGGGGGCG, (2) TCACATCTTCGCAGTAGCTGAAG, (3) CACGAAGCAAGGAGGCAGCCCTATG, (4) CTATGGATTTGAAACATTTGAAATA, (5) ACCAGAGCTATTTCAAGATGATGAG, (6) GGATAAATACCAGTTTGGTAAG, (7) GTCTGCAGGAAGAAATTGC, (8) GGAGGAGCGCTATGATGACCTC, (9) TGCGCCAGGTGCGCCTGCTTACC, (10) CTGCTGGCCCAGAACCTGCAGCTG, (11) CATCAACAATTAACAGCATC, (12) ACAGATGTTCTACATTGTGG, (2') GGATCCATGTCACCCATGTTCTG, (3') CTAAAAGGTAAGTTCTCATATTG, (4') GCCTGCAGCTTGGAGATGGGCTTG, (5') GTTTGACATGCGGGGCTTCTCA, (6') CTCGTGCGCTGATCCGGATGGTC, (7') CTGAATAACAATCGTGGCAGCT, (8') AGGCGACTGAACTCATTCAGAAGG, (9') CCTCAAGATGAGGACTTCCTCC, (10') TCCTGCTTTTCAAGTTGTTCCATC, (11') CCACTATATTGCTTCAAACAGTGC, (12') GTACCTGATCTGCATGCCC, (13') CATATTCTGAGGAGAAATGCG, (14') GTATGCCACTTAAATGCAGCAC.

All of the known alternatively spliced forms of Myo5a were also sequenced in these studies. As shown in Figure 2, three different alternative splice forms of Myo5a can be identified by PCR amplification and agarose gel electrophoresis. Each splice form was isolated from the gel and directly sequenced. Brain has a unique splice form (#3) that is not observed in other tissues such as skin and spleen. Skin and spleen have identical splice forms (#1 and #2), although the relative amount of each splice form varies in the two tissues. In some cases, skin was not available for analysis and spleen samples were substituted.

View larger version (13K): In this window In a new window Download PPT slide   Figure 2. —PCR amplification of the three alternative splice forms of Myo5a. The structure of the three alternative splice forms of Myo5a are shown to the right of the figure. The capital letters represent exons as described previously (SEPERACK et al. 1995 ). Since each alternatively spliced form codes for a slightly different tail, it has been suggested that each tail allows MyoVA to bind and transport different cargoes in different cell types. The bold arrows represent the primer set used in RT-PCR amplification. An agarose gel containing the Myo5a amplification products from brain, skin, and spleen is shown to the left of the figure. The sequence of spliced forms #1 though #3 was determined by direct sequencing after gel purification of each amplified fragment.

Head region mutations:
Among the 17 dilute mutations for which mutation data were obtained, seven were located in the MyoVA head (Table 1, Figure 3; and HUANG et al. 1998 ). All were missense mutations, consistent with their chemical mode of induction in spermatogonia. Five of the mutations were ENU-induced. ENU is a direct alkylating agent that can ethylate DNA at many sites (for review see SHIBUYA and MORIMOTO 1993 ). Three types of ENU-induced lesions have been shown to cause direct base misincorporation by DNA polymerase and are thus thought to be the most important mutagenic lesions. These are O ⁶-ethylguanine that induces G:C to A:T transitions, O ⁴-ethylthymine that induces T:A to C:G transitions and O ²-ethylthymine that induces T:A to A:T and T:A to G:C transversions (for a review see MARKER et al. 1997 ). Three of the five ENU-induced head region mutations presumably resulted from O ⁶ or O ² alkylations, two being T:A to A:T transversions and one being a G:C to A:T transition (Table 1). The other two head region mutations were induced by methylnitrosourea (MNU) (Myo5a^1MNURe) or nitrosoethylcarbamate (NEC) (Myo5a^8PNECIII). While little information is available regarding the mutational specificity of these two chemicals, both chemicals generated mutations that were similar to those induced by ENU (Table 1).

View larger version (10K): In this window In a new window Download PPT slide   Figure 3. —Schematic representation of MyoVA showing the approximate location of the MyoVA head region mutations. The different functional domains of MyoVA including the head, neck and tail are indicated. The head region of MyoVA shows extensive homology with other myosins, including the ATP and actin binding sites (MERCER et al. 1991 ; ESPREAFICO et al. 1992 ). The neck region contains six imperfect tandem repeats (the IQ repeats) and is the site of light chain binding (ESPREAFICO et al. 1992 ). The tail region consists of a coiled-coil region followed by a globular domain. The presence of this coiled-coil region suggests that MyoVA is a dimeric molecule and ultrastructure studies support this prediction (CHENEY et al. 1993 ). Mutations indicated below the schematic diagram affect only coat color while mutations indicated above the schematic diagram affect both coat color and the nervous system.

Three of the four viable classes of dilute alleles were represented by these head-region mutations (Table 1). The one missing class was the d class, which was not surprising given that only one of the viable mutations analyzed in these studies was from the d class. The head-region mutations were roughly equally distributed along the length of the MyoVA head and there was no obvious clustering of mutations with respect to phenotypic class (Figure 3). The MyoVA head can thus be mutated in such a way that only coat color or both coat color and the nervous system are affected. While it is conceivable that a head region mutation could affect the nervous system without affecting coat color, to date no dilute alleles have been reported that affect only the nervous system. These results argue against a model where the MyoVA head contains a region(s) important for MyoVA function in melanocytes and another region(s) important for MyoVA function in neurons; they are more consistent with a simple model where the severity of the mutation determines its ultimate phenotype; the least severe mutations being d^x and the most severe being dⁿ.

Expression levels:
These head-region mutations could have an effect on MyoVA in two different ways. First, they could alter amino acids critical for head function such as actin binding and ATP binding/hydrolysis. Second, they could destabilize Myo5a mRNA or protein or prevent correct protein folding, resulting in reduced protein levels. To determine if any of the mutations affect Myo5a mRNA levels, brain RNA from the seven different head region mutations was characterized by Northern analysis (Figure 4) and Myo5a mRNA levels quantitated relative to a wild-type control (Table 1). Myo5a mRNA levels appeared to be altered by three mutations, Myo5a^18ENURw (130%), Myo5a^48ENURd (79%), and Myo5a^8PNECIII (71%) (Table 1). These differences were, however, small and may represent simple experimental variation.

View larger version (72K): In this window In a new window Download PPT slide   Figure 4. —Northern blot analysis of Myo5a mRNA from brain of homozygous viable dilute mutant mice. The three principal 7, 8, and 12 kb Myo5a transcripts are shown. The complex transcription pattern of Myo5a results in part from the differential use of 3' poly(A) addition signals (MERCER et al. 1991 ). The three transcripts appear to have identical coding capacity. RNA from C57BL/6J wild-type brain was used as control. Gapd (1.35 kb) was used as a loading control.

To determine if any of the mutations affected MyoVA protein levels, extracts from mutant spleen or brain were characterized by Western analysis using antibodies directed against the MyoVA head (Figure 5; Table 1) as well as the MyoVA tail (data not shown) and the relative levels quantitated relative to an internal MyoVI control. Both antibodies are specific for MyoVA and do not cross-react with the related MyoV protein, MyoVB (V. M. and M. S. M., unpublished results). Both antibodies gave identical results, with the exception of the Myo5a^48ENURd mutation (see below). MyoVA protein levels appeared significantly reduced by at least three mutations (Table 1 and see below). The magnitude of the effect was roughly proportional to the severity of the mutant phenotype for these three alleles. The mutation with the most severe phenotype, Myo5a^4ENURk (9%), is a dⁿ mutation; the mutation with the next most severe phenotype, Myo5a^2ENURcc (30%), is a d^xn class mutation; and a mutation with one of the mildest phenotypes, Myo5a^18ENURw (41%), is a d^x class mutation (Table 1). These results suggest that the phenotype caused by these three mutations may be partly, but not exclusively, explained by these reduced protein levels. Several other mutations do not show this association and presumably result from mutations that affect protein function (Table 1).

View larger version (29K): In this window In a new window Download PPT slide   Figure 5. —Western blot analysis of MyoVA levels in homozygous viable dilute mutant mice. Extracts from wild-type and mutant mice were made from brain (Myo5a2ENURcc, Myo5a8PNECIII, Myo5a4ENURk and Myo5a18ENURw) or spleen (Myo5a94ENURd, Myo5a48ENURd and Myo5a1MNURe) and probed with a head region antibody. MyoVI was used as a loading control.

One mutation, Myo5a^48ENURd, that showed relatively normal MyoVA protein levels when probed with a tail region antibody, showed greatly reduced protein levels when probed with a head region antibody (Figure 5; Table 1). While the head antibody was a polyclonal against a large protein domain (see MATERIALS AND METHODS), myosin heads, like actin, are notoriously bad antigens and often induce only a limited immune response. It is possible, therefore, that the head antibody recognizes a single major epitope(s) that is located in the most N-terminal region of the head (aa 1-137) and that the Myo5a^48ENURd mutation, which is located at aa138, disrupts this epitope(s). The Myo5a^48ENURd mutation must, however, retain significant activity since the mutant phenotype is limited to a slight dilution of coat color.

Crystallographic modeling:
The primary structure of all myosin heads are highly conserved (COPE et al. 1996 ). This conservation makes it possible to model the structural consequences of mutations in one myosin head using the three dimensional co-ordinates reported for other myosin heads (FISHER et al. 1995 ; RAYMENT et al. 1993B ; SMITH and RAYMENT 1995 ; SMITH and RAYMENT 1996 ; XIE et al. 1994 ). In the studies outlined below, we have modeled the MyoVA head region mutations using the three-dimensional structure reported for the chicken skeletal muscle conventional myosin II head (RAYMENT et al. 1993B ). In these studies, the head region is defined as the S1 fragment, which refers to the proteolytic fragment obtained when conventional myosin II is digested with papain. Following trypsin digestion, this S1 fragment is further cleaved into the N-terminal 25, central 50 and C-terminal 20 kDa fragments (colored green, red, and blue, respectively, in Figure 6 and Figure 7).

View larger version (68K): In this window In a new window Download PPT slide   Figure 6. —The positions of the six missense mutations in the MyoVA head modeled onto the three-dimensional structure of chicken pectoralis myosin II motor domain (RAYMENT et al. 1993B ). Above is shown the "conventional" view of the motor domain, with the nucleotide binding pocket at the top and the actin binding region at the bottom left. Below is shown the same structure rotated approximately 180° about the horizontal axis. The locations of the six mutations are indicated by arrows, with the corresponding chicken residues as determined by multiple alignment (COPE et al. 1996 ) in parentheses. The side chains of these chicken residues are shown in cyan. The Myo5a2ENURcc (P60R) mutation could not be modeled since the N-terminal beta-barrel (shown in this figure in green and marked with an asterisk) is not present in MyoVA. The 20 kDa, 50 kDa and 25 kDa proteolytic subdomains are shown in green, red and blue, respectively. The sulfate occupying part of the nucleotide binding site is shown in yellow-green. For orientation, the inserts show the entire S1 structure with the regulatory light chain in magenta and the essential light chain in yellow-green. (Graphics were prepared using Midas software (University of California, San Francisco) on a Silicon Graphics Indigo II workstation, followed by annotation in Freehand (Aldus) on an Apple Macintosh.)

View larger version (57K): In this window In a new window Download PPT slide   Figure 7. —Closeup views of the six mutations mapped onto the chicken myosin II crystal structure illustrating their local environment: (a) Myo5a18ENURw (Y408N); (b) Myo5a4ENURk (M305K); (c) Myo5a48ENURd (H138Q) and Myo5a8PNECIII (Y127N); (d) and (e) Myo5a1MNURe (P516S); and (f) Myo5a94ENURd (R659H). In the center, an overall view of the myosin motor domain is shown as described in Figure 6. Panels b, d, and f are in approximately the same orientation as this central view, while panels a, c, and e are rotated for clarity. The colors of the motor domain are as described in Figure 6: the mutated side chains are cream; the other side chains are magenta; sulfur is shown in yellow-green; and the oxygens of the sulfate are in red. In this Figure, the amino acids are numbered according to their positions in the chicken myosin II protein and the corresponding mouse MyoVA amino acid is shown in parentheses. In panel e, the proximity of P543 to actin in the actomyosin interface determined by Rayment and colleagues (RAYMENT et al. 1993A ) is shown. One actin monomer is in blue, another in green, and the myosin is in red, with P543 labeled. Only a few side chains have been included for reference as it is not possible to determine the precise interactions between the myosin and actin side chains. In panel f, a spacefilling model of the region around R673 shows the cream NH1 and NH2 atoms of this residue. These are close to the O4 of the sulfate occupying part of the ATPase site that is just visible in this view. (Graphics were prepared using Quanta (Molecular Simulations, Inc.) and Midas (UCSF) software on a Silicon Graphics Indigo II workstation, and Rasmol followed by annotation in Freehand (Aldus) on an Apple Macintosh.)

Six out of the seven MyoVA head region mutations could successfully be modeled using this approach (Figure 6 and Figure 7). The Myo5a^2ENURcc mutation could not be evaluated in these studies because it results from a C219G transversion that introduces a missense mutation P60R into the protein. P60 is located within an N-terminal extension region that varies dramatically among the various classes of myosins. In the chicken skeletal muscle myosin II, this region forms a beta-barrel that makes little contact with the rest of the motor domain (see Figure 6) while in other myosins, this region may be truncated or even absent. The role of this region is not known. The severity of the Myo5a^2ENURcc phenotype may reflect an important function for the MyoVA N-terminal extension or may result from the reduced MyoVA protein levels observed in Myo5a^2ENURcc mice (Table 1). However, reduced protein levels do not correlate consistently with severity (see Myo5a^18ENURw).

The Myo5a^48ENURd mutation results from a C454G transversion that introduces a missense mutation H138Q into the protein. H138 (H154 in chick) is absolutely conserved in all known myosins (COPE et al. 1996 ). It may be important in stabilizing the transition state during ATP hydrolysis since H138 is located in the helix at the entrance to the ATP binding pocket (Figure 6). H138 is sandwiched within a tight hydrophobic cluster that includes the side chains of Y100 and F140 (Figure 7C). The introduction of a glutamine into this cluster might be expected to be highly disruptive. However, Myo5a^48ENURd has a relatively mild phenotype, indicating that this mutation has been accommodated within the 3-D structure of the motor domain with only a slight loss in functionality.

The Myo5a^18ENURw mutation is caused by a T1262A transversion that introduces a missense mutation Y408N into the protein (Figure 6 and Figure 7A). Y408 (Y434 in chick) is conserved in over 90% of all myosins, but is replaced by an H in two myosin I's, namely rat Myr3 and human IC (COPE et al. 1996 ). Y408 is involved in a series of conserved hydrophobic interactions with residues from the well-known highly conserved myosin sequence EA/SFGNAKT, forming a hydrophobic pocket close to the ATP binding site (see Figure 7A). An asparagine in this position would be unable to hydrogen bond with the backbone oxygen of F232 and would generate a buried polar residue. One would predict that the net effect would be to destabilize the ATP binding site. However, it is interesting to note that Myo5a^18ENURwR, like Myo5a^48ENURd, is a mild mutation (Table 1). Thus, changes in these highly conserved residues seem to have relatively minor effects on the function of MyoVA. Nevertheless, a phenotype is observed.

The Myo5a^1MNURe mutation is due to a C1586T transition that introduces a missense mutation P516S into the myosin (Figure 6, Figure 7D, and Figure 7E). P516 is located in one of the regions believed to be intimately involved in myosin-actin interaction (~aa 500–530) (RAYMENT et al. 1993A , Figure 7D and Figure 7E). This residue is conserved in about 85% of known myosins, but in a number of myosin I's it is replaced by an A or a hydrophobic residue. The mildness of the Myo5a^1MNURe phenotype suggests that the mutant myosin is partially active, providing additional evidence that this region of the actomyosin interface may be far less specific than previously imagined (see also COPE et al. 1996 ).

The Myo5a^94ENURd mutation arises from a G2016A transition that introduces a missense mutation R659H into the myosin. R659 (R673 in chick) is absolutely conserved in all myosins and lies close to the bottom of the nucleotide binding pocket (Figure 6 and Figure 7F). It was previously identified as a crucial residue that might be involved in the release of the -phosphate from the ATPase site (COPE et al. 1996 ). An R659H change would normally be considered a mild mutation. The Myo5a^94ENURd phenotype fits this prediction, it has a mild effect on both coat color and the nervous system (Table 1).

The Myo5a^8PNECIII mutation results from a T419A transversion that introduces a missense mutation Y127N into the protein. Y127 (Y143 in chick) is over 90% conserved in all myosins and in the remainder it is replaced by an F. Y127 is adjacent to the hydrophobic cluster containing H138, which is absolutely conserved (Figure 7C). A mutation in Y127 (especially to an N) might disrupt this helix, located at the mouth of the ATP binding site, and might be expected to have a deleterious effect on ATP binding or hydrolysis. The severity of the Myo5a^8PNECIII phenotype supports this prediction (Table 1). It is interesting that the mutations of residues Y127 (Myo5a^8PNECIII) and H138 (Myo5a^48ENURd), which are adjacent in the crystal structure (Figure 6 and Figure 7C), result in phenotypes of differing severity, at least with respect to the nervous system.

The Myo5a^4ENURk mutation is due to a T954A transversion that introduces a missense mutation M305K into the myosin. M305 (L331 in chick) is not conserved, but it usually is a hydrophobic residue. It is located in a helix running along the top of the upper 50 kDa subdomain and is likely to be a buried hydrophobic residue, as it is in the chicken skeletal myosin II structure (Figure 6 and Figure 7B). A lysine in this position introduces a larger, charged sidechain that should significantly disrupt the folding of the upper 50 kDa domain, perhaps resulting in the very low protein levels and the very severe phenotype, at least with respect to coat color, that is observed in Myo5a^4ENURk mice (Table 1).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

In the studies described here, we have used an RT-PCR-based sequencing approach to identify the mutations responsible for 17 viable dilute alleles that vary in their effect on coat color and the nervous system. Seven of the mutations represented missense mutations that mapped to the MyoVA head. Three of the four viable classes of dilute alleles were represented by these motor domain mutations. The one missing class was the d class, which was not surprising, given that only one of the viable mutations analyzed in these studies was from the d class. The MyoVA head can thus be mutated in such a way that only coat color or both coat color and the nervous system are affected.

Mutations in only two other classes of mammalian unconventional myosins have been reported. The mouse Snell's waltzer (sv) mutation is caused by mutations in unconventional Myo6 (AVRAHAM et al. 1995 ). Homozygous sv mice have defects in the inner ear and are completely deaf. Only one mutation in the Myo6 gene has been reported. This mutation results from a small intragenic deletion that truncates the protein at the head/neck junction (AVRAHAM et al. 1995 ). Likewise, the mouse shaker-1 (sh1) mutation is caused by mutations in unconventional Myo7a (GIBSON et al. 1995 ). Interestingly, homozygous sh1 mice have a phenotype that is nearly identical to that of homozygous sv mice. Three Myo7a mutations have been reported (GIBSON et al. 1995 ), all being in the Myo7a head, the only region screened to date. One mutation is in a splice site, resulting in premature translation termination and would presumably be a null allele. The other two are arginine-to-proline missense mutations, one of which is close to the ATP-binding site and presumably affects ATP-binding/hydrolysis or protein folding.

Mutations in MYO7A have also been identified in human Usher syndrome type 1B patients (USH1B) (WEIL et al. 1995 ). Usher syndrome type 1 is characterized by a profound congenital sensorineural hearing loss, constant vestibular dysfunction and prepubertal onset of retinitis pigmentosa. Fourteen exons from the head region of MYO7A have been screened for mutations in a total of 189 USH1B families (WESTON et al. 1996 ). Out of 23 mutations, 13 were unique. Six of the 13 mutations caused premature stop codons, 6 were missense mutations, and 1 was a splicing defect. The 6 missense mutations were largely located in regions of the head thought to be involved in actin binding and ATP binding/hydrolysis (WESTON et al. 1996 ). Interestingly, three additional mutations in MYO7A have recently been identified, two in the motor and one in the tail domain, that result in non-syndromic recessive deafness (LIU et al. 1997 ; WEIL et al. 1997 ).

In patients with familial hypertrophic cardiomyopathy (HCM), forty different mutations have also been identified in human conventional ß-cardiac myosin (MYH7) (reviewed in RAYMENT et al. 1995 ). HCM is an autosomal dominant inherited cardiac disease, characterized by left ventricular hypertrophy and markedly variable phenotypic expression (EPSTEIN et al. 1992 ; FANANAPAZIR et al. 1993 ). It is the most common cause of sudden death in otherwise healthy individuals. Surprisingly, 33 of the 40 characterized MYH7 mutations are located in the motor domain (RAYMENT et al. 1995 ; VIKSTROM and LEINWAND 1996 ). This may reflect the fact that HCM is a dominant disease and MYH7 mutations cause disease through dominant negative effects. Dominant negative mutations may be easier to generate in the head region. The 33 MHY7 head region mutations are clustered around four specific regions in the myosin head: (1) the actin binding interface; (2) the ATP binding site; (3) the region that connects the two reactive cysteines, SH1 and SH2; and (4) the light-chain binding region.

Similar to the results reported for Myo7a (MYO7A) and MYH7, most of the Myo5a head mutations were located near regions important for motor domain function including actin-binding (Myo5a^1MNURe) and ATP-binding/hydrolysis (Myo5a^48ENURd, Myo5a^18ENURw, Myo5a^8PNECIII, and Myo5a^94ENURd). However, two of the mutations were located in regions not previously identified as being important for motor domain function. One mutation, Myo5a^2ENURcc, was located in an N-terminal extension that is unique to the MyoV class of unconventional myosins and is absent in other classes of myosins. The severity of the Myo5a^2ENURcc mutation might indicate an important function for this N-terminal extension; however, the reduced MyoVA protein levels observed in Myo5a^2ENURcc mice make this difficult to predict with certainty. The other mutation, Myo5a^4ENURk, by replacing a hydrophobic residue with a charged basic residue, probably disrupts the folding of the upper 50 kDA subdomain. This disrupted folding could explain the very low levels of MyoVA protein observed in Myo5a^4ENURk mice.

A unique feature of the Myo5a mutations analyzed here is that they all are likely to encode proteins with residual wild-type function. Such alleles are more likely to identify important functional domains within a protein than are null alleles, which often represent large deletions or nonsense mutations within the protein coding sequence. This can easily be seen when one compares the MYO7A head region mutations, which in many cases are null alleles, with the Myo5a mutations analyzed here. While 6 of 13 MYO7A mutations truncate the protein in the head (WESTON et al. 1996 ), all 7 Myo5a mutations are missense mutations.

Another unique feature of the Myo5a mutations analyzed here is that they can be grouped into multiple different phenotypic classes and the nature and position of the mutation can thus be correlated with the mutant phenotype. In this regard, it is interesting to note that the Myo5a head region mutations are roughly equally distributed along the length of the MyoVA head and there is no obvious clustering of mutations with respect to phenotypic class. These results are consistent with a simple model whereby the severity of the mutation determines its ultimate phenotype: the least severe mutations being d^x and the most severe being dⁿ. It is interesting to speculate on why the coat color can be affected without an obvious neurological defect. Are the mechanisms for SER transport more robust than the relatively less crucial pigmentation of the hair? Is there redundancy present in the SER transport system? Perhaps the proposed long range delivery system (see INTRODUCTION) can partially, but not completely, suppress the loss of MyoVA functionality.

Another finding of these studies is that the severity of each mutation on head region function is difficult to predict from the mutational data alone. While protein expression levels did seem to mirror the phenotype in a few cases, i.e., the mutation with the lowest Myo5a expression levels was from the most severe dⁿ class of mutations, the correlation was not perfect. For example, only one of three d^x class mutations and one of three d^xn mutations had reduced protein levels. The other mutations in each class appeared to have normal protein levels. The crystallographic data were also not perfect predictors. For example, the Myo5a^1MNURe mutation, which is located within or near the actomyosin interface, would be predicted to have a profound effect on motor domain function, yet Myo5a^1MNURe is a mild d^x class mutation. Clearly, additional biochemical studies including in vitro motility assays (WOLENSKI et al. 1993 ), which are in progress, will be required to obtain a complete understanding of the effect of each mutation on MyoVA motor domain function.

	FOOTNOTES

¹ Present address: University of California, Rm. 401 Barker Hall, #3202 Berkeley CA 94720-3202.

	ACKNOWLEDGMENTS

We are grateful to DEBORAH A. SWING and MARILYN POWERS for their help with these studies. This research was supported by the following: The National Cancer Institute, Department of Health and Human Services, under contract with ABL (N.G.C. and N.A.J.); a basic research grant from the Muscular Dystrophy Association; National Institutes of Health grant DK-25387 (M.S.M.), American Cancer Society Postdoctoral fellowship PF-4316 to V.M.; and the Office of Health and Environmental Research, U.S. Department of Energy (under contract DE-AC05-96OR22464 with Lockheed Martin Energy Research Corp.) jointly with the National Institute of Environmental Health Sciences under Interagency Agreement No. 1-Y01-ES-50318-00 (L.B.R.).

Manuscript received September 19, 1997; Accepted for publication December 23, 1997.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ATKINSON, S. J., S. K. DOBERSTEIN, and T. D. POLLARD, 1992  Moving off the beaten tracks. Curr. Bio. 2:326-328.

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1997 Preparation and Analysis of DNA, pp. 2.9.1 in Current Protocols in Molecular Biology, edited by F. M. AUSUBEL, R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN, J. A. SMITH and K. STRUHL. John Wiley & Sons, New York.

AVRAHAM, K. B., T. HASSON, K. P. STEEL, D. M. KINGSLEY, and L. B. RUSSELL et al., 1995  The mouse Snell's waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nature Genet. 11:369-375[Medline].

CHENEY, R. E. K., M. K. O'SHEA, J. E. HEUSER, M. V. COELHO, and J. S. WOLENSKI et al., 1993  Brain myosin-V is a two-headed unconventional myosin with motor activity. Cell 75:13-23[Medline].

CHURCH, G. M. and W. GILBERT, 1984  Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995[Abstract/Free Full Text].

COPE, M. J. T., J. WHISSTOCK, I. RAYMENT, and J. KENDRICK-JONES, 1996  Conservation within the myosin motor domain: implications for structure and function. Structure 4:969-987[Medline].

DEKKER-OHNO, K., S. HAYASAKA, Y. TAKAGISHI, S. ODA, and N. WAKASUGI et al., 1996  Endoplasmic reticulum is missing in dendritic spines of purkinje cells of the ataxic mutant rat. Brain Res. 714:226-230[Medline].

EPSTEIN, N. D., G. M. COHN, F. CYRAN, and L. FANANAPAZIR, 1992  Differences in clinical expression of hypertrophic cardiomyopathy associated with two distinct mutations in the beta-myosin heavy chain gene. A 908Leu——Val mutation and a 403Arg——Gln mutation. Circulation 86:345-352[Abstract/Free Full Text].

ESPREAFICO, E. M., R. E. CHENEY, M. MATTEOLI, A. A. NASCIMENTO, and P. V. DE CAMILLI et al., 1992  Primary structure and cellular localization of chicken brain myosin-V (p190), an unconventional myosin with calmodulin light chains. J Cell Biol. 119:1541-1557[Abstract/Free Full Text].

EVANS, L. L., J. HAMMER, and P. C. BRIDGMAN, 1997  Subcellular localization of myosin V in nerve growth cones and outgrowth from dilute-lethal neurons. J. Cell Biol. 110:439-449.

FANANAPAZIR, L., M. C. DALAKAS, F. CYRAN, G. COHN, and N. D. EPSTEIN, 1993  Missense mutations in the beta-myosin heavy-chain gene cause central core disease in hypertrophic cardiomyopathy. Proc. Natl. Acad. Sci. USA 90:3993-3997[Abstract/Free Full Text].

FISHER, A. J., C. A. SMITH, J. B. THODEN, R. SMITH, and K. SUTOH et al., 1995  X-ray structures of the myosin motor domain of Dictyostelium discoideum complexed with MgADP.BeFx and MgADP.AlF4-. Biochemistry 34:8960-8972[Medline].

GIBSON, F., J. WALSH, P. MBURU, A. VARELA, and K. A. BROWN et al., 1995  A type VII myosin encoded by the mouse deafness gene shaker-1. Nature 374:62-64[Medline].

HASSON, T. and M. S. MOOSEKER, 1994  Porcine myosin-VI: characterization of a new mammalian unconventional myosin. J. Cell Biol. 127:425-440[Abstract/Free Full Text].

HUANG, J.-D., V. MERMALL, M. C. STROBEL, L. B. RUSSELL, and M. S. MOOSEKER et al., 1998  Molecular genetic dissection of mouse unconventional myosin-VA: Tail region mutation. Genetics 148:1963-1972[Abstract/Free Full Text].

LAEMMLI, U. K., 1970  Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].

LANGFORD, G. M., 1995  Actin- and microtubule-dependent organelle motors: interrelationships between the two motility systems. Curr. Opin. Cell Biol. 7:82-88[Medline].

LIU, X., J. WALSH, P. MBURU, J. KENDRICK-JONES, and M. J. T. V. COPE et al., 1997  Mutations in the myosin VIIA gene causing non-syndromic deafness. Nature Genet. 16:188-190[Medline].

MARKER, P.C., K. J. SEUNG, A. E. BLAND, L. B. RUSSELL, and D. M. KINGSLEY, 1997  Spectrum of Bmp5 mutations from germline mutagenesis experiments in mice. Genetics 145:435-443[Abstract].

MERCER, J. A., P. K. SEPERACK, M. C. STROBEL, N. G. COPELAND, and N. A. JENKINS, 1991  Novel myosin heavy chain encoded by murine dilute coat colour locus. Nature 349:709-713. (erratum: Nature 352:547).[Medline].

PROVANCE, D. W., JR., M. WEI, V. IPE, and J. A. MERCER, 1996  Cultured melanocytes from dilute mutant mice exhibit dendritic morphology and altered melanosome distribution. Proc. Natl. Acad. Sci. USA 93:14554-14558[Abstract/Free Full Text].

RAYMENT, I., H. M. HOLDEN, M. WHITTAKER, C. B. YOHN, and M. LORENZ et al., 1993a  Structure of the actin-myosin complex and its implications for muscle contraction. Science 261:58-65[Abstract/Free Full Text].

RAYMENT, I., W. R. RYPNIEWSKI, K. SCHMIDT-BASE, R. SMITH, and D. R. TOMCHICK et al., 1993b  Three-dimensional structure of myosin subfragment-1: a molecular motor. Science 261:50-58[Abstract/Free Full Text].

RAYMENT, I., H. M. HOLDEN, J. R. SELLERS, L. FANANAPAZIR, and N. D. EPSTEIN, 1995  Structural interpretation of the mutations in the beta-cardiac myosin that have been implicated in familial hypertrophic cardiomyopathy. Proc. Natl. Acad. Sci. USA 92:3864-3868[Abstract/Free Full Text].

RUSSELL, L.B., 1971  Definition of function units in a small chromosomal segment of the mouse and its use in interpreting the nature of radiation-induced mutations. Mutat. Res. 11:107-123[Medline].

RUSSELL, L. B. and W. L. RUSSELL, 1948  A study of the physiological genetics of coat color in the mouse by means of the dopa reaction in frozen sections of skin. Genetics 33:237-262[Free Full Text].

SEPERACK, P. K., J. A. MERCER, M. C. STROBEL, N. G. COPELAND, and N. A. JENKINS, 1995  Retroviral sequences located within an intron of the dilute gene alter dilute expression in a tissue-specific manner. EMBO J. 14:2326-2332[Medline].

SHIBUYA, T. and K. MORIMOTO, 1993  A review of the genotoxicity of 1-ethyl-1-nitrosourea. Mutat. Res. 297:3-38[Medline].

SMITH, C. A. and I. RAYMENT, 1995  X-ray structure of the magnesium(II)-pyrophosphate complex of the truncated head of Dictyostelium discoideum myosin to 2.7 A resolution. Biochemistry 34:8973-8981[Medline].

SMITH, C. A. and I. RAYMENT, 1996  X-ray structure of the magnesium(II).ADP.vanadate complex of the Dictyostelium discoideum myosin motor domain to 1.9 A resolution. Biochemistry 35:5404-5417[Medline].

STROBEL, M. C., P. K. SEPERACK, N. G. COPELAND, and N. A. JENKINS, 1990  Molecular analysis of two mouse dilute locus deletion mutations: spontaneous dilute lethal20J and radiation-induced dilute prenatal lethal Aa2 alleles. Mol. Cell. Biol. 10:501-509[Abstract/Free Full Text].

TAKAGISHI, Y., S. ODA, S. HAYASAKA, K. DEKKER-OHNO, and T. SHIKATA et al., 1996  The dilute-lethal (d^l) gene attacks a Ca2+ store in the dendritic spine of Purkinje cells in mice. Neurosci. Lett. 215:169-172[Medline].

TOWBIN, H., T. STAEHELIN, and J. GORDON, 1979  Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354[Abstract/Free Full Text].

VIKSTROM, K. L. and L. A. LEINWAND, 1996  Contractile protein mutations and heart disease. Curr. Opin. Cell. Biol. 8:97-105[Medline].

WEIL, D., S. BLANCHARD, J. KAPLAN, P. GUILFORD, and F. GIBSON et al., 1995  Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature 374:60-61[Medline].

WEIL, D., P. KUSSEL, S. BLANCHARD, G. LEVY, and F. LEVI-ACOBAS et al., 1997  The autosomal recessive isolated deafness, DFNB2, and the Usher 1B syndrome are allelic defects of the myosin-VIIA gene. Nature Genet. 16:191-193[Medline].

WESTON, M. D., P. M. KELLEY, L. D. OVERBECK, M. WAGENAAR, and D. J. ORTEN et al., 1996  Myosin VIIA Mutation Screening In 189 Usher Syndrome Type 1 Patients. Am. J. Hum. Genet. 59:1074-1083[Medline].

WOLENSKI, J. S., R. E. CHENEY, P. FORSCHER, and M. S. MOOSEKER, 1993  In vitro motilities of the unconventional myosins, brush border myosin-I, and chick brain myosin-V exhibit assay-dependent differences in velocity. J. Exp. Zool. 267:33-39[Medline].

WU, X. F., B. BOWERS, Q. WEI, B. KOCHER, and J. A. HAMMER, 1997  Myosin V associates with melanosomes in mouse melanocytes—evidence that myosin V is an organelle motor. J. Cell. Sci. 110:847-859[Abstract].

XIE, X., D. H. HARRISON, I. SCHLICHTING, R. M. SWEET, and V. N. KALABOKIS et al., 1994  Structure of the regulatory domain of scallop myosin at 2.8 A resolution. Nature 368:306-312[Medline].

This article has been cited by other articles:

				N. C. Geething and J. A. Spudich Identification of a Minimal Myosin Va Binding Site within an Intrinsically Unstructured Domain of Melanophilin J. Biol. Chem., July 20, 2007; 282(29): 21518 - 21528. [Abstract] [Full Text] [PDF]

				A. Varadi, T. Tsuboi, and G. A. Rutter Myosin Va Transports Dense Core Secretory Vesicles in Pancreatic MIN6 {beta}-Cells Mol. Biol. Cell, June 1, 2005; 16(6): 2670 - 2680. [Abstract] [Full Text] [PDF]

				R. T. Libby, C. Lillo, J. Kitamoto, D. S. Williams, and K. P. Steel Myosin Va is required for normal photoreceptor synaptic activity J. Cell Sci., September 1, 2004; 117(19): 4509 - 4515. [Abstract] [Full Text] [PDF]

				I. Nishimura, T. A. Drake, A. J. Lusis, K. M. Lyons, J. H. Nadeau, and J. Zernik ENU LARGE-SCALE MUTAGENESIS AND QUANTITATIVE TRAIT LINKAGE (QTL) ANALYSIS IN MICE: NOVEL TECHNOLOGIES FOR SEARCHING POLYGENETIC DETERMINANTS OF CRANIOFACIAL ABNORMALITIES Crit. Rev. Oral. Biol. Med., September 1, 2003; 14(5): 320 - 330. [Abstract] [Full Text] [PDF]

				R. J. Miltenberger, K. Wakamatsu, S. Ito, R. P. Woychik, L. B. Russell, and E. J. Michaud Molecular and Phenotypic Analysis of 25 Recessive, Homozygous-Viable Alleles at the Mouse agouti Locus Genetics, February 1, 2002; 160(2): 659 - 674. [Abstract] [Full Text] [PDF]

				J. M. Jones, J.-D. Huang, V. Mermall, B. A. Hamilton, M. S. Mooseker, A. Escayg, N. G. Copeland, N. A. Jenkins, and M. H. Meisler The mouse neurological mutant flailer expresses a novel hybrid gene derived by exon shuffling between Gnb5 and Myo5a Hum. Mol. Genet., March 22, 2000; 9(5): 821 - 828. [Abstract] [Full Text] [PDF]

				M. J. Justice, JaniceK. Noveroske, JohnS. Weber, B. Zheng, and A. Bradley Mouse ENU Mutagenesis Hum. Mol. Genet., September 1, 1999; 8(10): 1955 - 1963. [Abstract] [Full Text] [PDF]

				J.-D. Huang, V. Mermall, M. C. Strobel, L. B. Russell, M. S. Mooseker, N. G. Copeland, and N. A. Jenkins Molecular Genetic Dissection of Mouse Unconventional Myosin-VA: Tail Region Mutations Genetics, April 1, 1998; 148(4): 1963 - 1972. [Abstract] [Full Text] [PDF]

				S. J. Stachelek, T. F. Kowalik, A. P. Farwell, and J. L. Leonard Myosin V Plays an Essential Role in the Thyroid Hormone-dependent Endocytosis of Type II Iodothyronine 5'-Deiodinase J. Biol. Chem., October 6, 2000; 275(41): 31701 - 31707. [Abstract] [Full Text] [PDF]

E. M. Rinchik, D. A. Carpen