- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by de La Roche Saint André, C.
- Articles by Bregliano, J.-C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by de La Roche Saint André, C.
- Articles by Bregliano, J.-C.
Evidence for a Multistep Control in Transposition of I Factor in Drosophila melanogaster
Christophe de La Roche Saint Andréa and Jean-Claude Breglianoaa Institut de Biologie du Développement de Marseille, 13288 Marseille Cedex 9, France
Corresponding author: Christophe de La Roche Saint André, Institut de Biologie du Développement de Marseille, Marseille-Luminy, Case 907, 13288 Marseille Cedex 9, France, laroche{at}ibdm.univ-mrs.fr (E-mail).
Communicating editor: R. S. HAWLEY
| ABSTRACT |
|---|
Drosophila melanogaster strains belong to one of two interactive categories, inducer (I) or reactive (R), with respect to the I-R system of hybrid dysgenesis. The dysgenic interaction results from the presence of several transposition-competent copies of a LINE-like element, the I factor, only in the genome of I strains. When a cross is performed between I males and R females, I factor transposes at high frequency in the germ line of F1 daughters, known as SF females. This transposition burst results in the sterility of SF females. I factor transposes by reverse transcription of a full-length transcript. Specific RT-PCR experiments were done to compare the amount of I factor transcript in samples corresponding to various transposition frequencies. The sensitivity of the method allowed the ready detection of the I factor RNA in every tissue and genetic background examined. Comparison of amplification signals suggests that I factor activity in ovaries is regulated at different levels. First, the amount of I factor RNA subjected to negative and positive regulation. Whereas the negative control, which limits transposition in nonpermissive contexts, may be exerted by an I factor encoded repressor function, the positive control is linked to reactivity level, a cellular state maternally inherited from R mothers. Additionally, negative regulation is also exerted downstream of I factor RNA. This differs notably from previous conclusions in which transcription was envisaged as the main level of regulation of the I factor transposition.
I-R hybrid dysgenesis was described in the early 1970s (![]()
![]()
![]()
I factor, a non-LTR retrotransposon similar to mammalian LINEs, was shown to be responsible for the I-R hybrid dysgenesis phenomenon (![]()
![]()
![]()
![]()
The term "chromosomal contamination" was used to describe the acquisition of active I factors by chromosomes of reactive origin. The efficiency of contamination was used as an estimation of I factor transposition. Using this criterion, it was shown that: (1) while being stable in the inducer context, the I factor transposes at high frequency in the germ line of SF females and to a lesser degree in the germ line of RSF females (![]()
![]()
![]()
![]()
The severity of SF sterility in a dysgenic cross may vary within a wide range, depending on the reactive parental stock used in the cross (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Transposition of the I factor has been shown to require an RNA intermediate ( ![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Drosophila stocks and culture conditions:
The following strains were employed: est 28 and Cha are strong reactive lines; Paris is a reactive stock (this stock was weakly reactive for years and then became a mix of weak and strong reactive flies); P1m and PF9b are sublines, weakly and strongly reactive, respectively, derived from this stock; Canton-S is a standard inducer stock; Cha-(RC +) is an inducer stock, resulting from transposition of I factors from the genome of an inducer stock to the chromosomes of the Cha reactive strain.
Measurement of sterility level:
Young daughters from each cross were put on fresh food with sib males and allowed to lay eggs during 24 hr. Then they were discarded, and 2 days later the percentage of nonhatching eggs was scored. In the case where flies are SF females, i.e., daughters of reactive females mated with standard inducer males, the percentage of nonhatching eggs measures the reactivity level of the reactive mothers.
RNA extractions:
Ovaries were dissected 4 days after eclosion (except when specified) and stored at -80°, as well as the corresponding male and female carcasses. Total RNA was prepared by a phenol/guanidinium isothiocyanate procedure using TRIzol Reagent (GIBCO-BRL, Grand Island, NY ), according to the manufacturer's instructions. Two hundred fifty µl TRIzol was used for 20 ovaries and 500 µl TRIzol was used for 20 male or 20 female carcasses. After ethanol precipitation, RNA were resolubilized in water. RNA quantity and quality were estimated by UV absorption at OD260 nm and by visual inspection after migration on agarose gel and EtBr staining.
Poly(A)+ purification:
Poly(A)+ RNA was isolated from total RNA preparations using the Dynabeads mRNA purification kit (Dynal). Ten µg total RNA was mixed with 50 µl Dynabeads Oligo(dT)25 for the first round of purification, and half of the eluted RNA was mixed with 50 µl Dynabeads Oligo(dT)25 for the second round of purification.
Reverse transcription and cDNA amplification:
Random-primed cDNA was prepared from 5 µg total RNA using the Stratascript kit (Stratagene, La Jolla, CA) in a final volume of 50 µl. Amplification was carried out in a final volume of 30 µl in the presence of 1 µl of the reverse-transcribed RNAs, 30 µM dNTPs, 3 mM MgCl2, 0.2 µM primers, and 1 unit Taq polymerase (Eurobio, Les Ulis, France). Samples were subjected (except when specified) to 30 cycles PCR in a Crocodile III thermal cycler (Appligene, Illkirch, France). For I cDNA 5' fragments amplification, each cycle included (except when specified) 30 sec denaturation at 92°, 15 sec annealing at 68°, and 30 sec elongation at 72°. After amplification, 10 µl aliquots were analyzed by agarose gel electrophoresis and BET staining. The sequences of the primers used were: AGA GATAAGTCGTGCCTCTC 22/41-GTACTCGGACTGTTTCG TAC 721/702 (I factor 5' part); CCGACCCATCTCCCTCAACT 3059/3078-TCGCAAGGTCGGCTTTAAGG 4812/4793 (I factor 3' part); AGTCGCCTACAATGGTCTGC 39/58-GTTCGAATC GTTGCTAACGG 1119/1100 (glucose-6-phosphate dehydrogenase); ATGTCAAAGGGGGGCGAGCACAAGCGCGTC 1391/1420-CAACTGTGGCGCACTGGA 2046/2029 (yem-alpha). Positions refer to the sequences reported by ![]()
![]()
![]()
| RESULTS |
|---|
Designing PCR primers specific for active I factors:
Using the RT-PCR method, we aimed at amplification of cDNA fragments specific for the full-length I factor transcript, i.e., the potential intermediate of transposition (![]()
![]()
![]()
![]()
Transcription of the I factor initiates from an internal RNA polymerase II promoter, located at the 5' end (![]()
![]()
|
The pericentromeric defective elements are transcribed in all categories of flies (![]()
![]()
![]()
Specific amplification of active I factors cDNAs fragments:
RNAs prepared from various reactive and inducer strains were reverse transcribed and amplified. As expected, the discrimination between active and defective elements is not absolute and relies greatly on the annealing temperature. At low temperatures (below 60°), in addition to the expected amplification product, various RsaI-resistant fragments are amplified in all cDNAs tested, which likely correspond to defective I elements (not shown). Increase of annealing temperature (above 65°) allows the specific amplification of the RsaI-sensitive product only in cDNA samples corresponding to inducer flies (Figure 1B). Therefore, such a product corresponds to active I factor sequences.
Because no direct distinction could be made between amplified products corresponding to genomic or complementary I DNA sequences, we have checked for the absence of contribution of contaminating genomic DNA to the observed signals. Two types of controls were made (Figure 1C). First, the amplification was conducted on control cDNA reactions in which reverse transcriptase was omitted. The absence of signal (Figure 1C, left) showed that amplification was dependent on the reverse transcription step. Second, the same samples were amplified with primers located on both sides of an intron of the glucose-6-phosphate dehydrogenase (G6PD) gene (Figure 1C, right). The size of the amplified product was the one expected for a cDNA relieved of the intron. Therefore, the amplification products obtained with our I factor-specific primers correspond to cDNAs.
Amount of I factor RNA and transposition frequency:
All possible combinations of crosses were carried out with reactive est28 and inducer Canton-S flies. Crossing of est28 females with Canton-S males produced SF flies, and the reciprocal est28/Canton-S cross gave RSF flies. The nonhatching percentage of the eggs laid by the 3-day-old SF and RSF females was 98 and 2%, respectively. Canton-S x Canton-S and est28 x est28 crosses gave the corresponding inducer and reactive flies. In each case, total RNAs were isolated from young female and male adult progeny. After reverse transcription, the 5' part of I factors cDNAs was specifically amplified (Figure 2A), as demonstrated by the absence of signal with est28 cDNAs. The amount of product amplified with SF or RSF ovary cDNAs was similar and slightly less than with Canton-S ovary cDNAs. Comparable results were obtained following independent RT reactions. G6PD served as a control to confirm equal efficiency of reverse transcription of each of the RNAs. This result was surprising, because it contradicts previous studies (![]()
|
We have tested our RT-PCR reactions for a possible saturation, which could impede any real quantitative comparison. First, SF and RSF signals were compared after different numbers of amplification cycles (Figure 2B). The amount of PCR product increases regularly with the cycle number in a similar fashion for the SF and the RSF samples. Second, RNAs from SF flies were diluted in those of est28 flies, which are devoid of I factor transcript, to obtain qualitatively equivalent RNA samples containing decreasing amounts of I factor RNA. A decrease of the signal is observed from the first dilution (Figure 2C). Moreover, the regular decrease of the signal strength along the dilution range attests to the reliability of the RT step. Third, reducing fourfold the amount of RNA for reverse transcription diminishes the signal strength similarly for the SF and RSF samples (not shown). Therefore, neither the reverse transcription nor the amplification step appear to be saturated in our experimental RT-PCR conditions.
According to the reconstruction experiment (Figure 2C), the amount of I factor RNA present in Canton-S ovaries is about twofold that of the RSF sample. A small difference was observed between the SF and RSF samples in independent RT experiments, the SF signal being slightly more intense than the RSF one. However, this difference was not clearly above the background variation inherent to our experimental conditions (not shown). In addition, quantitative discrimination of a factor of two was effective (Figure 2C) and reproducible. From these observations, we conclude that the difference in the amount of I factor RNA between SF and RSF samples is certainly less than twofold, i.e., far from the difference previously described (![]()
The variation in signals obtained with the carcasses or male cDNA samples reproduced those seen with the ovary cDNA samples (Figure 2A). Although any direct comparison between samples belonging to different categories, i.e., ovaries, carcasses, and males has no significance, this is also in contradiction to previous results (![]()
![]()
Effect of varying methodological parameters:
The fact that our results are clearly different from those presented earlier (![]()
![]()
![]()
|
Another difference was the nature of RNA samples used. We amplified cDNAs prepared with total RNA, while poly(A)+ was used in Northern blot hybridization and S1 mapping experiments (![]()
![]()
Effect of the genetic background on I factor RNA level:
The last experimental difference between our work and previous work (![]()
![]()
![]()
|
The sterility level of SF females decreases as they get older (![]()
![]()
Ratio of amount of I factor RNA present in SF and RSF ovaries is correlated with the kinetics of SF sterility decline:
The differences observed between the est28/Canton-S and the Cha/Cha-(RC +) crosses underline the significance of the genetic background. In fact, neither the reactive nor the inducer strains are the same in the two crosses. To decipher which parameter is the determinant for the amount of I factor RNA, we made additional crosses involving the same strains but in different combination. Ovary RNA from the SF and RSF progeny of the four alternative crosses was compared (Figure 5A). Different observations can be made. First, the average amount of I factor RNA detected in the ovaries of progeny flies depends on I strain used in the cross, with more RNA detected when Cha-(RC +) is used as the inducer strain. Second, it is only when the parental inducer strain is Cha-(RC +) that a clear increase in the amount of I factor RNA in the SF samples can be seen relative to RSF. The magnitude of this increase depends on the reactive strain, around fivefold with Cha or two- to threefold with est28, as estimated by reconstruction experiments (see above).
|
Despite their similar sterility (98100%) when they are young, the evolution of the sterility with aging differs significantly between the different SF flies (Figure 5B). While decreasing quickly when the est28/Canton-S or the Cha/Canton-S SF females get older, the sterility of Cha/Cha-(RC +) SF females begins to decline only after 15 days. The kinetics of the decrease in sterility is intermediate in the case of the est28/Cha-(RC +) SF flies. Thus, the amplitude of SF/RSF ratio in the amount of I factor RNA is correlated to the kinetics of SF sterility decline.
Influence of the reactivity level:
The difference between Cha/Cha-(RC +) and est28/Cha-(RC +) SF flies can be attributed to the reactive strain. To test if reactivity level is the primary cause, comparisons were made in a more isogenic context. Two sublines of the same reactive Paris stock called P1m and PF9b, weakly and strongly reactive, respectively, were used for dysgenic crosses. This provides females with very different reactivity levels in a very close genetic background. Inducer males were from the Cha-(RC +) stock. The nonhatching percentages of the eggs laid by the P1m/Cha-(RC +) and the PF9b/Cha-(RC +) SF females were 3 and 100%, respectively. The evolution of sterility of PF9b/Cha-(RC +) SF females with aging is similar to that of Cha/Cha-(RC +) SF females, which is indicative of a very strong I-R interaction (not shown). RNAs extracted from the SF flies, and the corresponding RSF flies, were compared by RT-PCR (Figure 6A). Equivalent amplification signals were obtained with all the ovary samples, except for the PF9b/Cha-(RC +) SF sample, whose signal was much stronger. This difference is ovary-specific, i.e., not seen in the carcass samples, and is associated with a great difference in reactivity levels of the P1m and PF9b mothers. The amount of I factor RNA detected in ovaries of 60-day-old PF9b/Cha-(RC +) SF females is similar to that of young or old P1m/Cha-(RC +) SF flies (Figure 6B). Thus, as in the case of the Cha/Cha-(RC +) cross, the amount of I factor RNA follows the decline of sterility observed in PF9b/Cha-(RC +) SF flies.
|
When a strong reactive stock is bred with short generations, i.e., each generation being recovered from young mothers, the reactivity level remains high. In contrast, if the same stock is bred with long generations (old mothers), reactivity progressively decreases and reaches a low value, which is stable as long as the long generation pattern is maintained (![]()
| DISCUSSION |
|---|
Different levels of control in the regulation of I factor transposition:
Using specific RT-PCR conditions, we have compared different RNAs prepared from biological material differing in the frequency of I factor transposition. I factor RNA was readily detectable in every biological sample analyzed. These include those, like carcasses and males, where no RNA was detected before (![]()
Comparison of our data with published results:
The reasons for the discrepancies between the results of ![]()
Other studies used transgenic flies transformed with constructs containing a reporter gene fused to various 5' parts of the I factor sequence (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Regulation in ovary: a complex blend of mechanisms:
In the ovary tissue, the amount of I factor RNA correlates, to a certain extent, with the transposition frequency. Because no variation is detected in the corresponding carcass and male samples, this mode of regulation appears very likely to be germline specific. Depending on the samples chosen for comparison, several independent regulation levels are evidenced.
First, in all crosses examined, the signal detected in SF is always superior to that seen in RSF, albeit with a variable magnitude. This indicates a negative regulation of the amount of I factor RNA amount in RSF that must be related to additional information present in oocytes of inducer origin. Such a regulation is very likely achieved through the action of an I factor encoded repressor. The ORF1 product could have such an activity as previously proposed (![]()
![]()
Second, the difference in the amount of RNA detected in samples according to the inducer origin, i.e., Canton-S or Cha-(RC +), is probably related to a difference in I factor copy number and/or transcriptional activity of individual copies present in the two inducer strains. Accordingly, the amount of I factor RNA is greater in RSF issued from Cha-(RC +), where transposition frequency is low, than in SF issued from Canton-S, where transposition frequency is high (Figure 5A). This demonstrates that the absolute amount of I factor RNA does not reflect the transposition frequency, and indicates the existence of a negative regulation downstream of I factor RNA.
Third, when one concentrates on the SF and RSF ovary signals, a correlation appears between the magnitude of the SF:RSF ratio in the amount of I factor RNA and the corresponding kinetics of SF sterility decline (Figure 5A and Figure B). The higher this ratio, the slower the decrease in sterility. Therefore, this ratio could be viewed as a measure of the strength of the I-R interaction.
Fourth, a positive influence of the reactivity level on the amount of I factor RNA is demonstrable (Figure 6A). Moreover, the cumulative effect of aging, which affects similarly the reactivity level and the amount of I factor RNA (Figure 6C), indicates that it is the maternally inherited component of reactivity, which is involved in this control.
Finally, considering the effect of aging, the decrease in the amount of I factor RNA follows the decrease of transposition frequency (Figure 4C and Figure 6C). Strikingly, the signals obtained with old SF flies issued from highly reactive mothers are similar to those of young RSF flies (Figure 4C) or young SF flies issued from low reactive mothers (Figure 6C). The existence of a basal level of expression, perhaps not influenced by any negative regulation, can be invoked.
Is there any regulation in nonovarian tissues?
The detection of I factor RNA in carcasses does not support the notion of a transcriptional restriction in somatic cells (![]()
![]()
![]()
Differential effect of reactivity and I factor encoded repressor:
Recently, it was shown that the reactivity levels might be one manifestation of an inducible repair- recombination system, whose biological role might be comparable to that of the SOS response in bacteria (![]()
![]()
![]()
![]()
![]()
![]()
|
As with previous models (![]()
| ACKNOWLEDGMENTS |
|---|
We thank FRANCOISE GAY for excellent technical assistance, ANNE LAURENCON for her contribution in the settling of the different Paris sublines, MARIA BALAKIREVA for providing the 3' I factor primer sequences and OUNISSA AÏT-AHMED for the gift of the yem-alpha primers. OUNISSA AÏT-AHMED, NATHALIE DOSTATNI and SACHA KALLENBACH are greatly acknowledged for their careful reading of the manuscript. This work was supported by the Centre National de la Recherche Scientifique, the Université de la Méditerranée and the Ministère de la Recherche, de l'Enseignement et de la Technologie.
Manuscript received August 18, 1997; Accepted for publication December 22, 1997.
| LITERATURE CITED |
|---|
AÏT-AHMED, O., M. THOMAS-CAVALLIN, C. JOBLET, and M. CAPRI, 1990 Expression in the central nervous system of a subset of the yema maternally acting genes during Drosophila embryogenesis. Post-embryonic expression extends to imaginal discs and spermatocytes. Cell Differ. Dev. 31:53-65[Medline].
AÏT-AHMED, O., B. BELLON, M. CAPRI, C. JOBLET, and M. THOMAS-DELAAGE, 1992 The yemanuclein-
: a new Drosophila DNA binding protein specific for the oocyte nucleus. Mech. Dev. 37:69-80[Medline].
BREGLIANO, J.-C., A. LAURENÇON, and F. DEGROOTE, 1995 Evidence for an inducible repair-recombination system in the female germ line of Drosophila melanogaster: I. Induction by inhibitors of nucleotide synthesis and by gamma rays. Genetics 141:571-578[Abstract].
BUCHETON, A., 1979 Non-Mendelian female sterility in Drosophila melanogaster. Influence of ageing and thermic treatments. III. Cumulative effects induced by these factors. Genetics 93:131-142
BUCHETON, A. and J.-C. BREGLIANO, 1982 The I-R system of hybrid dysgenesis in Drosophila melanogaster: heredity of the reactive condition. Biol. Cell 46:123-132.
BUCHETON, A. and G. PICARD, 1978 Non-Mendelian female sterility in Drosophila melanogaster: hereditary transmission of reactivity level. Heredity 40:207-223.
BUCHETON, A., G. LAVIGE, G. PICARD, and P. L'HERITIER, 1976 Non-mendelian female sterility in Drosophila melanogaster: quantitative variation in the efficiency of inducer and reactive strains. Heredity 36:205-314[Medline].
BUCHETON, A., R. PARO, H. M. SANG, A. PELISSON, and D. J. FINNEGAN, 1984 The molecular basis of I-R hybrid dysgenesis in Drosophila melanogaster: identification, cloning and properties of the I factor. Cell 38:153-163[Medline].
BUSSEAU, I., A. PELISSON, and A. BUCHETON, 1989 Characterization of 5' truncated copies of the I factor in Drosophila melanogaster.. Nucleic Acids Res. 17:6939-6945
BUSSEAU, I., M. C. CHABOISSIER, A. PELISSON, and A. BUCHETON, 1994 I factors in Drosophila melanogaster : transposition under control. Genetica 93:101-116[Medline].
CHABOISSIER, M. C., I. BUSSEAU, J. PROSSER, D. J. FINNEGAN, and A. BUCHETON, 1990 Identification of a potential RNA intermediate for transposition of the LINE-like element I factor in Drosophila melanogaster.. EMBO J. 9:3557-3563[Medline].
CROZATIER, M., C. VAURY, I. BUSSEAU, A. PELISSON, and A. BUCHETON, 1988 Structure and genomic organization of I elements involved in I-R hybrid dysgenesis in Drosophila melanogaster.. Nucleic Acids Res. 16:9199-9213
FAWCETT, D. H., C. K. LISTE, E. KELLET, and D. J. FINNEGAN, 1986 Transposable elements controlling I-R hybrid dysgenesis in Drosophila melanogaster are similar to mammalian LINEs. Cell 47:1007-1015[Medline].
FOUTS, D., R. GANGULY, A. G. GUTIERREZ, J. C. LUCCHESI, and J. E. MANNING, 1988 Nucleotide sequence of the Drosophila glucose-6-phosphate dehydrogenase gene and comparison with the homologous human gene. Gene 63:261-275[Medline].
JENSEN, S. and T. HEIDMANN, 1991 An indicator gene for detection of germline retrotransposition in transgenic Drosophila demonstrates RNA-mediated transposition of the LINE I elements. EMBO J. 10:1927-1937[Medline].
JENSEN, S., L. CAVAREC, M. P. GASSAMA, and T. HEIDMANN, 1995 Defective I elements introduced into Drosophila as transgenes can regulate reactivity and prevent I-R hybrid dysgenesis. Mol. Gen. Genet. 248:381-390[Medline].
LACHAUME, P. and H. PINON, 1993 Germ line expression of the I factor, a functional LINE from the fruit fly Drosophila melanogaster, is positively regulated by reactivity, a peculiar cellular state. Mol. Gen. Genet. 240:277-285[Medline].
LACHAUME, P., K. BOUHIDEL, M. MESURE, and H. PINON, 1992 Spatial and temporal expression of the I factor during oogenesis in Drosophila melanogaster.. Development 115:729-735[Abstract].
LAURENÇON, A. and J.-C. BREGLIANO, 1995 Evidence for an inducible repair-recombination system in the female germ line of Drosophila melanogaster: II. Differential sensitivity to gamma rays. Genetics 141:579-585[Abstract].
LAURENÇON, A., F. GAY, J. DUCAU, and J.-C. BREGLIANO, 1997 Evidence for an inducible repair-recombination system in the female germ line of Drosophila melanogaster : III. Correlation between reactivity levels, crossovers frequency and repair efficiency. Genetics 146:1333-1344[Abstract].
LAVIGE, J. M., 1986 I-R system of hybrid dysgenesis in Drosophila melanogaster: further data on the arrest of development of the embryos from SF females. Biol. Cell 56:207-216.
MCLEAN, C., A. BUCHETON, and D. J. FINNEGAN, 1993 The 5' untranslated region of the I factor, a long interspersed nuclear element-like retrotransposon of Drosophila melanogaster, contains an internal promoter and sequences that regulate expression. Mol. Cell. Biol. 13:1042-1050
PELISSON, A. and J.-C. BREGLIANO, 1987 Evidence for rapid limitation of the I element copy number in a genome submitted to several generations of I-R hybrid dysgenesis in Drosophila melanogaster.. Mol. Gen. Genet. 207:306-313.
PELISSON, A., D. J. FINNEGAN, and A. BUCHETON, 1991 Evidence for the retrotransposition of the I factor, a LINE element of Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 88:4907-4910
PICARD, G., 1971 Un cas de stérilité femelle chez Drosophila melanogaster lié à un agent transmis maternellement. C.R. Acad. Sci. Paris 272:2482-2487.
PICARD, G., 1976 Non-Mendelian female sterility in Drosophila melanogaster: heredity and transmission of I factor. Genetics 83:107-123
PICARD, G., 1978 Non-Mendelian female sterility in Drosophila melanogaster, further data on chromosomal contamination. Mol. Gen. Genet. 164:235-247.
PICARD, G. and P. L'HERITIER, 1971 A maternally inherited factor inducing sterility in Drosophila melanogaster.. Dros. Inf. Serv. 46:54.
PICARD, G., J.-C. BREGLIANO, A. BUCHETON, J. M. LAVIGE, and A. PELISSON et al., 1978 Non-Mendelian female sterility and hybrid dysgenesis in Drosophila melanogaster.. Genet. Res. 32:275-287[Medline].
PROUST, J. and C. PRUDHOMMEAU, 1982 Hybrid dysgenesis in Drosophila melanogaster. I. Further evidence for and characterization of the mutator effect of the inducer-reactive interaction. Mutat. Res. 95:225-235[Medline].
PROUST, J., C. PRUDHOMMEAU, V. LADEVEZE, M. GOTTELAND, and M. C. FONTYNE-BLANCHARD, 1992 I-R hybrid dysgenesis in Drosophila melanogaster: use of in situ hybridization to show the association of I factor DNA with induced sex-linked recessive lethals. Mutat. Res. 268:265-285[Medline].
UDOMKIT, A., S. FORBES, C. MCLEAN, I. ARKHIPOVA, and D. J. FINNEGAN, 1996 Control of expression of the I factor, a LINE-like transposable element in Drosophila melanogaster.. EMBO J. 15:3174-3181[Medline].
VAURY, C., P. ABAD, A. PELISSON, A. LENOIR, and A. BUCHETON, 1990 Molecular characteristics of the heterochromatic I elements from a reactive strain of Drosophila melanogaster.. J. Mol. Evol. 31:424-431[Medline].
This article has been cited by other articles:
![]() |
J. F. Morales, E. T. Snow, and J. P. Murnane Environmental factors affecting transcription of the human L1 retrotransposon. II. Stressors Mutagenesis, March 1, 2003; 18(2): 151 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chambeyron, A. Bucheton, and I. Busseau Tandem UAA Repeats at the 3'-End of the Transcript Are Essential for the Precise Initiation of Reverse Transcription of the I Factor in Drosophila melanogaster J. Biol. Chem., May 10, 2002; 277(20): 17877 - 17882. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Morales, E. T. Snow, and J. P. Murnane Environmental factors affecting transcription of the human L1 retrotransposon. I. Steroid hormone-like agents Mutagenesis, May 1, 2002; 17(3): 193 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gauthier, C. Tatout, and H. Pinon Artificial and Epigenetic Regulation of the I Factor, a Nonviral Retrotransposon of Drosophila melanogaster Genetics, December 1, 2000; 156(4): 1867 - 1878. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by de La Roche Saint André, C.
- Articles by Bregliano, J.-C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by de La Roche Saint André, C.
- Articles by Bregliano, J.-C.








