Genetics, Vol. 148, 1813-1820, April 1998, Copyright © 1998

The fluffy Gene of Neurospora crassa Encodes a Gal4p-Type C6 Zinc Cluster Protein Required for Conidial Development

Lori A. Baileya and Daniel J. Ebbolea
a Program for the Biology of Filamentous Fungi, Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas 77843-2132

Corresponding author: Daniel J. Ebbole, Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843-2132, dje0282{at}zeus.tamu.edu (E-mail).

Communicating editor: J. J. LOROS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Neurospora crassa fluffy (fl ) mutants are unable to produce macroconidia. We cloned the fl gene to determine its role in regulating conidiation. A cosmid clone containing fl was identified by complementation. The sequence of fl revealed that it encodes a Gal4p-type C6 zinc cluster protein with greatest similarity to the N. crassa NIT4 protein that regulates genes required for nitrate utilization. Analysis of several fl mutant alleles demonstrated that null mutants are blocked in the budding phase of development required to produce conidiophores. fl mRNA is transiently induced just prior to the developmental commitment to budding growth. This timing of fl expression is consistent with a role for FL protein in activation of the previously characterized conidiation-specific (con) genes, con-6 and con-10. These data suggest that FL acts as a developmentally regulated transcription factor required for conidiophore morphogenesis.


CONIDIA are the major means of dispersal for many fungi. Macroconidiation (hereafter, conidiation) in Neurospora crassa can be induced by exposure of the mycelium to air or by starvation of a submerged mycelium in a liquid medium lacking sufficient carbon or nitrogen (TURIAN and BIANCHI 1972 Down). Aerial hyphae grow by apical elongation from the mycelium within 2 hr after exposure to air. Approximately 4 hr after induction, they switch to a budding mode of growth. The transition to budding growth is characterized by the formation of minor constriction chains, which are short proconidial chains with interconidial diameters nearly as large as the diameter of the proconidia themselves. As the chain continues budding, the constrictions become more pronounced. This major constriction chain growth is first observed about 8 hr after induction (Figure 1A) (SPRINGER and YANOFSKY 1989 Down). A double crosswall is laid down between proconidia at about 12 hr. Several hours later, the crosswalls between adjacent conidia are cleaved but the conidia are held together by a thread of material until they are dispersed by wind currents (SPRINGER and YANOFSKY 1989 Down).




View larger version (150K):
In this window
In a new window
Download PPT slide
 
Figure 1. —Mapping of fluffy. (A) Scanning electron micrographs of wild-type (wt) and fluffy (fl ) mutant strains. The arrow indicates a major constriction in a budding proconidial chain. Mycelial pads were harvested and exposed to air for 12 hr to induce conidiation. Scale bars = 10 µm. Micrographs courtesy of Drs. Matthew Springer and Charles Yanofsky. This phenotype was used to score progeny. (B) Genetic map of the right arm of chromosome II showing recombination distances between fl, mus-23, and trp-3. (C) RFLP mapping data using DNA from cosmid X24:A11 as a probe to detect an RFLP in 38 progeny from the cross of Oak Ridge (O) and Mauriceville (M) parents. The RFLP pattern is compared to the reported RFLP patterns for several markers in the fl region of chromosome II. The dash (—) indicates progeny not scored.

Physiological and biochemical changes associated with conidiation have been analyzed (TURIAN and BIANCHI 1972 Down; WEISS and TURIAN 1966 Down). However, relatively few genetic loci have been found that specifically block conidiation. In 1933, CARL LINDEGREN was the first to identify one of these loci in a study demonstrating that phenotypes could be inherited in a Mendelian fashion in N. crassa (LINDEGREN 1933 Down). He described this strain as having "white aerial growth and no conidia production" (Figure 1). The single gene responsible for this trait was named fluffy (fl ). Since then, seven alleles of fl have been identified and five additional loci that specifically block conidiation have been described (WILSON 1985 Down). Fluffyoid (fld ) and aconidiate-2 (acon-2) do not produce minor constriction chains and are blocked early in development (MATSUYAMA et al. 1974 Down; SPRINGER and YANOFSKY 1989 Down). aconidiate-3 (acon-3), like fl, produces minor, but not major, constriction chains (MATSUYAMA et al. 1974 Down). Two conidial separation (csp-1 and csp-2) mutants form major constriction chains with double crosswalls but these never separate to release free conidia (SELITRENNIKOFF et al. 1974 Down). Characterization of these mutants is important to our goal of understanding the molecular genetics of conidiation.

Here we report the cloning and characterization of N. crassa fl. fl encodes a protein that resembles C6 zinc cluster transcription factors of the Gal4p class. Several aconidial mutants carry null alleles, while a less severe mutant has an allele that contains two codon changes that specify conservative amino acid substitutions. fl is transiently expressed during conidiation and is most abundant at the time of major constriction chain formation.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and plasmids:
Unless otherwise noted, strains were obtained from the Fungal Genetics Stock Center (FGSC), Department of Microbiology, University of K ansas Medical Center. The mutagen sensitive-23 (mus-23) mutant strain was provided by DR. H. INOUE (Saitama University, Japan).

To construct pFL1, a 4.6-kilobase pair (kbp) ApaI-Not I fragment containing fl was subcloned into pBluescript SK- (Stratagene, La Jolla, CA) from cosmid X24:A11 of the ORBACH/SACHS library (ORBACH and SACHS 1991 Down). The same 4.6-kb fragment was also subcloned into pCB1004 (CARROLL et al. 1994 Down), which contains chloramphenicol and hygromycin resistance markers. We designated this plasmid pFL2, and it was used in the complementation experiments.

Strain 74 -ORS6a (FGSC #4200) was transformed with pFL2 and a purified hygromycin resistant transformant was crossed with strain 74 -OR23-1VA (FGSC #2489) in order to perform repeat-induced point (RIP) mutagenesis (SELKER 1990 Down; SELKER and GARRETT 1988 Down). One of the hygromycin sensitive progeny that had the fl phenotype was then backcrossed to 74 -OR23-1VA to obtain a strain (LBS1) carrying the flRIP allele.

Complementation of mus-23:
Protoplasts of the mus-23 strain were transformed with 25 cosmid pools from the ORBACH/SACHS cosmid library (ORBACH and SACHS 1991 Down), according to the procedure described by VOLLMER and YANOFSKY 1986 Down. Selection for complementation was obtained by resuspending the tranformed protoplasts in 50 ml regeneration agar containing 0.025 µl/ml methyl methane sulfonate (MMS). The resuspended protoplasts were then aliquoted to five Petri dishes and the agar was allowed to solidify. Agar (20 ml) containing 2% sorbose, 0.05% fructose, 0.05% glucose, and 0.10 µl/ml MMS was then poured onto the solidified regeneration agar containing the transformed protoplasts. Transformants complemented by the mus-23 gene are able to grow to the surface under these conditions.

Nucleic acid extraction and analysis:
Genomic DNA was isolated as described previously (VOLLMER and YANOFSKY 1986 Down). Southern blot analyses (SAMBROOK et al. 1989 Down) were performed using nylon membranes (Bio-Rad, Richmond, CA). To map cosmid X24:A11 by restriction fragment length polymorphism (RFLP) analysis, we used a standard set of progeny from a cross between a Mauriceville strain and an Oak Ridge strain (METZENBERG and GROTELUESCHEN 1995 Down). BamHI-digested chromosomal DNA generated RFLPs in the parental strains. We used ApaI and NotI fragments from both ends of the cosmid X24:A11 insert to probe a blot of BamHI-digested progeny DNA. The combined fragments were labeled with {alpha}-[32P]dCTP by random primed labeling (SAMBROOK et al. 1989 Down).

RNA extraction and Northern blot analyses were performed as previously described (MADI et al. 1994 Down). A 2.1-kb BamHI fragment located within the coding region of the fl gene was used as the probe in these experiments. M. PLAMANN (University of Missouri, K ansas City) provided the cDNA clone of N. crassa actin. Probes for con-6 and con-10 were prepared from cDNA clones from plasmids pCON6-6 and pBW100, respectively (MADI et al. 1994 Down).

DNA sequence analysis:
The nucleotide sequence of fl has been deposited in the GenBank sequence database under accession #AF022648. The amino acid sequence of FL was used to search databases using the BLAST search algorithm (ATSCHUL et al. 1990 Down). Individual alignments with high-scoring matches were performed using the BESTFIT program (DEVEREUX et al. 1984 Down). The polymerase chain reaction (PCR) was used to amplify a 2.45-kb fragment (corresponding to nucleotides 1-2450) (Figure 2) from flL, flP, flP961, and flRIP for direct sequence analysis. A 3.3-kb PCR fragment of the flY allele was used for direct sequencing. A second PCR amplification of the regions containing the putative mutations was performed using chromosomal DNA, and the products were sequenced to verify the mutations in each of these alleles.



View larger version (71K):
In this window
In a new window
Download PPT slide
 
Figure 2. —Nucleotide sequence of fl. The fl gene encodes a 792 amino acid polypeptide. The coding region is interrupted by four introns indicated by lower case letters. The amino acid sequence of a C6 zinc cluster DNA-binding motif is underlined. The basic region conserved in Gal4 -type zinc cluster (amino acids 38–60) and the conserved middle homology region (amino acids 325–358) are highlighted by dashed underlines. Five mutant fl alleles were sequenced. The 67-bp deletion in the flL allele is indicated by the boxed nucleotides. The 42-bp duplicated sequence of flP is indicated by the underlined nucleotides. The arrowhead at nucleotide position 938 indicates the site of insertion of a T residue in flP961. flY contains two missense mutations that result in conservative amino acid substitutions at amino acid positions 7 and 314 as indicated. Transition mutations in the sequenced region of the flRIP allele are indicated by the dots above the nucleotides. The 5' end of fl mRNA is indicated by the circled nucleotide at position 424.

Analysis of fl mRNA:
A wild-type strain of N. crassa (74-OR23-1VA) was grown for 20 hr in Vogel's minimal medium (DAVIS and DE SERRES 1970 Down). The culture was then washed twice with water and transferred to Vogel's minimal medium without nitrogen for an additional 8 hr. Conidiation is induced by nitrogen starvation under these conditions. The culture was harvested and RNA was extracted (MADI et al. 1994 Down). A primer (5' > ACCCGAAGAAGCAAACCCAAG < 3') downstream of the predicted 3' set of introns and a primer (5' > GTACCGTAAGATTTGCAG < 3') downstream of the predicted 5' intron, were used to generate first strand cDNA from the RNA using a Pharmacia Biotech First Strand cDNA Synthesis Kit. The first strand products were used as the templates for PCR amplification. Primers corresponding to nucleotides 453–470 and the complement of 1514 –1531 (Figure 2) were used to amplify the region spanning the putative intron in the 5' region of the gene, and primers corresponding to nucleotides 1682–1699 and the complement of 3550–3567 (Figure 2) were used to amplify the region spanning the putative introns in the 3' region of the gene. Amplified regions were used for direct sequencing.

To identify the 5' end of the mRNA, a radiolabeled oligonucleotide 5'-[32P]-TGCGGCATACTAGGCACACGCGTTCGGTGTTA-3' was used for primer extension analysis. The labeled primer was co-precipitated with 20 µg total RNA (nitrogen-starved culture) and resuspended in 20 µl water. After incubating for 5 min at 65°, MMLV reverse transcriptase buffer (New England Biolabs, Beverly, MA), dNTPs (final concentration 0.5 mM), and 50 units MMLV reverse transcriptase were added. The reaction was incubated for 5 min at 42°, followed by a 5 min incubation at room temperature. An additional 50 units reverse transcriptase were added to the reaction and incubation was continued at 37° for 1 hr. The reaction was stopped by adding 1 µl 0.5 M EDTA and was then treated with RNaseA. After phenol:chloroform (1:1) extraction, the products were precipitated and processed for loading on a sequencing gel. The same primer was used to produce a sequencing ladder to estimate the sizes of the primer extension products.

Developmental Timecourse Experiment:
Vogel's minimal medium (500 ml) (DAVIS and DE SERRES 1970 Down) was inoculated with 1 x 106 conidia/ml 74 -OR23-1VA. After incubation for 20 hr at 34° (200 rpm) the culture was harvested onto 7-cm-diameter pieces of Whatman #1 filter paper. Each mycelium filter disk was placed on Vogel's minimal media with 0.45% agar and placed in a sterile hood. Mycelial pads were quick-frozen in liquid nitrogen at the indicated times prior to RNA extraction.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cloning of the fl gene:
We employed a map-based cloning strategy to obtain fl. fl was previously mapped to the right arm of chromosome II, about 3 cM from trp-3 (PERKINS et al. 1982 Down). mus-23 was found to map between fl and trp-3 (PERKINS 1992 Down). We crossed a fl, trp-3;a strain (FGSC #7200) with the mus-23;A strain and examined 135 random progeny. We detected 6% recombination (8/135) between fl and trp-3, 4.5% recombination (6/135) between trp-3 and mus-23, and 1.5% recombination (2/135) between fl and mus-23 (Figure 1B). In N. crassa, one map unit is equal to an average of 40 kb based on the estimated genome size, suggesting that cloning fl by chromosome walking from mus-23 would be feasible.

Complementation of mus-23 was achieved by selection for wild-type levels of resistance to MMS (see MATERIALS AND METHODS). Three cosmid pools, X24, X22, and X11, gave rise to MMS-resistant colonies. Cosmid pool X24 was subdivided to identify a complementing subpool and the subpool was further divided until a single complementing cosmid, X24:A11, was isolated. The ends of the insert of X24:A11 were used as a probe for RFLP mapping of the cosmid clone (see MATERIALS AND METHODS). These data place the N. crassa DNA present in X24:A11 on the right arm of chromosome II, between bli-4 (a blue light inducible gene) and Fsr-34 (5S RNA) (METZENBERG and GROTELUESCHEN 1989 Down), consistent with the location of mus-23 (Figure 1C).

Cosmid X24:A11 was used for transformation experiments with a flL strain (FGSC #46), and complementation of the conidiation defect of the mutant was observed. The flY mutant has reduced pigmentation and delayed conidiation. Cosmid X24:A11 also complemented the phenotype of this second allele of fl. A 4.6-kb ApaI-NotI fragment was subcloned and complemented the flL and flY mutants. Subsequent analysis indicated that the NotI site of the 4.6-kb fragment was from the polylinker region of the cosmid vector and that the fl coding region was truncated at the 3' end (position 3134 in Figure 2). The 4.6-kb ApaI-NotI fragment was used as a hybridization probe to identify additional cosmids containing fl. Cosmids G15:G5, G18:F4, G15:A5, and X2:D10 were identified. Cosmid G15:G5 complemented flL and flY in transformation experiments. Direct sequencing of the 3' end of the fl gene from this cosmid revealed an additional 74 nucleotides of fl coding region.

fl encodes a C6 zinc cluster protein:
Sequence analysis of a 5.2-kb region containing the complementing activity revealed the presence of a gene predicted to encode a 792 amino acid polypeptide, following the removal of four predicted introns. The first putative intron interrupts a C6 zinc cluster motif that is present near the beginning of the coding region (Figure 2). Three additional putative introns are located in the central portion of the gene. These latter three introns contain branch point sequences that differ from the consensus sequence of 5'-RCTRAC-3' (EDELMANN and STABEN 1994 Down). Instead, the corresponding sequences of these introns are CCTGAC, ATTGAC, and TCTGAC (Figure 2). It was therefore important to verify that splicing at these sites occurs in vivo. A cDNA clone was obtained that initiated at position 2913 and ended at position 3715 (Figure 2). There was no poly-A tail in the cDNA clone. Although we could not verify the presence of any of the predicted introns with this truncated clone, its sequence suggests that the 3' untranslated region of fl mRNA is at least 500 bp in length. Reverse transcriptase-PCR products were obtained using mRNA from cultures that express fl (see MATERIALS AND METHODS). Direct sequencing of PCR products spanning putative introns verified their locations. An ATG codon is located 94 nucleotides upstream of the predicted translation initiation codon of fl. Primer extension mapping revealed a single major 5' end at position 424 (Figure 2), demonstrating that the potential upstream open reading frame is not present in the 5' leader region of the predominant transcript.

The closest match to fl obtained using the BLAST search algorithm (ATSCHUL et al. 1990 Down) was with another N. crassa gene, nit-4, which encodes a C6 zinc cluster transcription factor that activates expression of genes for nitrate utilization (YUAN et al. 1991 Down). A comparison of the sequence of FL, NIT4 (YUAN et al. 1991 Down), NIRA (the Aspergillus nidulans homologue of NIT4) (BURGER et al. 1991 Down), and Cha4p (a nitrogen-responsive regulator of serine catabolism in Saccharomyces cerevisiae) (HOLMBERG and SCHJERLING 1996 Down) identified three regions of similarity common to Gal4p-type C6 zinc cluster transcription factors (LAUGHON and GESTELAND 1984 Down) (Figure 3). The C6 zinc cluster of FL has a spacing of cysteine residues identical to that in Cha4p (HOLMBERG and SCHJERLING 1996 Down). A second motif conserved in Gal4-type activators is the occurrence of several basic amino acid residues that follow the C6 zinc cluster. Although this motif can be identified on the basis of charge, there is only weak sequence conservation (Figure 3B). A "middle homology" region of unknown function is conserved in FL and is equally similar among NIT4, NIRA, and Cha4p (Figure 3C).



View larger version (32K):
In this window
In a new window
Download PPT slide
 
Figure 3. —Alignment of conserved regions between Gal4-type proteins FL, N. crassa NIT4, A. nidulans NIRA, and S. cerevisiae Cha4p. (A) The DNA binding domain. (B) The basic region. (C) The middle homology region. Arg18 is indicated by a dot above the sequence. The residue in this position is important for DNA-binding in Gal4-type proteins (DE RIJCKE et al. 1992 Down). Residues of NIT4, NIRA, and Cha4p that are identical to FL are boxed. Basic amino acids in the basic region are underlined.

To characterize the mutations that cause the fl phenotype, we amplified fl DNA from several mutant alleles (Figure 2, Table 1) (see MATERIALS AND METHODS). The LINDEGREN allele (flL) was found to have a 67-bp deletion that encompasses the start codon and the first segment of the C6 zinc cluster (Figure 2). The PERKINS' allele (flP ) contains a 47-bp duplication that causes a frameshift leading to a premature stop codon (Figure 2). The flP961 allele contains an insertion of a single T residue after codon 96, resulting in premature termination (Figure 2). The flY allele causes a less severe phenotype and was found to contain two separate missense mutations at nucleotide positions 519 and 1591 that change the threonine of codon 7 to serine and the arginine of codon 314 to lysine (Figure 2).


 
View this table:
In this window
In a new window

 
Table 1. Summary of mutations in the fl alleles

To generate a null allele of fl that contains mutations throughout the entire coding region, we performed repeat-induced point (RIP) mutagenesis. In N. crassa, duplicated DNA segments may undergo RIP mutation during a sexual cross (SELKER 1990 Down; SELKER and GARRETT 1988 Down). A wild-type strain bearing an ectopic copy of the pFL2 plasmid was crossed to a wild-type strain of the opposite mating type. Unlinked duplications are mutated in about half of the nuclei in a cross in RIP mutagenesis, so that about 25% of the progeny should have a mutant copy of the gene. Approximately 23% of 361 viable progeny were defective in macroconidiation. Of these, four were only partially defective in conidiation and resembled the flY mutant, while the rest were aconidial. One of the hygromycin-sensitive aconidial progeny was crossed back to wild-type and the fluffy phenotype segregated 1:1. This mutant was crossed with a flL strain, and all 125 progeny examined displayed the fluffy phenotype. We conclude that we created a new allele of fl, flRIP. We amplified the fl locus from this strain (LBS1) and sequenced this allele. RIP mutagenesis produced 105 transition mutations that resulted in 47 codon changes (Figure 2, Table 1). Key changes included altering the initiator methionine codon to an isoleucine codon and changing two of the cysteine codons of the C6 zinc cluster to tyrosine codons. In addition, tryptophans at positions 231, 348, 352, and 505 were changed to termination codons. This RIP allele is a null allele with a phenotype equivalent to flL. flRIP could be complemented by transformation with cosmid G15:G5.

fl is expressed transiently during development:
We induced development in a wild-type strain (74OR23-1VA) and harvested samples over a time-course to examine the expression pattern of fl. RNA from each of these samples was probed in Northern blot experiments with a 2.1-kb fragment from the fl coding region. fl expression was low at 0 and 3 hr and increased substantially 6 hr after the induction of development (Figure 4) before returning to preinduction levels by 9 hr.



View larger version (97K):
In this window
In a new window
Download PPT slide
 
Figure 4. —Northern blot analysis of fl expression during development. Panels are northern blots probed with fl, con-6, con-10, and actin (act-1). A wild-type culture was grown in minimal medium for 20 hr and harvested onto separate filter paper circles. The harvested mycelial pads on the filters were placed onto agar minimal medium and incubated in the air for 0, 3, 6, 9, 12, and 24 hr before harvesting for RNA extraction. Each lane contained 20 µg total RNA. act-1 was used as a control for mRNA loading. fl and act-1 blots were exposed for 3 days. con-6 and con-10 blots were exposed for 4 and 12 hr, respectively.

con-6 is a conidiation-specific gene that is expressed at approximately 6 hr after induction of development (ROBERTS and YANOFSKY 1989 Down; SACHS and YANOFSKY 1991 Down). Its timing of expression precedes the transition from minor to major constriction chain formation by about 2 hr (ROBERTS and YANOFSKY 1989 Down; SACHS and YANOFSKY 1991 Down). The timing of con-6 expression is coincident with increased expression of fl. con-10 is typically expressed 8–10 hr after induction of development and its expression coincides with initiation of major constriction chain formation (SACHS and YANOFSKY 1991 Down). In this experiment a low-level of con-10 mRNA was detected at 6 hr and expression reached maximal levels at 9 hr (Figure 4).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

fl has long been thought to be an important regulator of conidial development in N. crassa. To further our understanding of the conidiation process we isolated fl and began to examine its role as a regulator of conidiation. Several lines of evidence prove that we have cloned the fl gene. Complementation of the aconidial phenotype of a flL strain and the delayed conidiation and pigmentation phenotypes of a flY strain was accomplished with the cloned gene. RFLP mapping of the cloned gene placed it in the same region of the genome as the fl locus. RIP inactivation of the cloned gene produced a null mutant that phenotypically resembles other aconidial fl mutants and no recombination between flRIP and flL was observed in sexual crosses. Sequence data of amplified fl alleles from three mutants revealed a deletion, a duplication, and an insertion in the gene that would produce a defective protein or no protein at all. The flY allele contained two conservative amino acid substitutions consistent with the less severe phenotype caused by this allele.

The main features required for proper function of Gal4p-type proteins are thought to be the C6 zinc cluster, the basic dimerization region, the middle homology region, and an acidic activation region (SCHJERLING and HOLMBERG 1996 Down). The sequences of the four alleles of fl provide initial information about the sequence requirements for FL activity. The truncated proteins predicted from the flP and flP961 alleles appear to be null alleles similar in phenotype to flL and flRIP. Thus, the DNA-binding domain and basic regions are not sufficient for FL function. Complementation of fl null alleles by the pFL2 clone that is truncated at the C terminus suggests that there is flexibility in the sequence requirements of this portion of the protein. This region does not contain any of the four important regions described. However, the two conservative amino acid changes in the flY allele are not located in any of the highly conserved domains, yet cause delayed conidiation and weak pigmentation. The threonine to serine or arginine to lysine mutations may have subtle effects on protein function or stability. Another possibility is that additional mutations exist in the unanalyzed regions of the promoter that could alter fl expression and cause the flY phenotype.

The precise function of the middle homology region of the Gal4-type proteins has not been determined. An internal region of Gal4p, including the middle homology region, is involved in glucose repression of Gal4p activity (STONE and SADOWSKI 1993 Down). In addition, when the middle homology region of Leu3p was largely deleted, it was able to activate LEU2 regardless of the presence of the co-activator {alpha}-isopropylmalate (ZHOU et al. 1990 Down). These data imply that the middle homology region is involved in responding to pathway-specific signals such as glucose or {alpha}-isopropylmalate levels (BURGER et al. 1991 Down; YUAN et al. 1991 Down) or, in the case of NIT4 and NIRA, nitrogen status.

FL displays the highest sequence similarity to NIT4 and NIRA, regulators of nitrate assimilation in N. crassa and A. nidulans, respectively. Interestingly, the first nitron of fl and the first intron of nirA are located in the same position in the C6 zinc cluster domain (Figure 2) (BURGER et al. 1991 Down). FL also has similarity to Cha4p, a yeast factor that regulates catabolism of serine in the absence of alternative nitrogen sources (HOLMBERG and SCHJERLING 1996 Down). Many of the members of the Gal4p family of proteins are pathway-specific regulators of metabolism. FL appears to be a specific regulator of conidiation; however, it is tempting to speculate that FL activity could respond to nitrogen status to modulate the abundance or timing of conidia production. fl mRNA was detected in nitrogen-starved cultures that were producing conidiophores (data not shown).

Expression of fl during synchronized conidiation occurs approximately 6 hr after exposure of the mycelium to air. The timing of fl induction is consistent with a role in initiating major constriction growth in response to earlier developmental cues. In wild-type cells, the transition to major constriction chain growth occurs between 6 to 9 hr after induction of development. fl null mutants initiate the early stages of budding growth and can form short minor constriction chains but do not initiate major constriction chain budding. Minor constriction chains are capable of reverting to hyphal growth and are not developmentally committed to budding growth (SPRINGER and YANOFSKY 1989 Down).

Several conidiation-specific genes of unknown function have been examined for expression patterns in the wild-type and in developmental mutants. con-8 is expressed early in development and is also induced during aerial growth of a fl mutant (ROBERTS and YANOFSKY 1989 Down). con-6 is induced just prior to major constriction chain growth, and its expression is reduced to 5–25% of wild-type levels in a fl mutant (ROBERTS and YANOFSKY 1989 Down)). con-10 is expressed during major constriction chain growth and is not induced in a fl mutant (ROBERTS and YANOFSKY 1989 Down)). The timing of fl expression relative to con-6 and con-10 is consistent with a direct role for FL in activating these genes during major constriction chain formation. Alternatively, FL may indirectly control con gene expression by activation of a developmental program for major constriction chain growth.

N. crassa and A. nidulans serve as important model systems for the study of fungal genetics. Morphologically, the structures of the N. crassa and A. nidulans conidiophores differ greatly. Recently, a N. crassa homologue of the A. nidulans flbD gene (WIESER and ADAMS 1995 Down) was cloned and characterized (SHEN et al. 1998 Down). Although the N. crassa homologue complements the delayed conidiation phenotype of an A. nidulans flbD mutant, a corresponding mutant produced in N. crassa displayed no defect in macroconidiation or microconidiation. fl is the first specific regulator of conidial development to be analyzed from N. crassa and it is not homologous to any of the known regulatory genes governing conidiation in A. nidulans (ADAMS 1995 Down). These findings suggest that the genetic pathways controlling conidial development differ in these two fungal species.


*  ACKNOWLEDGMENTS

The authors thank MS. SHEILA MCBRIDE and MR. WEI-CHIANG SHEN for technical assistance, and DRS. MATTHEW SPRINGER and CHARLES YANOFSKY for electron micrographs of fl and wild-type strains. We also thank DRS. R. ARAMAYO, D. BELL-PEDERSEN, M. BEREMAND and S. GOLDEN for helpful criticisms of the manuscript. This work was supported by U.S. Public Health Service grant R29 GM-47977 to D.J.E. L.A.B. was supported in part by National Science Foundation training grant DGE-9354891 to the Program for the Biology of Filamentous Fungi.

Manuscript received October 1, 1997; Accepted for publication December 11, 1997.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, T. H., 1995 Asexual sporulation in higher fungi, pp. 367–382 in The Growing Fungus, edited by N. A. R. GOW and G. M. GADD. Chapman & Hall, London.

ATSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990  Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].

BURGER, G., J. STRAUSS, C. SCAZZOCCHIO, and B. F. LANG, 1991  nirA, the pathway-specific regulatory gene of nitrate assimilation in Aspergillus nidulans, encodes a putative GAL4-type zinc finger protein and contains four introns in highly conserved regions. Mol. Cell. Biol. 11:5746-5755[Abstract/Free Full Text].

CARROLL, A. M., J. A. SWEIGARD, and B. VALENT, 1994  Improved vectors for selecting resistance to hygromycin. Fungal Genet. Newsl. 41:22.

DAVIS, R. H. and F. J. DE SERRES, 1970  Genetic and microbiological research techniques for Neurospora crassa. Methods Enzymol. 17A:79-143.

DERIJCKE, M., S. SENECA, B. PUNYAMMALEE, N. GLANSDORFF, and M. CRABEEL, 1992  Characterization of the DNA target site for the yeast ARGR regulatory complex, a sequence able to mediate repression or induction by arginine. Mol. Cell. Biol. 12:68-81[Abstract/Free Full Text].

DEVEREUX, J., P. HAEBERLI, and O. SMITHIES, 1984  A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.

EDELMANN, S. E. and C. STABEN, 1994  A statistical analysis of sequence features within genes from Neurospora crassa. Exp. Mycol. 18:70-81.

HOLMBERG, S. and P. SCHJERLING, 1996  Cha4p of Saccharomyces cerevisiae activates transcription via serine/threonine response elements. Genetics 144:467-478[Abstract].

LAUGHON, A. and R. F. GESTELAND, 1984  Primary structure of the Saccharomyces cerevisiae GAL4 gene. Mol. Cell. Biol. 4:260-267[Abstract/Free Full Text].

LINDEGREN, C. C., 1933  The genetics of Neurospora-III. Pure bred stocks and crossing over in N. crassa. Bulletin of the Torrey Club 60:133-155.

MADI, L., D. J. EBBOLE, B. T. WHITE, and C. YANOFSKY, 1994  Mutants of Neurospora crassa that alter gene expression and conidial development. Proc. Natl. Acad. Sci. USA 91:6226-6230[Abstract/Free Full Text].

MATSUYAMA, S. S., R. E. NELSON, and R. W. SIEGEL, 1974  Mutations specifically blocking differentiation of macroconidiation in Neurospora crassa. Dev. Biol. 41:278-287[Medline].

METZENBERG, R. L. and J. GROTELUESCHEN, 1989  Restriction polymorphism maps of Neurospora crassa: update. Fungal Genet. Newsl. 36:51-57.

METZENBERG, R. L. and J. GROTELUESCHEN, 1995  Restriction polymorphism maps of Neurospora crassa: update. Fungal Genet. Newsl. 42:86-90.

ORBACH, M. J. and M. S. SACHS, 1991  The Orbach/Sachs cosmid library of N. crassa DNA sequences (pMOcosX). Fungal Genet. Newsl. 38:97.

PERKINS, D. D., 1992  Neurospora crassa genetic maps, June 1992. Fungal Genet. Newsl. 39A:153-162.

PERKINS, D. D., A. RADFORD, D. NEWMEYER, and M. BÔRKMAN, 1982  Chromosomal loci of Neurospora crassa. Microbiol. Rev. 46:426-570[Free Full Text].

ROBERTS, A. N. and C. YANOFSKY, 1989  Genes expressed during conidiation in Neurospora crassa: characterization of con-8. Nucl. Acids Res. 17:197-214[Abstract/Free Full Text].

SACHS, M. S. and C. YANOFSKY, 1991  Developmental analysis of mRNA levels for genes involved in conidiation and amino acid biosynthesis in Neurospora crassa. Dev. Biol. 148:117-128[Medline].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHJERLING, P. and S. HOLMBERG, 1996  Comparative amino acid sequence analysis of the C6 zinc finger cluster family of transcriptional regulators. Nucleic Acids Res. 24:4599-4607[Abstract/Free Full Text].

SELITRENNIKOFF, C. P., R. E. NELSON, and R. W. SIEGEL, 1974  Phase-specific genes for macroconidiation in Neurospora crassa. Genetics 78:679-690[Abstract/Free Full Text].

SELKER, E., 1990  Premeiotic instability of repeated sequences in Neurospora crassa. Annu. Rev. Genet. 24:579-613[Medline].

SELKER, E. and P. W. GARRETT, 1988  DNA sequence duplications trigger gene inactivation in Neurospora crassa. Proc. Natl. Acad. Sci. USA 85:6870-6874[Abstract/Free Full Text].

SHEN, W.-C., J. WIESER, T. H. ADAMS, and D. J. EBBOLE, 1998  The Neurospora rca-1 gene complements an Aspergillus flbD sporulation mutant but has no identifiable role in Neurospora sporulation. Genetics 148:1031-1041[Abstract/Free Full Text].

SPRINGER, M. L. and C. YANOFSKY, 1989  A morphological and genetic analysis of conidiophore development in Neurospora crassa. Genes Dev. 3:559-571[Abstract/Free Full Text].

STONE, G. and I. SADOWSKI, 1993  GAL4 is regulated by a glucose-responsive functional domain. EMBO J. 12:1375-1385[Medline].

TURIAN, G. and D. E. BIANCHI, 1972  Conidiation in Neurospora. Bot. Rev. 38:119-154.

VOLLMER, S. J. and C. YANOFSKY, 1986  Efficient cloning of genes of Neurospora crassa. Proc. Natl. Acad. Sci. USA 83:4869-4873[Abstract/Free Full Text].

WIESER, J. and T. H. ADAMS, 1995  flbD encodes a Myb-like DNA-binding protein that coordinates initiation of Aspergillus nidulans conidiophore development. Genes Dev. 9:491-502[Abstract/Free Full Text].

WEISS, B. and G. TURIAN, 1966  A study of conidiation in Neurospora crassa. J. Gen. Microbiol. 44:407-418[Abstract/Free Full Text].

WILSON, C. H., 1985  Production of microconidia by several fl strains. Neurospora Newsl. 32:18.

YUAN, G.-F., Y.-H. FU, and G. A. MARZLUF, 1991  nit-4, a pathway-specific regulatory gene of Neurospora crassa, encodes a protein with a putative binuclear zinc DNA-binding domain. Mol. Cell. Biol. 11:5735-5745[Abstract/Free Full Text].

ZHOU, K., Y. BAI, and G. B. KOHLHAW, 1990  Yeast regulatory protein LEU3: a structure-function analysis. Nucleic Acids Res. 18:291-298[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
Eukaryot CellHome page
Q. Sun, G. H. Choi, and D. L. Nuss
Hypovirus-Responsive Transcription Factor Gene pro1 of the Chestnut Blight Fungus Cryphonectria parasitica Is Required for Female Fertility, Asexual Spore Development, and Stable Maintenance of Hypovirus Infection
Eukaryot. Cell, March 1, 2009; 8(3): 262 - 270.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. Lambreghts, M. Shi, W. J. Belden, D. deCaprio, D. Park, M. R. Henn, J. E. Galagan, M. Basturkmen, B. W. Birren, M. S. Sachs, et al.
A High-Density Single Nucleotide Polymorphism Map for Neurospora crassa
Genetics, February 1, 2009; 181(2): 767 - 781.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
V. D. Gooch, A. Mehra, L. F. Larrondo, J. Fox, M. Touroutoutoudis, J. J. Loros, and J. C. Dunlap
Fully Codon-Optimized luciferase Uncovers Novel Temperature Characteristics of the Neurospora Clock
Eukaryot. Cell, January 1, 2008; 7(1): 28 - 37.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. D. Perkins, M. Freitag, V. C. Pollard, L. A. Bailey-Shrode, E. U. Selker, and D. J. Ebbole
Recurrent Locus-Specific Mutation Resulting From a Cryptic Ectopic Insertion in Neurospora
Genetics, February 1, 2007; 175(2): 527 - 544.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
S. MacPherson, M. Larochelle, and B. Turcotte
A Fungal Family of Transcriptional Regulators: the Zinc Cluster Proteins
Microbiol. Mol. Biol. Rev., September 1, 2006; 70(3): 583 - 604.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. V. Colot, G. Park, G. E. Turner, C. Ringelberg, C. M. Crew, L. Litvinkova, R. L. Weiss, K. A. Borkovich, and J. C. Dunlap
A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors
PNAS, July 5, 2006; 103(27): 10352 - 10357.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. Vienken, M. Scherer, and R. Fischer
The Zn(II)2Cys6 Putative Aspergillus nidulans Transcription Factor Repressor of Sexual Development Inhibits Sexual Development Under Low-Carbon Conditions and in Submersed Culture
Genetics, February 1, 2005; 169(2): 619 - 630.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Bailey-Shrode and D. J. Ebbole
The fluffy Gene of Neurospora crassa Is Necessary and Sufficient to Induce Conidiophore Development
Genetics, April 1, 2004; 166(4): 1741 - 1749.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
K. A. Borkovich, L. A. Alex, O. Yarden, M. Freitag, G. E. Turner, N. D. Read, S. Seiler, D. Bell-Pedersen, J. Paietta, N. Plesofsky, et al.
Lessons from the Genome Sequence of Neurospora crassa: Tracing the Path from Genomic Blueprint to Multicellular Organism
Microbiol. Mol. Biol. Rev., March 1, 2004; 68(1): 1 - 108.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
A. Correa and D. Bell-Pedersen
Distinct Signaling Pathways from the Circadian Clock Participate in Regulation of Rhythmic Conidiospore Development in Neurospora crassa
Eukaryot. Cell, April 1, 2002; 1(2): 273 - 280.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
P.-K. Chang, J. Yu, D. Bhatnagar, and T. E. Cleveland
The Carboxy-Terminal Portion of the Aflatoxin Pathway Regulatory Protein AFLR of Aspergillus parasiticus Activates GAL1::lacZ Gene Expression in Saccharomyces cerevisiae
Appl. Envir. Microbiol., June 1, 1999; 65(6): 2508 - 2512.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Masloff, S. Pöggeler, and U. Kück
The pro1+ Gene From Sordaria macrospora Encodes a C6 Zinc Finger Transcription Factor Required for Fruiting Body Development
Genetics, May 1, 1999; 152(1): 191 - 199.
[Abstract] [Full Text]