help button home button Genetics Appl Env Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, B.-S.
Right arrow Articles by Garfinkel, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, B.-S.
Right arrow Articles by Garfinkel, D. J.
Genetics, Vol. 148, 1743-1761, April 1998, Copyright © 1998

Posttranslational Inhibition of Ty1 Retrotransposition by Nucleotide Excision Repair/Transcription Factor TFIIH Subunits Ssl2p and Rad3p

Bum-Soo Leea, Conrad P. Lichtenstein1,a, Brenda Faiola2,a, Lori A. Rinckel3,a, William Wysock4,a, M. Joan Curciob, and David J. Garfinkela
a Gene Regulation and Chromosome Biology Laboratory, Advanced BioScience Laboratories-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702-1201 and
b Molecular Genetics Program, Wadsworth Center and School of Public Health, State University of New York at Albany, Albany, New York 12201-2002

Corresponding author: David J. Garfinkel, Gene Regulation and Chromosome Biology Laboratory, ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, P.O. Box B, Frederick, MD 21702-1201, garfinke{at}ncifcrf.gov (E-mail).

Communicating editor: A. G. HINNEBUSCH


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

rtt4-1 (r egulator of Ty t ransposition) is a cellular mutation that permits a high level of spontaneous Ty1 retrotransposition in Saccharomyces cerevisiae. The RTT4 gene is allelic with SSL2 (RAD25), which encodes a DNA helicase present in basal transcription (TFIIH) and nucleotide excision repair (NER) complexes. The ssl2-rtt (rtt4-1) mutation stimulates Ty1 retrotransposition, but does not alter Ty1 target site preferences, or increase cDNA or mitotic recombination. In addition to ssl2-rtt, the ssl2-dead and SSL2-1 mutations stimulate Ty1 transposition without altering the level of Ty1 RNA or proteins. However, the level of Ty1 cDNA markedly increases in the ssl2 mutants. Like SSL2, certain mutations in another NER/TFIIH DNA helicase encoded by RAD3 stimulate Ty1 transposition. Although Ssl2p and Rad3p are required for NER, inhibition of Ty1 transposition is independent of Ssl2p and Rad3p NER functions. Our work suggests that NER/TFIIH subunits antagonize Ty1 transposition posttranslationally by inhibiting reverse transcription or destabilizing Ty1 cDNA.


RETROTRANSPOSONS are a widely disseminated group of mobile genetic elements structurally and functionally related to retroviruses (for reviews, see TEMIN 1985 Down; BOEKE 1988 Down; FLAVELL 1995 Down). Unlike retroviruses, however, retrotransposons are not infectious. Therefore, these elements and their host genomes have evolved control systems that keep transposition at a low level (for reviews, see GARFINKEL 1992 Down; WESSLER 1996 Down), and integration site preferences that minimize insertional mutagenesis (for reviews, see SANDMEYER et al. 1990 Down; CRAIGIE 1992 Down; CURCIO and MORSE 1996 Down). The Ty element families of Saccharomyces cerevisiae, Ty1, Ty2, Ty3, Ty4, and Ty5, provide an excellent experimental system for understanding how retroelements and yeast coexist (for reviews, see BOEKE and SANDMEYER 1991 Down; VOYTAS 1996 Down). Ty elements contain an internal coding region bracketed by two long terminal repeats (LTRs). These elements are transcribed from LTR to LTR, forming a terminally redundant transcript that is utilized as a template for both replication and translation. The internal domain contains two overlapping coding regions, TYA (gag), which encodes the nucleocapsid protein of the virus-like particle (VLP), and TYB (pol ), which encodes protease (PR), integrase (IN), and reverse transcriptase/ribonuclease H (RT/RH). The TyA-TyB precursor protein is synthesized by a +1 translational frameshifting event that places TYA and TYB in the same reading frame. Linear Ty cDNA is synthesized by reverse transcription within VLPs that accumulate in the cytoplasm. Ty IN catalyzes the integration of this cDNA into new genomic sites, and the formation of a 5-base pair (bp) duplication of target DNA occurs upon insertion of the element.

Minimizing the level of Ty1 transposition is particularly important for maintaining the integrity of the yeast genome because these elements transpose, mutate essentially any yeast gene, initiate genome rearrangements, and are the most abundant Ty element family in laboratory strains. The 29 Ty1 elements present in the completely sequenced S. cerevisiae genome (for a review, see GOFFEAU et al. 1996 Down) contribute as much as 0.1 to 0.8% of the total RNA present in the cell (ELDER et al. 1983 Down; CURCIO et al. 1990 Down). However, mature Ty1 proteins and VLPs are present in low levels (GARFINKEL et al. 1985 Down; CURCIO and GARFINKEL 1992 Down), and the rate of Ty1 transposition is 10-5 to 10-7 per element per cell division (CURCIO and GARFINKEL 1991 Down). The factors limiting Ty1 transposition have not been well characterized. Defective Ty1 elements have been hypothesized to play a major role in maintaining transpositional dormancy (BOEKE et al. 1988 Down). Extensive analyses of the number of transposition defective vs. competent Ty1 elements, however, suggest that most of the genomic elements are functional, and transdominant genomic Ty1 mutations do not play a major role in regulating Ty1 transposition (CURCIO and GARFINKEL 1994 Down).

Even though Ty1 transposition occurs at a low level, it is greatly stimulated in cells expressing an active Ty1 element from the inducible GAL1 promoter carried on a multicopy pGTy1 plasmid (BOEKE et al. 1985 Down). This growth condition is termed "transposition induction" (GARFINKEL et al. 1985 Down). Genetic tagging of a Ty1 element with the retrotransposition indicator gene his3-AI has facilitated understanding the process of retrotransposition because it allows the fate of individual genomic Ty1his3-AI elements to be followed (CURCIO and GARFINKEL 1991 Down). The his3-AI gene has also been used to define a Ty1 cDNA recombination pathway that may be in competition with the transpositional integration pathway (SHARON et al. 1994 Down).

TFIIH is a complex RNA polymerase II general transcription factor that has multiple roles in the cell (for reviews, see ORPHANIDES et al. 1996 Down; SVEJSTRUP et al. 1996 Down). TFIIH is required in vitro for transcription initiation, and promoter clearance, a step during or shortly after initiation of transcription when the RNA Pol II initiation complex is converted into an elongation complex. In addition to their essential role in transcription, certain TFIIH proteins are also required for nucleotide excision repair (NER) of damaged DNA. Yeast holo-TFIIH can be dissociated into three components: core-TFIIH which includes Rad3p and several other proteins, TFIIK which contains three proteins and has protein kinase activity, and Ssl2p (Rad25p) (SVEJSTRUP et al. 1995 Down; GUZDER et al. 1996 Down; SUNG et al. 1996 Down). Ssl2p and Rad3p are DNA helicases with opposite polarities; Ssl2p has 3'-5' helicase activity and Rad3p has 5'-3' helicase activity (SUNG et al. 1987 Down; GUZDER et al. 1994B Down; SUNG et al. 1996 Down). NER apparently requires core TFIIH proteins, Ssl2p, but not TFIIK. Instead, core TFIIH-Ssl2 proteins become associated with gene products known to be required for NER in yeast, including those encoded by RAD1, RAD2, RAD4, RAD10, and RAD14 (SVEJSTRUP et al. 1995 Down; SUNG et al. 1996 Down). The human homologs of SSL2 and RAD3, XPB/ERCC-3 and XPD/ERCC-2, respectively, have been found to be mutated in patients with xeroderma pigmentosum (XP), Cockayne's syndrome, and trichothiodystrophy (for a review, see LEHMANN 1995 Down). Mutations in haywire, the Drosophila homolog of SSL2-XPB-ERCC3, mimic some of the effects of XP, including ultraviolet (UV) sensitivity and neurological abnormalities (MOUNKES et al. 1992 Down).

SSL2, RAD3, as well as additional gene products comprising NER/TFIIH may have other roles in the cell. Certain mutations in SSL1 and SSL2 are dominant suppressors of his4-316, a mutation caused by a stable stem-loop structure in the 5' leader of HIS4 that prevents translation initiation (GULYAS and DONAHUE 1992 Down; WANG et al. 1995 Down). Special alleles of RAD3 have been characterized that cause elevated mutation and recombination rates (MONTELONE et al. 1988 Down; SONG et al. 1990 Down; BAILIS et al. 1995 Down). Interestingly, the rad3-G595R mutation specifically increases recombination rates between repeated sequences of 250–300 bp or less and stabilizes the ends of DNA double strand breaks (BAILIS et al. 1995 Down; BAILIS and MAINES 1996 Down).

Previous work suggests that Ty1 transposition is regulated posttranslationally by gene products that inhibit VLP formation or function (for a review, see FARABAUGH 1995 Down). Here, we describe the characteristics of a potent rtt mutation (r egulator of Ty t ransposition), rtt4-1 (ssl2-rtt), which is an allele of the NER/TFIIH subunit gene SSL2 (RAD25) (GULYAS and DONAHUE 1992 Down; WANG et al. 1994 Down). Mutations in another NER/TFIIH component, RAD3 (GUZDER et al. 1994A Down; WANG et al. 1994 Down), also stimulate Ty1 transposition. Our results suggest that Ssl2p and Rad3p inhibit Ty1 transposition by preventing the accumulation of Ty1 cDNA.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains, media, and genetic techniques:
The parental strains for mutagenesis, JC297 and JC358, were derived from GRF167 (BOEKE et al. 1985 Down) and GRY 340 (kindly provided by J. STRATHERN, ABL-Basic Research Program). JC297 was isolated following induction of transposition using pGTy1-H3his3-AI (CURCIO and GARFINKEL 1991 Down) in GRF167 and contains a single unspliced chromosomal element, designated Ty1-270his3-AI. The MATa::URA3 strain JC358 was derived from a cross between JC297 and GRY 340, which contains a URA3 gene integrated between the MATa and cry1 loci. Suitable ascospores from this cross were backcrossed two additional times with JC297 to generate JC358. JC297 and JC358 and derivatives thereof contain a genomic Ty1::lacZ fusion in which the E. coli lacZ gene is fused in-frame to Ty1 IN coding sequences. Mutant rtt4-1/ssl2-rtt (the mutation was renamed ssl2-rtt after gene identification) strains DG1501 and DG1502 were derived by three backcrosses between the original rtt4-1 isolate (JC358-6-24B) and the parental strains JC297 or JC358. DG1626 was constructed by integrating AgeI-digested SSL2/Y Ip5 at the SSL2 locus in JC364. The structure of the integration event at the RTT4/SSL2 locus in DG1626 was verified by Southern analysis using 32P-labeled pBR322 and SSL2 probes. DG1722 is an isogenic ssl2-rtt derivative of the SSL2 strain GRF167 constructed by two-step gene transplacement with ssl2-rtt/pRS406. DG1772 was constructed by gene disrupting SSL2 with p1586 (ssl2::TRP1) in the presence of SSL2/pRS416. DG1775 (ssl2-rtt), DG1776 (ssl2-dead), DG1777 (ssl2-x/p), and DG1778 (SSL2-1) were created by plasmid shuffle as described by GULYAS and DONAHUE 1992 Down. DG1751 (ssl2-rtt) contains the inverted repeat ade2-5'{Delta}-TRP1-ade2-n integrated at the HIS3 locus and the ssl2-rtt mutation. This strain was constructed by crossing DG1722 (ssl2-rtt) with yAR71 (ade2-5'{Delta}-TRP1-ade2-n) and choosing a representative ascospore with the required genotype. yAR71 was kindly provided by A. RATTRAY (RATTRAY and SYMINGTON 1994 Down). A ssl2-rtt derivative (DG1758) of GRY1658 (MAT{alpha}-inc ::MUSH 21/18; generously provided by J. STRATHERN) containing a heteroallelic trp1 inverted repeat was constructed by two-step gene transplacement using Age I-cleaved ssl2-rtt/pRS406. BLY14, BLY15, and BLY18 were derived from DG1657 carrying pBM6 by replacing the genomic RAD3 locus with LEU2 by microhomologous recombination (MANIVASAKAM et al. 1995 Down), followed by plasmid shuffle with pRS414 plasmids carrying wild-type RAD3, rad3-rtta, and rad3-rttb, respectively. To replace the chromosomal RAD3 locus with the LEU2 gene by microhomologous recombination, two oligonucleotide primers, 357 and 358, were used to amplify the LEU2 gene from plasmid pBDG874. Primer 357 is a 59-mer oligonucleotide containing 39 nucleotides homologous with nucleotides present on the 5' end of the RAD3 open reading frame followed by 20 nucleotides homologous with the 5' untranslated region (UTR) of LEU2. Primer 358 is a 61-mer oligonucleotide containing 39 nucleotides homologous with nucleotides present on the 3' end of the RAD3 open reading frame followed by 21 nucleotides homologous with the 3' UTR of LEU2. The PCR product containing the LEU2 gene bracketed by sequences homologous with the 5' and 3' ends of RAD3 was introduced into competent DG1657 cells carrying plasmid pBM6 to generate BLY12 containing the chromosomal rad3::LEU2 disruption. DG1653 (rad25-799am) was derived from JC297 by two-step gene transplacement using plasmid pEP22 as described by PARK et al. 1992 Down. Congenic strains containing rad3-2 or RAD3, and Ty1-270his3-AI were created by multiple backcrosses between RM145-3D (kindly provided by R. MALONE, University of Iowa) and JC358, or JC364. The universal gene blaster technique (ALANI et al. 1987 Down) was used to introduce null mutations at the ADE2, LEU2, RAD52, or TRP1 loci in appropriate strains. All gene transplacements were verified by complementation or Southern analyses. Other strains are listed in Table 1 and described in the text. Media were prepared as described by SHERMAN et al. 1986 Down, BOEKE et al. 1984 Down, and AGUILERA 1994 Down. Certain dominance tests for the Rtt phenotype were performed in MAT{alpha}/{alpha} diploids to eliminate MATa/{alpha} repression of Ty1 transcription. MAT{alpha}/{alpha} strains were constructed by plating MATa::URA3/{alpha} strains on 5-fluoroorotic acid (5-FOA) medium and analyzing resistant colonies for their mating type. Sensitivity to UV radiation was determined as described by GULYAS and DONAHUE 1992 Down. Standard techniques for genetic analysis, such as tetrad dissection, gene transplacements, gap-repair transformation, and plasmid shuffle were used as described by SHERMAN et al. 1986 Down, or GUTHRIE and FINK 1991 Down.


 
View this table:
[in this window]
[in a new window]

 
Table 1. List of yeast strains

Plasmids:
Plasmids were constructed by standard procedures (SAMBROOK et al. 1989 Down). Vectors pRS406, pRS414, and pRS416 were kindly provided by R. SIKORSKI (SIKORSKI and HIETER 1989 Down). Plasmids SSL2/pRS416, ssl2-rtt/pRS416, SSL2/Y Ip5, and ssl2-rtt/pRS406 were constructed by subcloning a 4594-bp EcoRI-HindIII fragment containing SSL2 or ssl2-rtt from pCL59 or pBDG824, respectively, into the URA3-based centromere plasmid pRS416 or URA3-based integrating plasmids Y Ip5 (STRUHL et al. 1979 Down) or pRS406. Plasmid ssl2-AgeI-fi/pRS416 was constructed by digesting SSL2/pRS416 with AgeI, followed by fill-in synthesis with the Klenow fragment of DNA Polymerase I (New England Biolabs, Beverly, MA) and ligation with T4 DNA ligase (New England Biolabs). Plasmid RAD3/pRS414 was constructed by subcloning a 3592-bp SalI-KpnI fragment containing RAD3 from p1772 (kindly provided by T. DONAHUE, Indiana University) into the TRP1-based centromere plasmid pRS414. Plasmid pBM6 (kindly provided by B. MONTELONE, Kansas State University) carries the RAD3 gene in the URA3-based centromere plasmid YCplac33. The riboprobe plasmids pBDG689-ACT1, pBTB146-LYS2, and pBDG512-18S rDNA were constructed by subcloning a BamHI-EcoRI fragment containing ACT1 from pCEN-ACT1 (kindly provided by T. DUNN, Johns Hopkins University) into pBluescript KS (+), and EcoRI-HindIII fragment containing LYS2 from pSL42-2 (kindly provided by G. FINK, Whitehead Institute) into pSP70 (Promega, Madison, WI), and an EcoRI-HindIII fragment containing RDN1 18S rDNA from pRibH15 (kindly provided by A. HINNEBUSCH, National Institutes of Health) into pSP71 (Promega), respectively. Plasmids p1517 (ssl2-dead/YCp50), p1533 (SSL2/LEU2-CEN4), p1535 (SSL2-1/LEU2-CEN4), p1573 (ssl2-x/p/YCp50), and p1586 (ssl2::TRP1 disruption) were kindly provided by T. DONAHUE (GULYAS and DONAHUE 1992 Down), and pEP22 (rad25-799am/Y Ip5) was kindly provided by L. PRAKASH (PARK et al. 1992 Down). In collaboration with M. JAZWINSKI (Louisiana State University), pOY 1 was constructed by subcloning an AatII-BstEII fragment from phis4-912 (kindly provided by G. FINK) into pBDG604, replacing the GAL1 promoter and 5' end of Ty1-H3his3-AI in YCp50 with homologous sequences from the 5' end of Ty1-912. Plasmids pBDG456-Ty1, pBJC42-his3-AI, and pGTy1-H3his3-AI have been described previously (CURCIO et al. 1990 Down; CURCIO and GARFINKEL 1991 Down).

Isolation of rtt4-1/ssl2-rrt :
Ethylmethane sulfonate mutagenesis was performed with JC297 and JC358 as described by SHERMAN et al. 1986 Down. Cell viability ranged between 20 and 70%. Mutagenized cells were plated on YPD plates at a density of about 300 colony-forming units per plate. The plates were incubated at 20° for 5 days and then replica plated to SC-His plates. After 3 days incubated at 30°, the number of His+ papillae from each colony was determined. Most colonies showed <=1 His+ papilla per colony, which is similar to that of the parental strains. Strain JC358-6-24B (rtt4-1/ssL2-rtt) gave rise to >=10 His+ papillae per colony and was studied further.

Isolation of RTT4/SSL2:
The wild-type RTT4 gene was isolated by complementation of the recessive formamide-sensitivity conferred by rtt4-1 using a YCp50-based library (ROSE et al. 1987 Down). Candidate transformants were tested for Ty1-270his3-AI transposition and growth at 37°, which are also recessive traits caused by rtt4-1. The insert junctions from two plasmids isolated from independent Rtt+ transformants were sequenced using pBR322 primers (New England Biolabs) that flank the BamHI cloning site of YCp50. To obtain the rtt4-1/ssl2-rtt mutation, plasmid SSL2/pRS416 was digested by Bgl II and BlpI, which each cleave the plasmid once outside of the SSl2 coding region, to generate a plasmid fragment containing 128-bp and 635-bp of homologous sequences flanking the 5' and 3' ends of SSL2 coding sequence, respectively. The purified plasmid fragment was used to gap-repair the rtt4-1/ssL2-rtt mutation from DG1501 after transformation. The ssl2-rtt mutation was identified by DNA sequencing.

Isolation of rad3-rtt alleles:
To isolate rad3-rtt mutations, RAD3/pRS414 was mutagenized in vitro with hydroxylamine as described (ROSE et al. 1990 Down), and introduced into BLY 12. Trp+ transformants were replica plated to SC-Trp media containing 5-FOA followed by incubation at 20° for several days. The resulting colonies were replica plated to YPD medium, incubated at 20° for 6 days, and replica plated to SC-His plates. Ty1HIS3 transposition events were scored after incubation of the SC-His plates at 25° for 4 days. Colony prints containing >=5 His+ papillae were retested. Mutant plasmids were rescued from each transformant and reintroduced into BLY 12. BLY15 and BLY18 carrying rad3-rtta/pRS414 and rad3-rttb/pRS414, respectively, were obtained from BLY 12 by plasmid shuffle, and had Rtt- phenotypes equivalent to that of the original mutants.

Transposition assays:
For qualitative estimates of spontaneous Ty1his3-AI transposition, cells were either spread in 2 x 2-cm patches or streaked for single colonies on YPD plates and incubated at 20° for 5 days. The plates were then replica plated to SC-His plates and incubated at 25° or 30° for 4 days. The rate of spontaneous Ty1his3-AI transposition was determined as described by CURCIO and GARFINKEL 1991 Down, except that median frequencies were converted to rates according to the method of DRAKE 1970 Down. The rate of spontaneous Ty-induced can1 mutations was obtained by multiplying the mutation rate to can1 by the fraction of mutations caused by Ty insertion. The can1 mutation rate resulting from non-Ty events was determined by multiplying the can1 mutation rate by the fraction of mutants not caused by Ty insertion. The mutation rate to can1 was determined according to the method of DRAKE 1970 Down. The position of Ty insertions at CAN1 was determined as described by RINCKEL and GARFINKEL 1996 Down. The efficiency of pGTy1-H3his3-AI transposition was determined as described by CURCIO and GARFINKEL 1991 Down. Spontaneous transposition events upstream of glycine tRNA genes were detected after individual colonies were grown on YPD plates for 7 days at 20°. Six colonies were then individually inoculated into 10 ml of YPD and grown for an additional two days at 20°. Total DNA isolated from these cultures was analyzed by PCR using primers specific for the target site and Ty1 and Ty2. A glycine tRNA-specific primer SUF16 OUT, 5'GGATTTTACCACTAAACCACTT3', was chosen to detect Ty insertions upstream of glycine tRNA genes, and is located within the glycine tRNA transcription unit. The Ty-specific primer AX020, 5'CTATTACATTATGGGTGGTATG3', is near the Ty1 and Ty2 element's polypurine tract just inside of the 3' LTR. The SUF16 OUT oligonucleotide was 5'-end labeled using T4 polynucleotide kinase (New England Biolabs) and [{gamma}-32P]-ATP (Amersham, Arlington Heights, IL). PCR was performed using the following conditions: 10 cycles at 94°, 30 sec; 67°, 30 sec; 72°, 1 min followed by 20 cycles at 94°, 30 sec; 62°, 30 sec; 72°, 1 min. A portion of the reaction was separated by agarose gel electrophoresis on a 2% (w/v) gel. The gel was dried at 50° under vacuum, then autoradiographed. Control PCR amplifications using TRP1-specific primers were performed to insure that the DNA samples were PCR-competent.

Mitotic recombination:
Intrachromosomal mitotic recombination assays developed by RATTRAY and SYMINGTON 1994 Down, and J. STRATHERN (personal communication) were utilized essentially as described (RATTRAY and SYMINGTON 1994 Down), except that Noble agar (Difco, Detroit) was used in the SC-Ade plates. Median recombination rates were calculated by the method of DRAKE 1970 Down.

Northern blot analysis:
Yeast strains were grown at 20° in YPD or SC-Ura media to mid-to-late log (2–3 days incubation) or stationary (5 days incubation) phase. Total RNA was isolated, separated electrophoretically, and blotted to Hybond N (Amersham) nylon membranes as described previously (CURCIO et al. 1990 Down). 32P-labeled RNA probes were synthesized from plasmids pBDG689-ACT1, pBTB146-LYS2, pBDG512-18S rDNA, pBDG456-Ty1, and pBJC242-his3-AI by in vitro transcription (Promega). DNA probes were made by randomly primed DNA synthesis (Amersham) or 5'-end labeling using T4 polynucleotide kinase (United States Biochemical, Cleveland). A 3.6-kb PvuII fragment containing Ty1 sequences from pOY 1 was used to make the Ty1 hybridization probe. The Ty1-912/H3his3-AI and Ty1-270his3-AI probe was made from a 0.5-kb PstI fragment containing the his3-AI region from pOY 1. An isoleucine pre-tRNA probe was prepared by 5'-end labeling the 45 nucleotide intron of the tRNA as described previously (QIU et al. 1993 Down). Multiple probes were sometimes added to one filter, or single probes were sequentially added to the same filter after the previous probe was removed. Hybridization signals were quantitated by phosphorimage analysis using conditions suggested by the manufacturer (Molecular Dynamics, Inc., Sunnyvale, CA) and ImageQuant software (Version 1.1).

Protein analysis:
Total protein extracts were prepared as described by ATKIN et al. 1995 Down using a lysis buffer containing 5 mM EDTA, 250 mM NaCl, 0.1% (v/v) Nonidet P-40, 50 mM Tris-HCl (pH 7.4), 0.1 mM PMSF, and 1 µg/ml of each of the following protease inhibitors: pepstatin, leupeptin, aprotinin, antipain, and chymostatin. Endogenous VLPs from uninduced cells were fractionated by sedimentation through a sucrose step gradient as described previously (EICHINGER and BOEKE 1988 Down). Typically one liter of mid-to-late log phase cells grown in YPD broth was used for isolation of endogenous VLPs. VLPs from cells expressing pGTy1-H3his3-AI were prepared as described previously (EICHINGER and BOEKE 1988 Down). Protein concentrations were determined using commercially available reagents (BioRad Labs., Hercules, CA, or Pierce Chemical Co., Rockford, IL). Proteins separated on SDS-polyacrylamide gels were transferred to Immobilon-P membranes (Millipore, Bedford, MA) using a Bio Rad electrophoretic transfer apparatus or a semi-dry electroblotter (ISS Inc., Champaign, IL). After transfer, membrane-bound proteins were visualized with Ponceau S stain (Sigma Chemical Co., St. Louis). The polyclonal antisera to Ty1-VLPs, Ty1 IN, and Ty1 RT/RH are described in detail elsewhere (YOUNGREN et al. 1988 Down; GARFINKEL et al. 1991 Down). Antiserum to Hts1p was kindly provided by T. MASON (University of Massachusetts, Amherst). Immunodetection was performed using enhanced chemiluminscence (ECL) as described by the supplier (Amersham). ECL signals were quantitated by laser densitometry using an Ultroscan XL densitometer (LKB, Piscataway, NJ). Protein molecular weight standard were obtained from BioRad. Standard methods were used to prepare protein extracts from yeast and determine ß-galactosidase activity (ROSE et al. 1981 Down). One unit is defined as one nanomole o-nitrophenyl galactoside converted per mg protein per min.

Southern blot analysis of Ty1 cDNA:
A single colony of each strain inoculated into 1–2 ml of YPD broth was grown overnight at 20°. These cultures were diluted 100-fold into 20 ml YPD and grown for two days at 20°. Yeast DNA was prepared for Southern analysis as described by HOFFMAN and WINSTON 1987 Down. For detection of Ty1 VLP-associated cDNA, cellular extracts enriched for VLPs were deproteinized with phenol and total nucleic acid was recovered as described by GARFINKEL et al. 1985 Down. DNA samples digested with PvuII were separated by 0.8% (w/v) agarose gel electrophoresis, and capillary-blotted to Hybond N+ nylon membrane (Amersham). The resulting filter was hybridized with a randomly-primed 32P-labeled Ty1-H3 PvuII-SnaB1 fragment that spans the Ty1 RT/RH gene. Four conserved Ty1-chromosomal junction fragments were used as internal standards to normalize the level of Ty1 cDNA in each sample. Hybridization signals were quantitated by phosphorimage analysis as described above.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Isolation of rtt4-1 (ssl2-rtt):
rtt4-1 came from a collection of 143 chromosomal mutants that display a high frequency of putative Ty1 transposition events, as monitored by the increased level of His+ prototroph formation by a genomic element Ty1-270 marked with the retrotransposition indicator gene, his3-AI (Figure 1A and Figure B) (CURCIO and GARFINKEL 1991 Down). The original rtt4-1 mutant, JC358-6-24B, was temperature sensitive for growth at 37°, weakly sensitive to UV radiation, and sensitive to 3% formamide in the growth medium. JC358-6-24B was backcrossed three times to the parental strains JC297 or JC358 to generate congenic MATa and MAT{alpha} strains DG1502 and DG1501 (Figure 1C), respectively. The temperature and formamide sensitivities, and the Rtt- phenotype, as monitored by Ty1-270his3-AI His+ levels, were recessive and tightly linked in each backcross. These results suggest that a single mutation is responsible for the three phenotypes. When the rate of His+ formation was determined in congenic rtt4-1 strains DG1501 and DG1502, and the RTT4 strain JC297, the rtt4-1 mutation caused a 400- to 1125-fold increase in Ty1-270his3-AI mediated His+ events (Table 2A). Southern analysis of 24 independent His+ events from either DG1501 or JC297 grown at 20° was performed using a 32P-labeled HIS3 probe, and each isolate contained a single Ty1HIS3 element present at apparently novel sites (data not shown).



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. —Experimental system used to isolate rtt4-1/ssl2-rtt. (A) Ty1 life cycle. Ty1 elements reside in the nuclear genome where they are transcribed. Ty1 RNA is terminally redundant because directly repeated LTR (long terminal repeat) sequences present at the ends of the element are transcribed (boxed arrows point in the direction of Ty1 transcription). Ty1 RNA directs the synthesis of proteins that are essential for transposition. These include capsid proteins of the virus-like particle (VLP), and enzymes required for protein processing, reverse transcription, and integration. Ty1-VLPs do not leave the cell. A preintegration complex made up of at least integrase and Ty1 cDNA probably journeys back to the nucleus where integration takes place. (B) Phenotypic detection of transposition of a genomic Ty1 element marked with the retrotransposition indicator gene his3-AI. The Ty1 element is tagged at the 3' end with his3-AI, which is the yeast HIS3 gene interrupted by an artificial intron, AI. Boxed area represents the HIS3 gene and its direction of transcription, opposite to that of Ty1, is shown by the enclosed arrow. AI, represented by the thin line, is inserted into the HIS3 coding sequence in an antisense orientation relative to HIS3 transcription, as indicated by the arrow below the AI. Cells containing his3-AI are phenotypically His-. AI, however, is in the sense orientation relative to the Ty1 transcript. The Ty1 transcript is represented by the wavy line and splicing of the AI is indicated by vertical lines in the Ty1 transcript. When a spliced transcript undergoes retrotransposition, a new copy of the element with a functional HIS3 gene (Ty1HIS3) is recreated by precise removal of the AI. This duplicative transposition event renders the cell phenotypically His+. The transposition event is shown as occurring on the same chromosome for simplicity. (C) Increased levels of Ty1 transposition in a rtt4-1/ssl2-rtt background, as monitored by chromosomal Ty1-270his3-AI transposition. Parental (JC297; RTT4/SSL2) and mutant (DG1501; rtt4-1/ssl2-rtt) strains were streaked for single colonies on a YPD plate and incubated for 5 days at 20°. Spontaneous Ty1HIS3 transposition events were detected as His+ papillae by replica plating the YPD plate to SC-His medium, followed by incubation for 4 days at 25°.


 
View this table:
[in this window]
[in a new window]

 
Table 2. Transposition of Ty1his3-AI elements

rtt4-1 is an allele of SSL2 (RAD25):
The results of the preceding experiments served as the basis for cloning the wild-type RTT4 gene. The RTT4 gene was cloned from a YCp50 genomic library (ROSE et al. 1987 Down) by complementation of the rtt4-1 formamide-sensitive phenotype. Candidate transformants were then tested for growth at 37° and Ty1-270his3-AI transposition. Plasmids were isolated from two formamide-resistant, temperature- resistant, Rtt+ transformants that were suspected to contain the wild-type RTT4 gene. These plasmids contained overlapping inserts, as demonstrated by restriction enzyme and DNA sequence analyses (Saccharomyces Genome Data Base, Stanford University). The only complete gene common to both cloned inserts was SSL2 (also known as RAD25), an essential gene involved in RNA Pol II transcription and NER (GULYAS and DONAHUE 1992 Down; PARK et al. 1992 Down; FEAVER et al. 1993 Down; GUZDER et al. 1994B Down). A 4594-bp EcoRI-HindIII fragment containing SSL2 was subcloned into the centromere plasmid pRS416 and the integrating vector YIp5. The RTT4/SSL2/pRS416 subclone complemented all mutant defects conferred by rtt4-1. This plasmid also complemented the severe UV-sensitivity of a previously characterized ssl2 mutation, rad25-799am (PARK et al. 1992 Down), in strain DG1653. When a frameshift mutation was introduced into the middle of the SSL2 coding sequence by filling in an AgeI restriction site, the resulting ssl2-AgeI-fi/pRS416 plasmid failed to complement rtt4-1 and rad25-799am, and was recessive to wild-type SSL2. Crossing a SSL2 strain (DG1626) containing a SSL2/YIp5 plasmid integrated at SSL2 with a rtt4-1 strain (DG1501) demonstrated tight linkage between rtt4-1 and the integrated URA3 marker present on YIp5 (16 parental ditype: 0 nonparental ditype: 0 tetratype asci). We now refer to rtt4-1 as ssl2-rtt, since these results show that rtt4-1 is an allele of SSL2.

The ssl2-rtt region was rescued from DG1501 by gap-repair recombination. The resulting plasmid showed no gross rearrangement of the EcoRI-HindIII insert or the plasmid backbone, as monitored by restriction enzyme analysis. The ssl2-rtt/pRS416 centromere plasmid failed to complement the ssl2-rtt mutation, and the plasmid-borne ssl2-rtt mutation was recessive to wild-type SSL2 and rad25-799am with respect to the Rtt- phenotype. The DNA sequence of the EcoRI-HindIII fragment present in the gap-repaired ssl2-rtt/pRS416 plasmid was determined and shown to be identical to that of SSL2, except for a G->A transition at codon 556, which changes glutamic acid (GAG) to lysine (AAG). This mutation was confirmed by direct sequencing of PCR-generated SSL2 and ssl2-rtt alleles from our strains, and transformation experiments using PCR fragments spanning codon 556 of SSL2 (data not shown). Codon 556 is located between the conserved helicase sequence motifs III and IV (WALKER et al. 1982 Down) of SSL2, and the glutamic acid codon at this position is conserved in human XPB/ERCC-3 and Drosophila haywire. Surprisingly, QIU et al. 1993 Down showed that a temperature sensitive ssl2 allele, rad25-ts24, generated by in vitro mutagenesis with hydroxylamine, contains both a V552I mutation and the identical ssl2-rtt E556K mutation.

An isogenic ssl2-rtt derivative of GRF167, DG1722, was constructed by two-step gene transplacement using a ssl2-rtt/pRS406 integrating plasmid for further studies of Ty1 transposition. DG1722 and the congenic strains, DG1501 and DG1502, had similar growth characteristics. We initially examined Ty1his3-AI transposition (Table 2B) to determine whether this key phenotype was maintained in DG1722. Since GRF167 does not contain a genomic Ty1his3-AI element, a functional Ty1-912/H3his3-AI hybrid element present on the centromere plasmid YCp50 (pOY1) was introduced into DG1722 and GRF167, and Ty1-912/H3his3-AI transposition rates were determined in the resulting transformants, DG1721 and DG1725, respectively. The 180-fold stimulation in the rate of His+ formation observed in DG1721 (ssl2-rtt) is comparable to the increase in transposition we obtained with the genomic Ty1-270his3-AI element in congenic SSL2 and ssl2-rtt strains.

Ty1 retrotransposition and target site preferences:
To characterize ssl2-rtt-stimulated Ty1 transposition events at specific chromosomal targets, we compared the efficiency and target site preferences of Ty1 insertions at the CAN1 and glycine tRNA genes in ssl2-rtt and SSL2 strains. These genes have been shown to be reliable targets for measuring the efficiency and insertion site preferences of Ty1 elements (WILKE et al. 1989 Down; RINCKEL and GARFINKEL 1996 Down; JI et al. 1993 Down; DEVINE and BOEKE 1996 Down). The CAN1 gene encodes an arginine permease (BROACH et al. 1979 Down). Loss of gene function at this locus causes resistance to canavanine, a toxic arginine analog. Two pairs of ssl2-rtt and SSL2 strains were used: the congenic strains DG1501 (ssl2-rtt) and JC297 (SSL2), and the isogenic strains DG1721 (ssl2-rtt) and DG1725 (SSL2). The spontaneous rate of mutation to canavanine resistance was 1.6- or 3.7-fold higher in the ssl2-rtt mutant strains DG1501 or DG1721 when compared to the rate obtained in the parental strains JC297 or DG1725, respectively (Table 3). To determine the fraction of can1 mutants that were caused by Ty1 insertional mutagensis, 23 or 24 independent mutants from each strain were analyzed by PCR for Ty1 insertions within a 2.3-kb interval spanning the CAN1 locus as described by RINCKEL and GARFINKEL 1996 Down. The fraction of spontaneous Ty1-induced can1 mutants increased by six-fold in the ssl2-rtt mutants. Therefore, the overall rate of transposition into CAN1 increased between 10.4- to 24-fold in the ssl2-rtt mutant. Rate measurements at CAN1 obtained in both sets of experiments were also used to determine whether all of the observed increase in can1 mutations was due to Ty1 insertions. Since the average rate of non-Ty1-induced mutagenic events is about the same in SSL2 strains (3.7 x 10-8) as in the ssl2-rtt strains (2 x 10-8), Ty1 transposition can account for the weak mutator phenotype observed at CAN1 in the ssl2-rtt strains.


 
View this table:
[in this window]
[in a new window]

 
Table 3. Ty1 insertional mutagenesis of CAN1

To address the possibility that the apparent increase in transposition rate at CAN1 was caused by expression bias in the ssl2-rtt mutant (DG1721), we reintroduced the wild-type SSL2 gene by mating all of the Ty1-induced can1 mutants obtained from DG1721 with DG1044 (mat-{Delta}::URA3 can1 SSL2). Since can1 and ssl2-rtt mutations are recessive, the diploid strains should become sensitive to canavanine if the Ty1-induced can1 mutations were dependent on ssl2-rtt. Inclusion of the mat mutation was in DG1044 eliminated the regulatory effects of the MAT locus on Ty1 transcription in diploids (ERREDE et al. 1980 Down). All of the Ty1-induced can1 mutants remained canavanine-resistant in the ssl2-rtt/SSL2 diploid, whereas the diploids made with the parental strains DG1721 and DG1725 were canavanine-sensitive. Therefore, expression bias does not account for the increase in Ty1-induced mutagenesis at CAN1.

The insertion sites of spontaneous Ty1 transposition events in DG1721 (ssl2-rtt) and DG1725 (SSL2) were obtained by sequencing the 5' Ty1/CAN1 junction to determine whether the ssl2-rtt mutation affected target site preferences. The GRF167 strain background was advantageous to use for target site analysis because we have mapped a large number of pGTy1-H3his3-AI insertions at CAN1 in this strain (RINCKEL and GARFINKEL 1996 Down). In DG1721, 40% (8/20) of the Ty1 insertions were distributed throughout the 300-bp CAN1 promoter region, while the remaining 60% (12/20) were inserted in CAN1 coding sequence. All insertions appeared normal, as suggested by the presence of a typical 5-bp target site duplication at the 5' Ty1/CAN1 junction. Chi square analysis ({chi}2 = 1.2; P = 0.2) suggests that the insertion sites utilized by Ty1 in the ssl2-rtt mutant resemble those utilized when pGTy1-H3his3-AI was induced in the parental SSL2 strain GRF167 [53% promoter insertions (67/126) and 47% (59/126) coding sequence insertions; RINCKEL and GARFINKEL 1996]. All of the Tyl promoter insertions were in the same transcriptional orientation as that of the CAN1 gene, a bias that has been observed previously. Therefore, the ssl2-rtt mutation allows the normal spectrum of CAN1 insertion sites to be used 10.4- to 24-fold more efficiently.

To determine whether the ssl2-rtt mutation affected Ty transposition in an unselected population of cells, we modified the genetic footprinting technique of SMITH et al. 1995 Down so that spontaneous unmarked Tyl (and Ty2) insertions could be monitored at a known Ty1 hotspot (Figure 2). Genomic regions upstream of the 16 dispersed glycine tRNA genes were chosen because this region of the SUF16 glycine tRNA gene on chromosome III is a hotspot for Ty1 transposition in transposition-induced cells ( JI et al. 1993 Down; DEVINE and BOEKE 1996 Down). GRF167 (SSL2), DG1722 (ssl2-rtt), and DG789 (spt3-101) were grown on YPD plates for 7 days at 20°. Six colonies per strain were then inoculated into individual YPD liquid cultures. After two days incubation at 20°, DNA was prepared from each of the six cultures for PCR analysis. The PCR reactions for detecting Ty insertions contained a 32P-labeled primer homologous to sequences within 16 glycine tRNA genes (SUF16 OUT) and an unlabeled Ty primer (AX020) homologous with the polypurine tract of Ty1 and Ty2 elements. We will refer to all the transposition events detected in this assay as resulting from Ty1 elements; however, some Ty2 insertions may also be present (CURCIO et al. 1990 Down). The resulting products were separated by agarose gel electrophoresis and visualized by autoradiography. When the Ty1 insertion pattern of DG1722 (ssl2-rtt) is compared to GRF167 (SSL2) and DG789 (spt3-101), the ssl2-rtt mutation greatly stimulates the level of Ty1 transposition events upstream of glycine tRNA genes. Similar insertion patterns and product yield detected by PCR within each group of six independent cultures provide evidence that similar insertion sites were utilized. The majority of Ty1 insertions occurred between 160 and 860 bp upstream of the glycine tRNA genes in GRF167 (SSL2) and DG1722 (ssl2-rtt), and the pattern of insertions was also similar. An exceptionally intense band in one of the DG1722 cultures suggests that a Ty1 insertion occurred very early in cell growth, creating a "jackpot" event. A negative control was provided by DG789, a spt3-101 derivative of GRF167, in which Ty1 transcription (WINSTON et al. 1984 Down) and transposition (BOEKE et al. 1986 Down) is severely reduced. All DNA samples were PCR-competent, as demonstrated from control reactions in which oligonucleotide primers specific to the TRP1 gene were substituted for primers SUF16 OUT and AX020 (data not shown). Our results suggest that the hotspot upstream of glycine tRNA genes is utilized more efficiently by Ty1 in the ssl2-rtt background. Since the regions upstream of 16 dispersed glycine tRNA genes including SUF16 are being monitored in this experiment, we cannot distinguish the relative contribution of each locus to the total transposition signal.



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2.ssl2-rtt increases the spontaneous Ty1 and Ty2 transposition events upstream of glycine tRNA genes. Schematic representation of a typical glycine tRNA gene is at the top. tRNA gene and direction of transcription is shown by the open arrow. Ty1 [for simplicity we will refer to all the transposition events detected in this assay as resulting from Ty1 elements; however, Ty2 insertions may also be present (CURCIO et al. 1990 Down)] insertions occur between 160 and 860 base pairs (bp) upstream of one or more of the 16 glycine tRNA genes dispersed in the yeast genome. Oligonucleotide primers used for PCR amplifications are designated SUF16 OUT and AX020, which are homologous with glycine tRNA genes, and Ty1 and Ty2 elements, respectively. Below are the patterns of Ty1 insertions upstream of the glycine tRNA genes from the isogenic strains GRF167 (SSL2), DG1722 (ssl2-rtt), and DG789 (spt3-101). DNA from 6 independent colonies of each strain was analyzed by PCR using a 32P-labeled SUF16 OUT primer and an unlabeled AX020 primer. PCR products were separated by electrophoresis on a 2% agarose gel. The gel was dried and autoradiographed. Alongside the autoradiograph are size standards in base pairs (bp).

Level of Ty1 cDNA and chromosomal recombination:
To determine if ssl2-rtt stimulates both Ty1 cDNA recombination and transposition or just Ty1 transposition, we performed a Ty1his3-AI transposition assay in a rad52 ssl2-rtt double mutant (Table 2C and Table 2D). Ty1 transposition is moderately elevated in a rad52 mutant background (CURCIO and GARFINKEL 1994 Down), but cDNA recombination is strongly dependent on RAD52 (SHARON et al. 1994 Down). The appropriate strains were made by crossing DG1501 with DG1520, a rad52-hisG::URA3 mutant that was derived from a strain (JC364) closely related to the parental SSL2 strains JC297 and JC358. Fifteen tetrads were analyzed and representative rad52-hisG::URA3 (DG1636), ssl2-rtt (DG1637), rad52-hisG::URA3 ssl2-rtt (DG1638), and RAD52 SSL2 (DG1639) ascosporal derivatives were chosen to determine Ty1-270his3-AI transposition rates (Table 2C and Table 2D). As expected, the rad52-hisG::URA3 mutants (DG1520 and DG1636) had higher transposition rates than the RAD52 strains (JC364 and DG1639). The transposition rate was about 40-fold higher in the ssl2-rtt rad52-hisG::URA3 mutant (DG1638) than in the rad52-hisG::URA3 mutant (DG1636). This result suggests that ssl2-rtt primarily stimulates Ty1 transposition and not cDNA recombination, because the ssl2-rtt-mediated increase in Ty1 transposition is independent of RAD52. The rate of Ty1-270his3-AI transposition was also about two-fold higher in the rad52-hisG::URA3 ssl2-rtt double mutant (DG1638) than in the ssl2-rtt strain (DG1637), suggesting that RAD52 and SSL2 belong to different epistasis groups with respect to inhibiting Ty1 transposition.

Since certain mutations in the NER/TFIIH subunit gene RAD3 stimulate the frequency of mitotic recombination (MONTELONE et al. 1988 Down; SONG et al. 1990 Down; BAILIS et al. 1995 Down), we determined whether ssl2-rtt affected the overall frequency of mitotic recombination using ade2 or trp1 heteroalleles present in inverted repeat orientations at the MAT or HIS3 loci, respectively (Table 4). Appropriate strains were made by a genetic cross (DG1751) or two-step gene transplacement (DG1758), and mitotic recombination rates were determined as described by RATTRAY and SYMINGTON 1994 Down. The ssl2-rtt mutant strains DG1751 and DG1758, and SSL2 parental strains yAR71 and GRY1658 had similar rates of mitotic recombination at either the ade2 or trp1 loci, respectively. Taken together, these results indicated that Ty1-270his3-AI-mediated His+ formation faithfully reflects the overall level of Ty1 transposition in the cell, and that mitotic recombination remains at wild-type levels in the ssl2-rtt mutant strains.


 
View this table:
[in this window]
[in a new window]

 
Table 4. Effect of ssl2-rtt on mitotic recombination

Other ssl2 alleles influence Ty1 transposition:
We analyzed four SSL2/RAD25 alleles for their ability to modulate Ty1 transposition using the Ty1-270his3-AI assay. The SSL2-1 mutation was originally isolated as a dominant suppressor of his4-316, a mutation created by a 36-bp insertion with perfect dyad symmetry placed in the 5' untranslated region of HIS4 (CIGAN et al. 1988 Down; GULYAS and DONAHUE 1992 Down). The ssl2-x/p and rad25-799am mutations contain a 3' truncation of the gene that should eliminate 94 and 45 C-terminal amino acid residues, respectively, from the Ssl2p/Rad25p (GULYAS and DONAHUE 1992 Down; PARK et al. 1992 Down). These mutations were designed to resemble the truncated protein predicted to be present in a XP patient (WEEDA et al. 1990 Down). The final mutation analyzed, ssl2-dead, contains a mutation in nucleotide binding motif II (WALKER et al. 1982 Down) of the Ssl2p DNA helicase (GULYAS and DONAHUE 1992 Down).

Strains containing these mutations, as well as ssl2-rtt, were constructed either by a plasmid shuffle in which a plasmid-borne copy of the wild-type SSL2 gene was replaced with centromere plasmids containing ssl2-rtt, SSL2-1, ssl2-x/p, or ssl2-dead in a ssl2::TRP1 disruption background, or by two-step gene transplacement in the case of the rad25-799am mutation. All strains had the expected phenotypes, except that DG1777 (ssl2-x/p) did not grow at 37°. This result is somewhat surprising since DG1653 (rad25-799am) also contains a C-terminal truncation of Ssl2p and is sensitive to UV radiation, but grows well at 37°. The rad25-799am mutation failed to complement the UV-sensitivity of the ssl2-x/p allele, but did complement the temperature-sensitive phenotype of ssl2-x/p. When the rates of Ty1 transposition were determined in these strains, only rad25-799am did not markedly stimulate transposition (Table 5). The ssl2-dead and ssl2-rtt mutations caused the strongest Rtt- phenotypes, whereas SSL2-1 and ssl2-x/p had slightly weaker effects. The transposition rate of the ssl2-rtt strain DG1775 (Table 5) was more than 10-fold lower than the rate in DG1501 and DG1502 (Table 2A), even though the SSL2 parental strains (DG1772 and JC297) had comparable transposition rates. This difference in transposition rate probably results from a low copy gene-dosage effect of the ssl2-rtt/pRS416 plasmid in strain DG1775 and applies to the other ssl2 plasmids as well.


 
View this table:
[in this window]
[in a new window]

 
Table 5. Allele-specific stimulation of Ty1 transposition

SSL2-1 was found to be recessive with respect to stimulating Ty1 transposition by two genetic tests, even though it is a dominant suppressor of his4-316. In the first dominance test, no change in the Rtt phenotype was observed when a SSL2-1/LEU2-CEN plasmid was introduced into the SSL2 strain JC364, as monitored by the qualitative Ty1-270his3-AI transposition assay. In the second test, we utilized the plasmid shuffle technique described above to create strains containing a chromosomal ssl2::TRP1 null mutation, and centromere plasmids with SSL2-1 or SSL2. The increased level of Ty1 transposition observed with the SSL2-1 mutant was reduced to wild-type levels when the SSL2/pRS416 plasmid was also present in the same cell.

The ssl2-rtt mutation does not suppress his4-316:
Since SSL2-1 was identified as an extragenic suppressor of his4-316, we determined whether ssl2-rtt also suppresses his4-316. GULYAS and DONAHUE 1992 Down reported that ssl2-x/p does not suppress his4-316; ssl2-dead was not analyzed in their study. We constructed a ssl2-rtt strain (DG1793) that is isogenic with the SSL2-1 strain JJ586 and the parental SSL2 strain JJ565 by two-step gene transplacement. As expected, SSL2-1 suppressed the his4-316 mutation. Cells containing his4-316, and SSL2 or ssl2-rtt grew poorly on media lacking histidine after extended incubation of 7 days. All strains grew well when histidine was added to the medium. These results indicate that ssl2-rtt does not suppress his4-316.

Posttranslational regulation of Ty1 transposition by SSL2:
To determine whether the ssl2-rtt mutation affects Ty1 or Ty1his3-AI RNA levels, quantitative Northern hybridizations were performed with RNA extracted from cells grown under the same conditions as those used for measuring Ty1his3-AI transposition (Figure 3 and Figure 4). Most of the analyses were performed with RNA extracted from mid-to-late log phase cells. An additional experiment was included using RNA extracted from stationary-phase cells to examine the effects of another growth phase on Ty1 and Ty1-his3-AI RNA levels (Figure 4, lanes 7–8). In the first set of experiments (Figure 3), phosphorimage analysis of the hybridization filters showed no increase in the steady-state level of total Ty1 or Ty1-270his3-AI RNA relative to control transcripts from genes transcribed by RNA Pol II (ACT1 and LYS2) or Pol I (18S rRNA) when the ssl2-rtt strains DG1501 and DG1502, and the congenic parental strains JC297 and JC358 were compared.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. —Level of Ty1-270his3-AI and Ty1 RNA is unchanged in the ssl2-rtt mutant. Northern analysis of congenic ssl2-rtt strains DG1501 (lane 1) and DG1502 (lane 2), and SSL2 parental strains JC297 (lane 3) and JC358 (lane 4). Cells were grown to mid-to-late log phase in YPD broth at 20°. Ten micrograms of total RNA extracted from each cell culture was separated by electrophoresis on a 1% agarose gel, and blotted to Hybond N membranes. In the top two panels, filters were hybridized with radiolabeled probes specific for his3-AI and Ty1. In the next three panels, filters were hybridized with probes specific for ACT1 (actin) and LYS2 transcripts, and 18S rRNA to ensure that equivalent amounts of RNA were analyzed from these strains.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. —Levels of Ty1-912/H3his3-AI, Ty1-270his3-AI, and Ty1 RNA remain unaltered in various ssl2 mutants. Northern analysis of isogenic strains DG1725 (SSL2; lane 1) and DG1721 (ssl2-rtt ; lane 2), and isogenic strains DG1774 (SSL2; lane 3), DG1775 (ssl2-rtt ; lane 4), DG1776 (ssl2-dead; lane 5), and DG1778 (SSL2-1; lane 6) was performed as described in Figure 3 except that DG1721 and DG1725 were grown in SC-Ura medium to select for the maintenance of pOY1. Northern analysis of strains DG1774 (SSL2; lane 7) and DG1775 (ssl2-rtt ; lane 8) grown to stationary phase was also included to examine Ty1 RNA levels under another growth condition. In the top panel, a 32P-labeled his3-AI DNA probe was used to detect Ty1-912/H3his3-AI (lanes 1 and 2) or Ty1-270his3-AI (lanes 3–8) RNA levels. In the middle and lower panels, DNA probes specific for Ty1 and the isoleucine tRNA intron (tRNAI) were used to detect Ty1 RNA and isoleucine pre-tRNA levels, respectively.

Since the loading controls in the preceding experiment were transcripts from genes either transcribed by RNA Pol I or Pol II, there may be unforeseen effects on transcription of these genes in a ssl2-rtt mutant. QIU et al. 1993 Down reported that rad25-ts24 affects both RNA Pol II transcription and rRNA synthesis at the nonpermissive temperature, but it does not affect the rate of RNA Pol III-mediated transcription of isoleucine tRNA genes, as monitored using a hybridization probe homologous with the rapidly-processed isoleucine tRNA intron. Therefore, we examined additional ssl2 mutants using an isoleucine tRNA (tRNAI) as a loading control in a second set of Northerns that were quantitated by phosphorimage analysis (Figure 4). Total RNA was prepared from the isogenic strains DG1725 (SSL2 ; lane 1) and DG1721 (ssl2-rtt ; lane 2), and isogenic strains DG1774 (SSL2; lane 3), DG1775 (ssl2-rtt ; lane 4), DG1776 (ssl2-dead; lane 5), and DG1778 (SSL2-1; lane 6) and treated as described above, except that strains DG1721 and DG1725 were grown in SC-Ura medium to select for plasmid pOY 1. The results show that total Ty1 (lanes 1–6), Ty1-912/H3his3-AI (lanes 1 and 2), and Ty1-270his3-AI (lanes 3–6) RNA levels were not altered by the ssl2 mutations when normalized to the isoleucine pre-tRNA level. Ty1 RNA levels also remained unaltered when DG1774 (SSL2 ; lane 7) and DG1775 (ssl2-rtt ; lane 8) were grown to stationary phase.

The formation of the mature Ty1 proteins is indicative of high levels of transposition, and therefore, may be one of the steps in the retrotransposition cycle subject to inhibition (CURCIO and GARFINKEL 1992 Down). To examine the expression of Ty1 proteins, we initially determined the level of ß-galactosidase activity from a genomic Ty1::lacZ gene fusion in which the E. coli lacZ gene was inserted in-frame in the IN coding region of a chromosomal Ty1 element. ß-galactosidase assays were performed on total cell extracts from ssl2-rtt and wild-type strains. There was no apparent difference in ß-galactosidase activity between the SSL2 strains JC297 (4.4 units) and JC358 (2.5 units), and the ssl2-rtt mutants DG1501 (4.5 units) and DG1502 (2.7 units). S288C and GRF167, which lack the Ty1::lacZ fusion, had 0.5 units and 0.4 units of activity, respectively. We also determined that the ssl2-rtt mutation did not change the level of TYA1-TYB1 frameshifting (data not shown), as monitored by expression of lacZ fusions with or without the Ty1 frameshift signal (BELCOURT and FARABAUGH 1990 Down).

To determine whether the ssl2 mutations affected the level of endogenous Ty1 proteins, total cell protein (Figure 5) or partially purified Ty1-VLPs (Figure 6) were analyzed by immunoblotting using antisera that recognize TyA1 protein p54 and its full-length precursor p58, IN, or RT/RH. The level of TyA1 proteins was analyzed from mid-to-late log phase cells (Figure 5, lanes 2–8) and from stationary phase cells (Figure 5, lanes 9 and 10). The immunoblots included proteins from the SSL2 strain DG1741 (pGTy1-H3his3-AI ) that had been induced for transposition by growth in galactose to mark the positions of Ty1 proteins. Protein was also analyzed from the spt3-101 mutant DG789 that is defective for Ty1 expression. An immunoblot from a SDS-polyacrylamide gel loaded with equal amounts of total cell protein (Figure 5) from isogenic strains DG1741 (pGTy1-H3his3-AI; lane 1), DG789 (spt3-101; lane 2), DG1722 (ssl2-rtt ; lane 3), GRF167 (SSL2; lane 4), and isogenic strains DG1774 (SSL2; lane 5), DG1775 (ssl2-rtt; lane 6), DG1776 (ssl2-dead; lane 7), and DG1778 (SSL2-1; lane 8) was incubated with VLP (Figure 5A) or Hts1 antisera (Figure 5B) to detect TyA1 proteins or heat shock protein Hts1p, respectively. The amount of endogenous p58-TyA1 and p54-TyA1 was about the same for all of the strains when normalized to the total protein present or the Hts1p loading control by Ponceau S staining and laser densitometry. Similar TyA1 protein levels were observed when total protein was extracted from DG1774 (SSL2; lane 9) and DG1775 (ssl2-rtt ; lane 10) strains that had been grown to stationary phase. In agreement with the immunoblot analysis, pulse-chase immunoprecipitations of TyA1 proteins suggest that the kinetics of protein processing remain unaltered in a ssl2-rtt mutant (data not shown).



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. —Levels of endogenous TyA1 proteins are not altered in various ssl2 mutants. Total cell protein extracts were prepared from isogenic strains DG1741 (SSL2, pGTy1-H3his3-AI; lane 1), DG789 (spt3-101; lane 2), DG1722 (ssl2-rtt ; lane 3), and GRF167 (SSL2; lane 4), and isogenic strains DG1774 (SSL2; lane 5), DG1775 (ssl2-rtt ; lane 6), DG1776 (ssl2-dead; lane 7), and DG1778 (SSL2-1; lane 8) that had been grown in either SC-Ura galactose (lane 1) or YPD (lanes 2–8) to mid-to-late log phase. Total cell protein from strains DG1774 (SSL2; lane 9) and DG1775 (ssl2-rtt ; lane 10) grown to stationary phase was also included to examine TyA1 protein level under another growth condition. Transposition-induced strain DG1741 (lane 1; approximately 0.5 µg) served as a marker for endogenous TyA1 proteins from the other strains (lanes 2–10). Approximately 15 µg of total protein was loaded in lanes 2–10, separated by 7.5% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to an Immobilon P membrane, and incubated with VLP (A) or Hst1p(B) polyclonal antisera. Immunodetection was performed using enhanced chemiluminescence (ECL) (Amersham). The position of molecular size markers in kilodaltons (kD), TyA1 proteins p58 and p54, and Hts1p are shown alongside the figure.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. —Levels of TyA1 and TyB1 proteins from endogenous VLPs isolated from SSL2 wild-type and ssl2-rtt mutant strains are unaltered. Partially purified VLPs were isolated from isogenic strains DG1741 (SSL2, pGTy1-H3his3-AI; lane 1), DG789 (spt3-101; lane 2), GRF167 (SSL2; lane 3), and DG1722 (ssl2-rtt ; lane 4) and separated by 8% SDS-PAGE. (A) Approximately 0.3 µg of protein was analyzed in lanes 2–4, (B and C) 15 µg of protein was analyzed in lanes 2–4, and (A) 0.02 µg and (B and C) 0.3 µg of protein was added in lane 1. The amount of protein was adjusted because of the greater abundance of TyA1 proteins compared to TyB1 proteins in the cell, and because DG1741 was induced for transposition prior to VLP isolation. VLPs from DG1741 (lane 1) served as a marker for Ty1 proteins. After transfer to Immobilon P membranes, individual blots were incubated with either (A) VLP, (B) RT/RH, or (C) IN polyclonal antisera. Immunodetection was performed using ECL. Molecular size standards (kD) and positions of proteins are indicated.

To determine whether ssl2-rtt affects the level of mature Ty1 IN and RT/RH, we partially purified endogenous Ty1-VLPs by sucrose-step gradient centrifugation and analyzed equivalent samples of Ty1 proteins by immunoblotting (Figure 6). This approach was necessary because we could not detect mature IN or RT/RH in total cell extracts from ssl2-rtt or SSL2 strains DG1722 and GRF167, respectively (data not shown). VLPs were isolated from DG1741 (SSL2; pGTy1-H3his3-AI; lane 1), DG789 (spt3-101; lane 2), GRF167 (SSL2; lane 3), and DG1722 (ssl2-rtt ; lane 4) and the resulting filters were incubated with antisera against VLPs (Figure 6A), RT/RH (Figure 6B), and IN (Figure 6C). p54 was the major TyA1 protein present in VLPs from transposition- induced cells (Figure 6A, lane 1), and in endogenous VLPs from SSL2 (Figure 6A, lane 3) and ssl2-rtt (Figure 6A, lane 4) strains. The RT/RH antiserum (Figure 6B) reacted with the p190 (TyA1-TyB1), p160 (PR-IN-RT/RH), and p140 (IN-RT/RH) precursors and mature RT/RH (p60) present in endogenous VLPs from the SSL2 (Figure 6B, lane 3) and ssl2-rrt (Figure 6B, lane 4) strains. Similar results were obtained when IN antiserum was used (Figure 6C, lanes 3 and 4; data not shown). Mature p54-TyA1, RT/RH, and IN obtained from endogenous SSL2 (lane 3) and ssl2-rtt (lane 4) VLPs had similar electrophoretic mobilities as the cognate proteins from transposition induced cells (lane 1). Similar amounts of Ty1 proteins were present in the VLPs from SSL2 and ssl2-rtt strains. As expected, Ty1 proteins were not detected from DG789 (lane 2).

These results suggest that SSL2 inhibits Ty1 transposition at the posttranslational level. If Ty1 VLP functions are inhibited by SSL2, then VLPs isolated from a ssl2-rtt strain may have an increased level of reverse transcriptase or integrase activities in vitro. However, we were not able to reproducibly detect these activities from endogenous VLP preparations from either SSL2 or ssl2-rtt strains, because of their low abundance and the presence of cellular inhibitors (data not shown). As expected, the level of pGTy1-H3his3-AI and VLP production is greatly stimulated in a transposition-induced SSL2 wild-type strain. However, ssl2-rtt does not markedly affect transposition or VLP production under transposition-inducing conditions when compared to wild-type SSL2. Since we showed that galactose induction of pGTy1 overcomes posttranslational control of Ty1 transposition (CURCIO and GARFINKEL 1992 Down), pGTy1 expression in SSL2 cells may override the negative effects of Ssl2p.

Ty1 cDNA is increased in ssl2 mutants:
Since we had difficulty identifying relevant biochemical activities from endogenous Ty1 VLPs, we determined whether the level of linear Ty1 cDNA increased in ssl2 mutants (Figure 7). Total DNA was prepared after the strains were grown to mid-to-late log phase at 20°, digested with PvuII, and subjected to Southern blot hybridization using a 32P-labeled probe spanning the RT/RH region at the 3' end of Ty1. The probe should detect an unintegrated Ty1 cDNA fragment of about 2 kb that contains sequences from the PvuII site at nucleotide 3944 to the end of the element at nucleotide 5918 [coordinates are taken from the sequence of Ty1-H3 (BOEKE et al. 1988 Down)]. The probe should also hybridize with integrated Ty1 elements present in the genome, generating a variety of different fragments that contain Ty1 sequences joined to genomic DNA.



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. —Ty1 cDNA is increased in ssl2 mutants. The 2-kb segment of Ty1 cDNA detected by Southern analysis of total yeast DNA digested with PvuII is shown on the top. A Ty1 element is depicted along with relevant PvuII (nucleotide positions 475 and 3944) and SnaBI (position 5461) restriction sites (BOEKE et al. 1988 Down). Additional Ty1 element features are described in Figure 1. Solid bar represents the PvuII-SnaBI restriction fragment used as Southern hybridization probe to detect Ty1 cDNA. Total DNA was isolated after strains DG789 (spt3-101; lane 1), GRF167 (SSL2; lane 2), DG1722 (ssl2-rtt ; lane 3), DG1774 (SSL2; lane 4), DG1775 (ssl2-rtt ; lane 5), DG1776 (ssl2-dead; lane 6), and DG1778 (SSL2-1; lane 7) were grown to mid-to-late log phase, digested with PvuII, and subjected to Southern analysis using a 32P-labeled probe spanning the Ty1 RT/RH region (nucleotides 3944–5461). Positions of the 2-kb Ty1 cDNA and four conserved Ty1-chromosomal junction fragments ({bullet}) used for normalization are shown alongside the figure.

When the level of Ty1 cDNA (Figure 7) present in total cellular DNA from isogenic strains GRF167 (SSL2; lane 2) and DG1722 (ssl2-rtt ; lane 3) was estimated relative to four conserved Ty1-genomic DNA junction fragments, there was a 50-fold increase in Ty1 cDNA in the ssl2-rtt mutant. This analysis was extended to additional ssl2 mutants in which Ty1 transposition was increased (Table 5). We observed that the cDNA level was elevated 7-fold in DG1775 (ssl2-rtt ; lane 5), 12-fold in DG1776 (ssl2-dead; lane 6), and 5-fold in DG1778 (SSL2-1; lane 7) when compared to strain DG1774 (SSL2; lane 4). As noted previously with the transposition rates (Table 2A and Table 5), the increase in the level of Ty1 cDNA with a plasmid-borne ssl2-rtt mutant DG1775 was less than that obtained with a chromosomal ssl2-rtt mutant. This difference in cDNA level probably results from a low copy gene-dosage effect of the ssl2-rtt/pRS416 plasmid and applies to the other ssl2 plasmids as well. As expected, we could not detect Ty1 cDNA in the spt3-101 strain DG789 (lane 1), even after extended autoradiography. The level of Ty1 cDNA also increased when partially purified endogenous VLPs from DG1722 were examined (data not shown).

rtt alleles of RAD3:
To determine whether other NER/TFIIH subunits inhibit Ty1 transposition, we analyzed a highly UV-sensitive