- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Carrico, P. M.
- Articles by Zitomer, R. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Carrico, P. M.
- Articles by Zitomer, R. S.
Mutational Analysis of the Tup1 General Repressor of Yeast
Pauline M. Carricoa and Richard S. Zitomeraa Department of Biological Sciences, University at Albany/State University of New York, Albany, New York 12222
Corresponding author: Richard S. Zitomer, Department of Biological Sciences, University at Albany/SUNY, Albany, NY 12222, RZ144{at}cnsvax.albany.edu (E-mail).
Communicating editor: M. JOHNSTON
| ABSTRACT |
|---|
The Tup1 and Ssn6 proteins of Saccharomyces cerevisiae form a general transcriptional repression complex that regulates the expression of a diverse set of genes including aerobically repressed hypoxic genes, a-mating type genes, glucose repressed genes, and genes controlling cell flocculence. To identify amino acid residues in the Tup1 protein that are required for repression function, we selected for mutations that derepressed the hypoxic genes. Three missense mutations that accumulated stable protein were isolated, and an additional three were generated by site-directed mutagenesis. The mutant protein L62R was unable to complex with Ssn6 or repress expression of reporter genes for the hypoxic and glucose repressed regulons or the flocculence phenotype, however, expression of the a-mating type reporter gene was still repressed. The remaining mutations fell within the WD repeat region of Tup1. These mutations had different effects on the expression of the four Tup1 repressed regulons assayed, indicating that the WD repeats serve different roles for repression of different regulons.
BAKER'S yeast, Saccharomyces cerevisiae, is a facultative aerobe that can derive energy aerobically either through oxidative phosphorylation or a mixture of fermentation and oxidative phosphorylation, or anaerobically through fermentation. In the intermediate hypoxic state, yeast induce the expression genes, which enable them to utilize available oxygen more efficiently. The aerobic repression of hypoxic genes is heme dependent and is mediated through the heme activated repressor Rox1 (![]()
![]()
![]()
![]()
In addition to Rox1, aerobic repression of the hypoxic genes requires the general repressors Tup1 and Ssn6, (![]()
![]()
-mating type cell through interactions with the
2 repressor (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Several studies have defined the functional domains of Tup1. The first 72 amino acids of Tup1 are involved in formation of the repression complex that consists of either three (![]()
![]()
![]()
![]()
![]()
![]()
![]()
2 repressor (![]()
The functional analyses of Tup1 carried out to date were done in vitro or in artificial systems. To identify residues important for Tup1 function in vivo, we developed a selection for tup1 mutations. We initially obtained three missense mutations, one in the Ssn6 interaction domain, and two in the WD repeat region. The mutation in the Ssn6 interaction domain eliminated Tup1/Ssn6 complex formation and caused derepression of both the hypoxic and glucose repressed regulons, but still formed Tup1 multimers and repressed the a-mating type genes. Although the effects of the two WD repeat mutants on the hypoxic and glucose-repressed genes were very similar, each had a different effect on the a-mating type genes. The differential repression displayed by these point mutations prompted a more detailed study of the role of the different WD repeats. In this paper we provide evidence that suggests that the WD repeats are not functionally redundant, and that they serve a function in the repression of at least two regulons.
| MATERIALS AND METHODS |
|---|
Strains, cell growth and transformations:
The S. cerevisiae strain RZ53-6
tup1 (MAT
trp1-289 leu2-3, 112 ura3-52 ade1-100 tup1::ura3) was described previously (![]()
![]()
trp1/trp1 leu2/leu2 ura3/ura3 lys2/lys2 tif51A::TRP1/tif51A::TRP1 tup1::URA3/tup1::URA3 ura3::AZ4/ura3::AZ4 gal-/gal-) and MZ12-16 (MATa trp1 leu2 lys2 his3 tup1::URA3 ura3::AZ4 gal-).
Yeast cells were transformed as described previously (![]()
Escherichia coli HB101 was maintained and transformed as described previously (![]()
Enzymes and general methods for plasmid constructions:
Plasmid constructions were carried out according to standard protocols (![]()
General plasmids:
pBSTUP1 and YEp(181)TUP1 were constructed by insertion of the 4.2-kb HindIII-Sac I fragment from YCpTUP1 (![]()
![]()
pBSTUP1bbg was constructed as follows: the pBSTUP1 was subjected to site directed mutagenesis (![]()
YCpSSN6 was obtained from a YCp50 library and contains a large insert including the SSN6 gene. pBSSSN6 and YEp(112) SSN6 were constructed by insertion of the 6.1-kb XbaI-SphI fragment of YCpSSN6 into the polylinker of pBSM13(+) and YEplac112 (![]()
The epitope tagged version of SSN6 was constructed as follows. The synthetic DNA encoding the c-myc 9E10 epitope (5'- CGAACAAAAGCTTATTTCTGAAGAAGACTTGGG -3' and 5'-CAAGTCTTCTTCAGAAATAAGCTTTTGTTCGCC-3') was ligated into the unique Bsg I site at the 3' end of the coding sequence of SSN6 in pBSSSN6 creating pBSSSN6e. YEp(112) SSN6e was constructed by replacing the 2.2-kb MluI-XbaI fragment from YEp(112)SSN6 with the MluI-XbaI fragment from pBSSSN6e.
The lacZ fusion plasmids YCp(33)ANB1/lacZ (![]()
![]()
Mutagenesis of TUP1:
(i) PCR mutant pools were generated as follows: A 2.2-kb fragment containing TUP1 5' flanking sequences plus codons 1275 was amplified from plasmid YEp(181)TUP1 using the primers 5'-TCCCAGTCACGACGT-3' and 5'-CACCGCAGAAGGAGGAATCC-3'. PCR was carried out for 30 cycles with 10 ng of template under the conditions recommended by the vendor. Four separate reactions were performed to obtain independent pools. The reaction products were digested with Sac I and BamHI and fractionated on an agarose gel, and the desired product was purified and ligated into the Sac I-BamHI sites of YEp(181)TUP1.
A 1.8-kb fragment containing codons 226713 plus 3' flanking sequences was amplified from YEp(181)TUP1 using the primers 5'-AACAGCTATGACCATG -3' and 5'-CCCTCTG TCAAGGCACCTGAATCTACG -3'. Reactions were carried out as above. The reaction products were digested with HindIII and BamHI and fractionated on an agarose gel, and the desired product was purified and ligated into the HindIII-BamHI sites of YEp(181)TUP1.
(ii) YEp(181)tup1-S593P was constructed as follows. A 2.8-kb fragment containing TUP1 5' flanking sequences plus codons 1601 was amplified as recommended by the vendor for 15 cycles from 100 ng of the plasmid YEp(181)TUP1 using the primers 5'-CAACAGATCTATCTAATGAGCCGGGTA CAACGCTTTGTCC-3' and 5'-TCCCAGTCACGACGT-3'. The product contains a single base pair substitution (shown in bold) resulting in an amino acid change from serine to proline at codon 593. The reactions products were digested with Sac I and Bgl II, fractionated on an agarose gel, and ligated into the Sac I-Bgl II sites of YEp(181)TUP1.
(iii) YEp(181)tup1-T460P and YEp(181)tup1-T695P were constructed using the megaprimer method of site-directed mutagenesis (![]()
YEp(181)tup1-T460P : A 420-bp fragment containing codons 325465 was amplified from the plasmid YEp(181)TUP1 using the primers 5'-GTCTGTCTTCAGCACCTGGTGCCAAAAAT TTCCCATCTG - 3' and 5'-CAACCCGGCACTACC - 3'. The product contained a base pair substitution (shown in bold) resulting in an amino acid change from threonine to proline at codon 460 and was used as a megaprimer with the primer 5'-AACAGCTATGACCATG-3' and the template YEp(181)TUP1 to generate a 1-kb fragment containing codons 325713 plus 3' flanking sequences. The reaction products were digested with Bgl II and HindIII and fractionated on an agarose gel, and the desired product was purified and ligated into the BamHI-HindIII sites of YEp(181)TUP1bbg.
YEp(181)tup1-T695P : A 440-bp fragment containing codons 577698 was amplified from the plasmid YEP(181)TUP1 with the primers 5'-CCGCTACCAGGAGCAAAAACGTTATA-3' and 5'-ACTCTGTTTATAGCG - 3'. This product contained a base pair substitution (shown in bold) resulting in an amino acid change from threonine to proline at codon 695 and was used as a megaprimer with the primer 5'-AACAGCTATGACCATG -3' and the template YEp(181)TUP1 to generate a 730-bp fragment containing codons 577713 plus 3' flanking sequences. The reaction products were digested with Bgl II and HindIII and fractionated on an agarose gel, and the desired product was purified and ligated into the Bgl II-HindIII sites of YEp(181)TUP1.
YEp(181)tup1-
443-555 was constructed as follows. A 750-bp fragment containing TUP1 codons 556713 plus 3' flanking sequences was amplified from the plasmid YCp(22)TUP1 using the primers 5'-AACAGCTATGACCATG -3' and 5'-TC CGGATCCGAGACCGGATTCTTGGTGGAA-3'. The reaction products were digested with BamHI and HindIII, fractionated on an agarose gel, and the desired product was purified and ligated into the Bgl II and HindIII sites of pBSTUP1BBg generating pBStup1-
443-555. pBStup1-
443-555 was then digested with Sac I and HindIII and the 3.9-kb fragment was ligated into the Sac I-HindIII sites of YEplac181.
In each of the above constructs, the presence of the desired mutation was verified by DNA sequence analysis.
Yeast protein extractions:
Yeast cells were grown in SD (![]()
![]()
Western (immunoblot) analysis:
(i) Denaturing gels: The yeast protein extracts were boiled with SDS-PAGE sample buffer and fractionated on SDS-10% polyacrylamide gels (PAGE) (![]()
![]()
![]()
(ii) Nondenaturing gel:
The yeast protein extracts were fractionated on non-denaturing 5% polyacrylamide gels (![]()
Enzyme assays:
For invertase assays glucose repressed cells were grown in SD (![]()
![]()
![]()
Flocculence assays:
RZ53-6
tup1 transformed with both the wild type and mutant TUP1 alleles was grown overnight in 5 ml of SD lacking leucine to late log phase. Each culture tube was vigorously mixed to disperse the aggregates, and 100 µl of culture was removed immediately. The cells were allowed to settle for five minutes, whereupon a second aliquot of 100 µl was removed from the aqueous portion of the culture. Each 100 µl sample was added to 900 µl of SD-leu with 20 mM EDTA, and the cell density was measured. Flocculence was determined by the equation: [A600 at t0 - A600 at t5 min]/[A600 at t0 x 5 min] = % culture settling out per minute.
Mutant selection scheme:
Missense mutations in TUP1 were obtained using random mutagenesis in the following selection scheme. The aerobically expressed TIF51A gene and the heme-repressed ANB1 gene are homologs encoding isoforms of the essential protein eIF-5a. Cells carrying a null allele of TIF51A cannot grow aerobically unless ANB1 is expressed constitutively as in a tup1, ssn6, or rox1 deletion strain. Strain MZ14-29 is a tif51a tup1 leu2 homozygous diploid containing an ANB1/lacZ disruption of the URA3 gene. This strain could not be transformed to leucine prototrophy by a 2µ plasmid containing the LEU2 and TUP1 genes because the TUP1 gene resulted in aerobic repression of ANB1 and subsequent cell death due to a lack of eIF-5a. However, using a plasmid pool in which mutations were targeted to the TUP1 gene, leu+ transformants were obtained, presumably from plasmids bearing tup1 mutations. Constitutive expression of ANB1 in these transformants was confirmed using the ANB1/lacZ fusion by testing for blue color on X-gal plates. To screen out frame shift and nonsense mutations or missense mutations leading to highly unstable protein, whole yeast extracts were prepared from colonies which were constitutively expressing ANB1, and Western analysis was performed using Tup1 polyclonal antisera. Those colonies that produced stable, full-length Tup1 were examined further. Approximately 500 putative tup1 mutants were screened by Western analysis. The plasmid DNA was recovered from each mutant and used to retransform MZ12-16 (tup1,TIF51A) to confirm the mutant phenotype was plasmid borne.
| RESULTS |
|---|
Isolation of TUP1 mutations:
Utilizing the selection described in MATERIALS AND METHODS, the following three missense mutations in TUP1 were isolated: L62R, S595P, and S647P. The latter two mutations each altered a conserved serine at different positions in the fourth and fifth WD repeats, respectively (Figure 1), and, as documented below, each affected the Tup1 repressed genes differently. Such differential effects could arise from either a difference in the role of the two different serines within a WD repeat or a difference in the function of the two WD repeats. To distinguish between these possibilities, three new mutant alleles were generated by site-directed mutagenesis: T460P, S593P, and T695P. Each contained a serine or threonine to proline substitution in the residue corresponding to S647 in the first, fourth, and sixth WD repeat, respectively (Figure 1). We also constructed a deletion mutation that precisely excised the first three WD repeats (
443-555). The cellular levels of the mutant proteins were determined by Western analysis. As demonstrated in Figure 2, L62R, S593P, S595P, and S647P (Figure 2A) levels were similar to wild type, but T460P (Figure 2B) and T695P (Figure 2C) protein accumulated to lower levels. The
443-555 mutant did not accumulate detectable levels of protein (data not shown). This deficiency was not due to the inability of the antibody to detect the deletion protein, since truncated versions of Tup1 lacking all sequences after residue 291 were readily detected (data not shown).
|
|
Interactions of mutant Tup1 with Ssn6:
One function of Tup1 is to associate with Ssn6, thus we investigated this complex formation by the mutant proteins. Yeast extracts were prepared from cotransformants carrying YEp(112)SSN6e, an epitope-tagged SSN6 allele, and each of the TUP1 mutant plasmids. The extracts were fractionated on a nondenaturing polyacrylamide gel, and complex formation was analyzed by Western analysis with primary monoclonal antibody against the c-myc 9E10 epitope. The results are presented in Figure 3A. Ssn6 was visualized rather than Tup1 because the differential migration between free versus complexed protein is greater for Ssn6 than for Tup1; Tup1 itself forms a multi-meric complex that migrates almost as slowly as the Tup1/Ssn6 complex. The Tup1/Ssn6 complex can be visualized as a slowly migrating band as seen in a comparison of the migration of free Ssn6 in a tup1
strain (lane 8) with that of the complex in a strain containing wild-type Tup1 (lane 1). The N-terminal mutant, L62R was unable to form a complex with Ssn6 (lane 7). The three WD repeat mutants, S593P, S595P, and S647P (lanes 3, 4, and 5), were all capable of interacting with Ssn6. Surprisingly, the Tup1/Ssn6 complex was neither detected in T460P (lane 2) nor T695P (lane 6) extracts. This may be directly due to the inability of the T460P and T695P mutants to form complexes with Ssn6, but we believe, given the repression activity of these mutant proteins described below, that these results reflect the low Tup1 levels in these mutants, which left most of the Ssn6 free and made detection of the complex difficult.
|
The L62R allele is able to form multimers:
The Tup1/Ssn6 repression complex is composed of three or four Tup1 subunits and one Ssn6 subunit (![]()
![]()
![]()
![]()
![]()
![]()
Effects of the TUP1 mutants on different Tup1 regulated genes:
The effects of these mutants on oxygen repression (ANB1/lacZ ), catabolite repression (invertase activity), cell type regulation (STE2/lacZ), and flocculence were assessed and the results are presented in Table 1 and summarized in Figure 4. The L62R mutant was completely derepressed for ANB1 expression and showed little repression of SUC2 expression (25%) and flocculence (18%). In contrast, this mutant repressed STE2 expression to 83% of the wild type level. This ability to repress STE2 expression in the absence of the Tup1-Ssn6 interaction probably arises from the ability of the
2 repressor to bind both Tup1 and Ssn6 (![]()
![]()
|
|
The WD repeat mutants exhibited different effects on the different regulons. All of the mutants, including the deletion of the first three repeats, repressed expression of the SUC2 and flocculence genes to near wild-type levels. On the other hand, ANB1 expression was derepressed in the T460P (first repeat) and
443-555 mutants but repressed to significant levels in the S593P and S595P (fourth repeat), S647P (fifth repeat), and T695P (sixth repeat) mutants. The repression of STE2 expression showed a different pattern. Expression was completely derepressed in the T460P (first repeat), S647P (fifth repeat), and
443-555 mutants, but repressed to near wild-type levels in the S593P and S595P (fourth repeat) and T695P (sixth repeat) mutants. Thus, as more easily visualized in Figure 4, the mutations in the WD repeats had differential effects on the repression of the four regulons assayed.
| DISCUSSION |
|---|
In this study we report the isolation and characterization of six single amino acid substitutions in the general repressor protein Tup1 acquired through both random mutagenesis and site directed mutagenesis.
The N-terminal mutant L62R was unable to interact with Ssn6, but retained the ability to homo-oligomerize. This demonstrates that interaction with Ssn6 is not necessary for Tup1 oligomerization. This is in agreement with both two-hybrid data and in vitro studies with truncated Tup1 (![]()
![]()
2 can interact with both Tup1 and Ssn6, it may serve to stabilize the mutant complex. If so, the lack of repression in the other regulons suggests that the Rox1 and Mig1 repressor interact with Tup1 and Ssn6 in a different manner.
All the remaining mutations fell within the WD repeats, and perhaps the most intriguing finding to emerge from our analysis is that these mutations affected the regulons studied here differently. The WD repeat region of Tup1 is required for full Tup1-dependent repression of at least two of the four regulons studied here. Deletion of the first three repeats resulted in full derepression of ANB1 and STE2. However, SUC2 was only partially derepressed (57%), and the cells exhibited only mild flocculence, and even this partial loss of repression may have been due to the severely reduced amount of mutant Tup1 protein in the cell. The requirement of the WD repeats for STE2 repression is not surprising given that the
2 repressor has been demonstrated to interact with this region. On the other hand, the Rox1 repressor of the hypoxic genes has been shown to interact with Ssn6, but it is possible that it has some weak interaction with Tup1 also. Alternatively, the requirement of hypoxic gene repression for the WD repeats could stem from an interaction between these repeats and the general transcriptional machinery to achieve repression.
It has been proposed (![]()
The flocculent phenotype and SUC2 regulation were only minimally affected by any of the WD repeat missense mutations. These results demonstrate that the Tup1 mutant proteins are functional and that despite the low levels of protein in the mutants T460P and T695P, the protein that is made can associate with Ssn6. If there is any requirement for the WD repeats at all by these two regulons, no repeat is uniquely required for regulation. Also, the retention of repression activity of these regulons indicates that none of the mutated repeats is uniquely required for interaction with the transcriptional machinery. The Mig1 repressor of the glucose-repressed genes has been reported to interact with TPR (tetratricopeptide) repeats seven through ten of Ssn6, but complete repression requires that TPR repeats one to three be present to interact with Tup1 (![]()
Unlike the case with flocculence and SUC2 repression, the mutations in either the first or fifth repeats resulted in complete derepression of STE2. The
2 repressor is known to interact with the WD repeats of Tup1, and it is tempting to speculate that it binds to blades one and five of the propeller. But these blades separated by the sixth blade, where mutations do not affect STE2 repression dramatically. However, contact could be made from the top or bottom surface (as is the case for G
and G
for Gß transducin) skipping over or spanning the sixth repeat.
As for STE2, the mutation in the first repeat caused complete derepression of ANB1, but unlike the case of STE2 only partial loss of ANB1 repression resulted from a mutation in the fifth repeat. Rox1 has been reported to require Ssn6 TPR repeats four through seven for specific repression as well as TPR repeats one through three, presumably for their interactions with Tup1 (![]()
Summarizing these results, the regulons studied here were affected differently by the battery of mutations in the TUP1 gene. It appears that the Tup1/Ssn6 repression system is both an economical and flexible method of regulation. The DNA binding proteins that are known to be involved in repression of the different systems (Mig1, Rox1, and
2) show no sequence or structural similarities, but all have recruited the Tup1/Ssn6 complex to achieve repression. Our demonstration here that the same mutation in different WD repeats has deferential effects on repression further reinforces the view that each regulon evolved independently, recruiting the repression complex through different interactions.
Note: While this manuscript was in revision, ![]()
2. Their mutants were different than the mutants described here. The effect of their mutations on MFA2 (an a-mating type gene) expression was more allele specific than WD repeat specific. Six of their mutations were tested for repression of SUC2 and ANB1, and none exhibited a signficant effect. The differences between their findings and those reported here probably reflect a difference in the selections. Since they selected for a disruption of the
2-Tup1 interaction but maintenance of general repression activity, all their mutations lay clustered on one surface of the WD propellar as they suggested from the presumed homology between the Tup1 and Gß structure. Therefore, most of their mutations are not expected to seriously disrupt the structure of a given blade of the propellar as is the case with the residues mutated in this present study. Thus these two studies are complementary rather than duplicative.
| ACKNOWLEDGMENTS |
|---|
We thank ALEXANDER KASTANIOTIS and MING ZHANG for help in some plasmid constructions and MARGYE ZITOMER for strain constructions. We thank GEORGE SPRAGUE for the STE2/lacZ plasmid and PETER SHERWOOD for advice for the invertase assays. This study was supported by National Institute of General Medical Science grant 26061 to R.S.Z. and the Burke Fellowship to P.M.C.
Manuscript received September 3, 1997; Accepted for publication October 28, 1997.
| LITERATURE CITED |
|---|
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1994 Current Protocols in Molecular Biology. John Wiley and Sons, New York.
BALASUBRAMANIAN, B., C. V. LOWRY, and R. S. ZITOMER, 1993 The Rox1 repressor of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility group motif. Mol. Cell. Biol. 13:6071-6078
BARIK, S., 1995 Site directed mutagenesis by double polymerase chain reaction. Mol. Biotechnol. 3:1-7[Medline].
CHEN, D. C., B. C. YANG, and T. T. KUO, 1992 One step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].
DECKERT, J., R. PERINI, B. BALASUBRAMANIAN, and R. S. ZITOMER, 1995a Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae.. Genetics 139:1149-1158[Abstract].
DECKERT, J., A. M. RODRIGUEZ TORRES, J. T. SIMON, and R. S. ZITOMER, 1995b Mutational analysis of Rox1, a DNA-bending repressor of hypoxic genes in Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:6109-6117
EDMONDSON, D. G., M. M. SMITH, and S. Y. ROTH, 1996 Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4. Genes Dev. 10:1247-1259
FRIESEN, H., S. R. HEPWORTH, and J. SEGALL, 1997 An Ssn6-Tup1-dependent negative regulatory element controls sporulation-specific expression of DIT1 and DIT2 in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:123-134
GARCIA-HIGUERA, I., J. FENOGLIO, Y. LI, C. LEWIS, and M. P. PANCHENKO et al., 1996 Folding of proteins with WD-repeats: comparison of six members of the WD-repeat superfamily to the G protein beta subunit. Biochemistry 35:13985-13994[Medline].
GIETZ, R. D. and A. SUGINO, 1988 New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[Medline].
GOLDSTEIN, A. and J. O. LAMPEN, 1975 ß-D-Fructofuranoside fructohydrolase from yeast. Methods Enzymol. 42C:504-511[Medline].
HWANG-SHUM, J. J., D. C. HAGEN, E. J. JARVIS, C. A. WESTBY, and G. F. SPRAGUE, 1991 Relative contributions of MCM1 and STE12 to transcriptional activation of a- and
-specific genes from Saccharomyces cerevisiae.. Mol. Gen. Genet. 227:197-204[Medline].
JOHNSTON, M. and L. L. LUTFIYYA, 1996 Two zinc-finger containing repressors are responsible for glucose repression of SUC2 expression. Mol. Cell. Biol. 16:4790-4797
KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992 Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].
KENG, T., 1992 HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2616-2623
KOMACHI, K., M. J. REDD, and A. D. JOHNSON, 1994 The WD repeats of Tup1 interact with the homeo domain protein alpha 2. Genes Dev. 8:2857-2867
KOMACHI, K. and A. D. JOHNSON, 1997 Residues in the WD repeats of Tup1 required for interaction with
2. Mol. Cell. Biol. 17:6023-6028
LOWRY, C. V., M. E. CERDAN, and R. S. ZITOMER, 1990 A hypoxic consensus operator and a constitutive activation region regulate the ANB1 gene of Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:5921-5926
REDD, M. J., M. B. ARNAUD, and A. D. JOHNSON, 1997 A complex composed of Tup1 and Ssn6 represses transcription in vitro.. J. Biol. Chem. 272:11193-11197
ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics, a Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
SANGER, F., S. NICKLEN, and S. A. COULSON, 1997 DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74:5643-5647.
SMITH, R. L., M. J. REDD, and A. D. JOHNSON, 1995 The tetratricopeptide repeats of Ssn6 interact with the homeo domain of
2. Genes Dev. 9:2903-2910
SONDEK, J., A. BOHM, D. G. LAMBRIGHT, H. E. HAMM, and P. B. SIGLER, 1997 Crystal structure of a GA protein ß dimer at 2.1A° resolution. Nature 379:369-374.
TEUNISSEN, A. W., J. A. VAN DEN BERG, and H. Y. STEENSMA, 1995 Transcriptional regulation of flocculation genes in Saccharomyces cerevisiae.. Yeast 11:435-446[Medline].
TREITEL, M. A. and M. CARLSON, 1995 Repression by SSN6-TUP1 is directed by MIG1, a repressor/activator protein. Proc. Natl. Acad. Sci. USA 92:3132-3136
TRUMBLY, R. J., 1992 Glucose repression in the yeast Saccharomyces cerevisiae.. Mol. Microbiol. 6:15-21[Medline].
TZAMARIAS, D. and K. STRUHL, 1994 Functional dissection of the yeast Cyc8-Tup1 transcriptional co-repressor complex. Nature 369:758-761[Medline].
TZAMARIAS, D. and K. STRUHL, 1995 Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev. 9:821-831
VARANASI, U. S., M. KLIS, P. B. MIKESELL, and R. J. TRUMBLY, 1996 The Cyc8 (Ssn6)-Tup1 corepressor complex is composed of one Cyc8 and four Tup1 subunits. Mol. Cell. Biol. 16:6707-6714
WILLIAMS, F. E., U. VARANASI, and R. J. TRUMBLY, 1991 The CYC8 and TUP1 proteins involved in glucose repression in Saccharomyces cerevisiae are associated in a protein complex. Mol. Cell. Biol. 11:3307-3316
WILLIAMS, F. E. and R. J. TRUMBLY, 1990 Characterization of TUP1, a mediator of glucose repression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:6500-6511
ZHANG, M., L. S. ROSENBLUM-VOS, C. V. LOWRY, K. A. BOAKYE, and R. S. ZITOMER, 1991 A yeast protein with homology to the beta-subunit of G proteins is involved in control of heme-regulated and catabolite-repressed genes. Gene 97:153-161[Medline].
ZHOU, Z. and S. J. ELLEDGE, 1992 Isolation of crt mutants constitutive for transcription of the DNA damage inducible gene RNR3 in Saccharomyces cerevisiae.. Genetics 131:851-866[Abstract].
ZOLLER, M. J. and M. SMITH, 1982 Oligonucleotide-directed mutagenesis using M13 derived vectors: an efficient and general procedure for the production of point mutations in any fragment of DNA. Nucleic Acids Res. 10:6487-6500
This article has been cited by other articles:
![]() |
L. G. Klinkenberg, T. A. Mennella, K. Luetkenhaus, and R. S. Zitomer Combinatorial Repression of the Hypoxic Genes of Saccharomyces cerevisiae by DNA Binding Proteins Rox1 and Mot3 Eukaryot. Cell, April 1, 2005; 4(4): 649 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fagerstrom-Billai and A. P. H. Wright Functional Comparison of the Tup11 and Tup12 Transcriptional Corepressors in Fission Yeast Mol. Cell. Biol., January 15, 2005; 25(2): 716 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Wykoff and E. K. O'Shea Identification of Sumoylated Proteins by Systematic Immunoprecipitation of the Budding Yeast Proteome Mol. Cell. Proteomics, January 1, 2005; 4(1): 73 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Mennella, L. G. Klinkenberg, and R. S. Zitomer Recruitment of Tup1-Ssn6 by Yeast Hypoxic Genes and Chromatin-Independent Exclusion of TATA Binding Protein Eukaryot. Cell, December 1, 2003; 2(6): 1288 - 1303. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Sertil, R. Kapoor, B. D. Cohen, N. Abramova, and C. V. Lowry Synergistic repression of anaerobic genes by Mot3 and Rox1 in Saccharomyces cerevisiae Nucleic Acids Res., October 15, 2003; 31(20): 5831 - 5837. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, U. Varanasi, and R. J. Trumbly Functional Dissection of the Global Repressor Tup1 in Yeast: Dominant Role of the C-Terminal Repression Domain Genetics, July 1, 2002; 161(3): 957 - 969. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Kastaniotis, T. A. Mennella, C. Konrad, A. M. R. Torres, and R. S. Zitomer Roles of Transcription Factor Mot3 and Chromatin in Repression of the Hypoxic Gene ANB1 in Yeast Mol. Cell. Biol., October 1, 2000; 20(19): 7088 - 7098. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Braun, W. S. Head, M. X. Wang, and A. D. Johnson Identification and Characterization of TUP1-Regulated Genes in Candida albicans Genetics, September 1, 2000; 156(1): 31 - 44. [Abstract] [Full Text] |
||||
![]() |
C. Jabet, E. R. Sprague, A. P. VanDemark, and C. Wolberger Characterization of the N-terminal Domain of the Yeast Transcriptional Repressor Tup1. PROPOSAL FOR AN ASSOCIATION MODEL OF THE REPRESSOR COMPLEX Tup1{middle dot}Ssn6 J. Biol. Chem., March 17, 2000; 275(12): 9011 - 9018. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Conlan, N. Gounalaki, P. Hatzis, and D. Tzamarias The Tup1-Cyc8 Protein Complex Can Shift from a Transcriptional Co-repressor to a Transcriptional Co-activator J. Biol. Chem., January 1, 1999; 274(1): 205 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. WAHI, K. KOMACHI, and A.D. JOHNSON Gene Regulation by the Yeast Ssn6-Tup1 Corepressor Cold Spring Harb Symp Quant Biol, January 1, 1998; 63(0): 447 - 458. [Abstract] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Carrico, P. M.
- Articles by Zitomer, R. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Carrico, P. M.
- Articles by Zitomer, R. S.



); the free Ssn6e is indicated by the arrow (
). (B) Crude protein extract (25 µg) was prepared from the tup1






