Epigenetic Instability and Trans-Silencing Interactions Associated With an SPT::Ac T-DNA Locus in Tobacco

Corresponding author: Jonathan D. G. Jones, The Sainsbury Laboratory, John Innes Centre, Norwich NR4 7UH, UK.

Communicating editor: V. SUNDARESAN

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Progeny of tobacco line 2853.6, which carries a streptomycin phosphotransferase (SPT ) gene interrupted by the maize element Activator (Ac), were selected for streptomycin resistance (Spr) because of germinal Ac excision. Some events gave rise to Spr alleles that were unstable and exhibited a mottled phenotype on streptomycin-containing medium due to somatic loss of SPT function. This instability was most pronounced in one particular line, Spr12F. Other Spr alleles rarely exhibited silencing of SPT. Streptomycin-sensitive, homozygous Spr12F plants were recovered, and crosses were performed with other, more stable Spr lines. A high proportion of the resulting heterozygous progeny were silenced for SPT expression. The silenced state was heritable even after the Spr12F allele segregated away. No correlation could be made between silencing and methylation of the SPT gene. Structural analysis of allele Spr12F showed that the SPT gene from which Ac had excised was flanked by direct repeats of Ac. A search was carried out among 110 additional Spr alleles for new independent unstable alleles, and four were identified. All of these alleles also carried an SPT gene flanked by direct repeats of Ac. Thus, there is a strong correlation between this structure and instability of SPT expression.

Anumber of epigenetic phenomena involving interactions between repeated sequences, either unlinked or at allelic positions, result in the silencing or alteration of gene expression in plants. One of the first examples to be described in detail was paramutation involving the r locus in maize (BRINK 1973 ). One allele (paramutagenic) could alter the expression of another allele (paramutable) in a directed and heritable way, resulting in a new (paramutant) allele. Paramutation has also been observed at the b (COE 1966 ) and pl (HOLLICK et al. 1995 ) loci of maize and the sulfurea locus of tomato (HAGEMANN 1969 ). Other potentially related phenomena include cycling of maize transposable elements between active and inactive phases (MARTIENSSEN and RICHARDS 1995 ); trans-silencing interactions between nivea alleles in Antirrhinum majus (BOLLMAN et al. 1991 ); repeat-induced point mutations (RIP) (SINGER and SELKER 1995 ); methylation-induced premeiotically (MIP) (ROSSIGNOL and FAUGERON 1995 ); quelling in fungi (COGONI et al. 1996 ); and various examples of gene silencing in transgenic plants ( JORGENSEN 1992 ; FLAVELL 1994 ; MATZKE and MATZKE 1995B ).

The introduction of foreign DNA sequences into plants has produced many examples of gene silencing ( JORGENSEN 1992 ; FLAVELL 1994 ; MATZKE and MATZKE 1995B ). An early study showed a puzzling inverse relationship between T-DNA copy number and marker gene expression in transgenic petunia plants (JONES et al. 1987 ). Many more recent studies have shown that interactions between repeated sequences can cause gene silencing, also known as transinactivation (MATZKE and MATZKE 1995A ; FLAVELL 1994 ). The repeated sequences can comprise unlinked T-DNA loci (MATZKE and MATZKE 1995A ; HOBBS et al. 1990 ) or, in the case of cosuppression, an endogenous gene and a homologous introduced T-DNA locus (NAPOLI et al. 1990 ; VAN DER KROL et al. 1990 ). T-DNA insertions with complex structures may be particularly prone to cosuppression ( JORGENSEN et al. 1996 ; CLUSTER et al. 1996 ).

Paramutation at the maize b and r genes has been studied extensively both at the genetic (COE 1966 ; BRINK 1973 ; KERMICLE et al. 1995 ) and molecular levels (PATTERSON et al. 1993 ; EGGLESTON et al. 1995 ; PATTERSON and CHANDLER 1995 ). A strong correlation has been made between paramutation of the complex r locus and the number of repeated r genes present (KERMICLE et al. 1995 ). In contrast, paramutation of the b locus is not associated with the presence of repeated sequences (PATTERSON and CHANDLER 1995 ).

The mechanisms underlying gene silencing are not known. Some examples involve decreased transcription of the affected gene(s) (PROLS and MEYER 1992 ; PATTERSON et al. 1993 ; PARK et al. 1996 ), while others occur by post-transcriptional mechanisms (MUELLER et al. 1995 ; DECARVALHO et al. 1992 ; ENGLISH et al. 1996 ). In general, gene silencing is associated with repeated DNA sequences (FLAVELL 1994 ; CLUSTER et al. 1996 ; HOBBS et al. 1990 ), but there are exceptions (ELMAYAN and VAUCHERET 1996 ).

Here we describe a series of alleles derived from a SPT::Ac T-DNA locus in tobacco. Transformed tobacco plants were generated using construct pJJ2853, which contains a T-DNA carrying the bacterial neomycin phosphotransferase (NPT) gene under the control of the Agrobacterium tumefaciens nopaline synthase (nos) promoter and the streptomycin phosphotransferase (SPT) gene under control of the 2' or mannopine synthase promoter ( JONES et al. 1989 ). One line, 2853.6, carried two copies of the T-DNA, which inserted as an inverted repeat around the right border (Figure 1) ( JONES et al. 1990 ). Germinal transpositions of Ac were isolated by screening for fully streptomycin-resistant (Spr) individuals. The positions of transposed Ac (trAc) elements were determined genetically relative to the functional SPT gene ( JONES et al. 1990 ). Somatic loss of SPT activity was observed at different frequencies among the different families. This loss of SPT function was the subject of the investigation described here.

View larger version (11K): [in this window] [in a new window]   Figure 1. —Structure of the T-DNA insertion in tobacco transformant 2853.6. SPT, streptomycin phosphotransferase ; NPT, neomycin phosphotransferase ; LB, RB, T-DNA left and right borders are indicated. E, EcoRI; B, BamHI restriction sites are shown to indicate the orientation of Ac. Arrows show the direction of transcription of Ac, SPT, and NPT.

Most of the 2853.6 Spr derivatives exhibited somatic loss of SPT function at low frequencies. An exceptional allele, Spr12F, showed frequent somatic loss and occasional germinal loss of SPT function. Analysis of completely streptomycin-sensitive Spr12F (white) plants showed that loss of SPT activity was not associated with DNA structural rearrangements. This, and the fact that Spr12F (white) plants were homozygous for the Spr12F T-DNA, suggested that an epigenetic phenomenon was responsible for loss of SPT activity. The Spr12F (white) allele was shown to direct silencing in trans when crossed to other 2853.6 Spr alleles. By Southern blotting and DNA sequence analysis of previously described alleles ( JONES et al. 1990 ) and new alleles generated in this study, we show a strong correlation between a particular type of DNA structure and high frequency somatic loss of SPT function in 2853.6 Spr derivatives. The relationship of this type of gene silencing with other epigenetic phenomena, and possible implications regarding the mechanisms involved, are discussed.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Genetic stocks:
All work was carried out with the streptomycin-sensitive Nicotiana tabacum cultivar Petite Havana (PH). Transformant 2853.6, carrying an Ac element inserted in the 5' untranslated leader of a chimeric streptomycin phosphotransferase gene (SPT::Ac), has been described previously ( JONES et al. 1989 ). In this transformant, the T-DNA was inserted as an inverted repeat around its right border (Figure 1). A series of excision alleles of the 2853.6 locus [described previously in JONES et al. 1990 and new alleles described in this work] were selected as streptomycin-resistant progeny from testcrosses between untransformed PH and a variegated line that was homozygous for the 2853.6 T-DNA. This is represented as 2853.6/2853.6 X -/- .

Visualization of streptomycin resistance phenotype:
Seedlings were germinated on medium consisting of Murashige and Skoog salts (ICN Biomedicals Inc., Costa Mesa, CA), 0.8% agarose, 1% glucose, and 300 µg/ml streptomycin ( JONES et al. 1989 ). The streptomycin resistance phenotype was visualized after 10–14 days. The seedlings pictured in Figure 2 represent typical examples obtained from each cross indicated. Each cross was performed 3–5 times and ~200 seedlings were observed for each cross.

View larger version (92K): [in this window] [in a new window]   Figure 2. —Streptomycin resistance phenotypes of 2853.6 derivatives. Seedlings were photographed 10–14 days after being sown on streptomycin-containing medium. In each panel, the seedlings shown are progeny from the cross indicated. The genotype of each parent is given and the streptomycin resistance phenotype (i.e., white, streptomycin-sensitive; green, streptomycin-resistant) is shown in parenthesis. (-) represents the locus corresponding to the 2853.6 T-DNA insertion in untransformed tobacco. Thus, -/- represents untransformed tobacco.

DNA extraction and Southern blot analysis:
DNA extraction was performed as described previously (ENGLISH et al. 1993 ). For Southern blot analysis, 10 µg of genomic DNA was digested with the appropriate restriction enzyme and separated on 1% agarose gels. DNA was transferred to Hybond-N hybridization membranes (Amersham, Arlington Heights, IL) by capillary blotting. The resulting filters were probed with gel-purified DNA fragments which were ³²P-labeled by the random priming method (FEINBERG and VOGELSTEIN 1983 ). Probe fragments used were probe A, which contains the NPT coding sequence (see Figure 3) and the octopine synthase (ocs) 3' end, Ac 5' (2.5 kb fragment 5' to the EcoRI site), and Ac 3' (2 kb fragment 3' to the EcoRI site).

View larger version (50K): [in this window] [in a new window]   Figure 3. —Southern blot analysis of DNA from 2853.6 derivatives. (A) Diagram of the 2853.6 locus. EcoRI restriction sites (E) are indicated. The extent of homology to probe fragment A (NPT coding sequence and ocs 3' end) is indicated. The two Ac elements are distinguished by which EcoRI fragment they are associated with and have been named Ac10.5 and Ac16, accordingly. (B) DNA from 2853.6 and derivatives was digested with EcoRI, Southern blotted, and hybridized with probe A. Lane 1, 2853.6; lane 2, Spr11B; lane 3, Spr12D; lane 4, Spr1A; lane 5, Spr10D; lane 6, Spr2; lane 7, Spr1E; lane 8, Spr12F; lane 9, Spr368; lane 10, Spr379; lane 11, Spr381; lane 12, Spr419; lane 13, untransformed tobacco.

Inverse polymerase chain reaction:
Inverse polymerase chain reaction (IPCR) (OCHMAN et al. 1988 ) was performed as described by THOMAS et al. 1994 . Restriction enzymes AluI, Sau3A, TaqI and HaeIII were used. Primers B38 (GATATACCGGTAACGAAAACGAACG, Ac positions 89–114), B39 (TTT CGTTTCCGTCCCGCAAGTTAAATA, Ac positions 84–58), B34 (ACGGTCGGTACGGGATTTTCCCAT, Ac positions 4525–4496) and B35 (TATCGTATAACCGATTTTGTTAGTT, Ac positions 4526–4549) were used. Ac sequence positions are numbered as in POHLMAN et al. 1984 .

Northern blot analysis:
RNA was extracted from 2-week-old plants (i.e., the same age as visualization of streptomycin resistance) as described previously (MUELLER et al. 1995 ). Five µg RNA samples were electrophoresed on 0.8% (w/v) agarose/formaldehyde gels according to SAMBROOK et al. 1989 , transferred to Hybond-N membranes (Amersham, Arlington Heights, IL), and hybridized with ³²P-labeled DNA probes corresponding to the SPT or NPT coding sequences.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Somatic instability of SPT expression in SPT::Ac excision alleles:
Germinal excision alleles from the transgenic tobacco line 2853.6 carrying SPT::Ac have been characterized previously ( JONES et al. 1990 ) with respect to reinsertion of the excised Ac element and the genetic distance between the transposed Ac (trAc) and the functional streptomycin resistance gene (SPT). Fourteen fully streptomycin-resistant (Spr) plants, hemizygous for different 2853.6 excision alleles, were self-pollinated. When the resulting progeny were germinated on streptomycin-containing media, white (streptomycin-sensitive) sectors were observed on a background of green (streptomycin-resistant) cotyledon cells. This mottled phenotype occured at different frequencies among the different families. Typical sectors are shown in Figure 2A. Table 1 lists the families that were examined for white sectors, the frequency with which white-sectored seedlings were observed, and the percentage of recombination between trAc and the SPT gene. Most families exhibited white-sectored seedlings at frequencies ranging from 0-6%. In two families, Spr6A and Spr11E, 16–17% of green seedlings had white sectors. One exceptional family, Spr12F, exhibited a much higher frequency of white-sectored seedlings than the others, with 60% of green seedlings having white sectors.

The percentage recombination expressed in Table 1 can only be interpreted as unlinked (in the cases of Spr10B, Spr10C, and Spr12C) or very closely linked (in the rest). This is because secondary transpositions of Ac can contribute to the apparent recombinant class (as described in JONES et al. 1990 ). Thus, the values given here are maximum values for percent recombination. There is no correlation between the frequency of white-sectored seedlings and the position of trAc at this level of resolution.

Molecular analysis of SPT::Ac excision alleles:
To address whether the structures resulting from Ac transposition in the SPT::Ac excision alleles might provide information about the mechanism by which SPT activity was being lost, a molecular analysis of these alleles was undertaken. Southern blot analysis was performed on EcoRI-digested DNA from transformant 2853.6 and each of the excision alleles. A typical Southern blot, including each type of transposition event observed, is shown in Figure 3. There are two EcoRI sites within the 2853.6 T-DNA, one in each Ac element. Probe A hybridizes to bands of 16 and 10.5 kb in DNA from transformant 2853.6 (Figure 3, lane 1). The two Ac elements can be identified by the band to which they correspond and have been designated Ac_10.5 and Ac₁₆, accordingly. In the SPT::Ac excision alleles, the Ac element that excised can be determined from analysis of which probe A-hybridizing band has been altered. If one of the Ac elements excises, the probe A-hybridizing fragment extends to the EcoRI site in the other Ac element (as long as the fragment is not disrupted by transposition of Ac into it). This results in a predictable 1-kb increase in size.

In allele Spr11B (lane 2), Ac_10.5 excised, and an 11.5-kb band resulted. The same result was obtained with alleles Spr6A and Spr10N (data not shown). In allele Spr12D (lane 3), Ac₁₆ excised, and a 17-kb band appeared. The same result was obtained with alleles Spr6F and Spr11E (data not shown) Both Ac elements excised in allele Spr1A (lane 4), giving rise to one band of 23 kb. Alleles Spr10D (lane 5) and Spr2 (lane 6) have the 11.5-kb band predicted for excision of Ac_10.5. The 16 kb band is no longer present in these individuals because Ac_10.5 transposed into this fragment, giving rise to bands of 8.7 and 8.3-kb, respectively. Alleles Spr1E (lane 7) and Spr12F (lane 8) retain the 16-kb band, indicating that Ac₁₆ has not excised. Transposition of Ac_10.5 into the region of probe A homology disrupted the 10.5-kb band and two new bands were produced in each. Allele Spr1E has bands of 7 and 9.6 kb. Bands of 8.2 and 8.4 in allele Spr12F were not resolved on this blot.

Southern blot analysis using HindIII (for which there are two recognition sequences in each Ac element and not elsewhere in the T-DNA) and probings with Ac 5' and Ac 3' probes confirmed which Ac had transposed and the positions and orientations of trAc elements within the T-DNA (data not shown). Additional confirmation came from analysis of sequences flanking the trAc elements in alleles Spr1E, Spr10D, and Spr12F (data not shown). Figure 4 shows schematic representations of the structures of the SPT::Ac excision alleles.

View larger version (22K): [in this window] [in a new window]   Figure 4. —Structures of the 2853.6 locus in 2853.6 parent and derivatives. Orientation of Ac elements is indicated by an arrow that points in the direction of Ac transcription. LB, RB-T-DNA left and right borders, respectively; NPT, neomycin phosphotransferase ; SPT, streptomycin phospotransferase are indicated.

Structures of SPT::Ac excision alleles:
It is clear from the structures of the SPT::Ac excision alleles that Ac can frequently transpose very short distances in tobacco. Of fourteen transposition events characterized (JONES et al. 1990 and this study), four were to positions within 10.5 kb of the original starting position. This raises the possibility that the streptomycin-sensitive sectors observed may be because of reinsertion of Ac into SPT. This appeared to be the case in three out of five streptomycin-sensitive hemizygous plants derived from Spr1E and Spr10D testcrosses (data not shown).

An interesting comparison can be made between the structures present in the Spr1E and Spr12F alleles. The trAc in Spr1E (trAc_1E) transposed 1.4 kb to a position downstream of SPT and is in the same orientation as in the 2853.6 progenitor (Figure 4). The trAc_12F transposed 2.1 kb, also to a position downstream of SPT, but the orientation has changed so that the two Ac elements are in direct orientation (Figure 4). The only differences detected between Spr1E and Spr12F are the 700 bp difference in the insertion sites of the trAc elements and the orientations of the trAc elements. Nonetheless, line Spr12F exhibits a very high frequency of white-sectored seedlings, while line Spr1E gives a very low frequency of white-sectored seedlings (Table 1).

Several types of rearrangements involving the two Ac elements in direct orientation in allele Spr12F could lead to loss of SPT. For example, homologous recombination between the directly repeated Ac elements in Spr12F would cause loss of SPT. If the two Ac elements in Spr12F acted as a macrotransposon (RALSTON et al. 1989 ) and were excised, the DNA between them (which includes SPT) would be deleted. Also, chromosome breakage induced by the closely linked Ac elements could result in loss of SPT (RALSTON et al. 1989 ; DOONER and BELACHEW 1991 ). However, as the following sections explain, DNA structural rearrangements are unlikely to account for the majority of SPT marker gene loss described here.

Comparison of the frequency of white-sectored seed-lings in Spr12F homozygotes and hemizygotes:
Five plants homozygous for the Spr12F allele were self-pollinated and crossed to untransformed tobacco. Progeny seed, homozygous and hemizygous for the Spr12F allele, respectively, were germinated on streptomycin-containing medium. A high proportion of seedlings homozygous for the Spr12F allele had white sectors (Figure 2C). The frequency of white sectors was drastically reduced in Spr12F hemizygous seedlings (Figure 2B). The phenotype of hemizygous seedlings was similar whether the Spr12F allele was transmitted through male or female gametes (data not shown). Similar results were obtained with progeny from each of the four Spr12F parents used. No increase in the frequency of white-sectored seedlings in homozygotes versus hemizygotes was observed with any of the other 2853.6 Spr alleles (data not shown). These results argue against the mechanisms described above in which DNA structural rearrangements would cause loss of SPT function in Spr12F seedlings.

Recovery of streptomycin-sensitive Spr12F homozygous plants:
In addition to the majority of white-sectored seedlings in self progeny of Spr12F homozygous plants, fully white seedlings were observed at a low frequency (zero to a few percent), as shown in Figure 2D. Four streptomycin-sensitive Spr12F homozygous plants were transferred to antibiotic-free medium and grown to maturity. Southern blot analysis was performed using 7 different digests with restriction enzymes cutting within and outside of the Ac elements and an SPT probe, Ac 5', and Ac 3' probes. An example is shown in Figure 5. No differences were detected between streptomycin-sensitive and streptomycin-resistant Spr12F homozygous plants at the Southern blot level (Figure 5; data not shown). This result provides additional support for the idea that DNA structural rearrangements were not involved with loss of SPT function in Spr12F plants.

View larger version (43K): [in this window] [in a new window]   Figure 5. —Southern blot analysis of streptomycin-resistant and streptomycin-sensitive Spr12F homozygous plants. (A) Diagram of the Spr12F allele with NcoI (N), HindIII (H), and EcoRI (E) restriction sites indicated. The SPT probe fragment is represented by a bar. (B) DNA samples from a homozygous Spr12F plant selected as streptomycin-resistant (lanes 1, 4, and 7) and two Spr12F plants selected as streptomycin-sensitive (lanes 2, 5, and 8 and lanes 3, 6, and 9) were subjected to Southern blot analysis using the SPT probe. Samples were digested with NcoI (lanes 1 to 3), EcoRI (lanes 4 to 6), or HindIII (lanes 7 to 9). Note: the NcoI digest is predicted to produce three SPT-hybridizing fragments. Two fragments at 7 kb were not resolved on this blot.

The streptomycin-sensitive phenotype was heritable in self (data not shown) and testcross (Figure 2E) progeny from Spr12F (white) homozygous plants. Reversion to streptomycin resistance was observed in 1–2% of testcross progeny. Reversion was not always complete; intermediate phenotypes were often observed. In addition to SPT, the markers NPT and Ac were also tested for activity. The Spr12F streptomycin-sensitive seedlings were fully kanamycin resistant (data not shown). To test for Ac activity, streptomycin-sensitive Spr12F plants were crossed to an SPT::Ds tester line ( JONES et al. 1990 ). In each case, these crosses produced seedlings that were highly variegated due to Ds excision, suggesting that at least one Ac element was active (data not shown).

Expression of the SPT and NPT marker genes was analyzed by Northern blot analysis. Total RNA was extracted from pooled Spr12F homozygous seedlings from a streptomycin-resistant line (as in Figure 2C) and a streptomycin-sensitive line (similar to Figure 2E). A Northern blot was made and probed with the SPT coding sequence as shown in Figure 6. No SPT transcript was detected in the streptomycin-sensitive line, while the resistant line gave a strong signal at 0.7 kb, the expected size. After stripping and reprobing with a fragment corresponding to the NPT coding sequence, signals of similar intensity were detected in both lines. This is in agreement with the kanamycin resistance phenotype exhibited by the Spr12F streptomycin-sensitive line and provides further evidence that silencing does not spread beyond the SPT gene. Ethidium bromide staining and reprobing of the blot with a RUBISCO fragment both indicated that the samples had been equally loaded (data not shown).

View larger version (61K): [in this window] [in a new window]   Figure 6. —Northern blot analysis of Spr12F homozygous seedlings from a streptomycin-resistant line (G) and a streptomycin-sensitive line (W). 20 µg of total RNA was electrophoresed, blotted, and probed with the SPT coding sequence or the NPT coding sequence.

Trans-silencing directed by allele Spr12F:
The observation that Spr12F homozygous seedlings exhibited a higher frequency of streptomycin-sensitive sectors than Spr12F hemizygous seedlings suggested that an interaction between alleles might be involved. The availability of streptomycin-sensitive Spr12F homozygous lines provided a useful tool for testing this idea. Four streptomycin-sensitive Spr12F homozygous plants were crossed to streptomycin-resistant Spr11E plants. Each plant was also crossed to untransformed tobacco. Typical progeny seedlings resulting from each of these crosses are shown in Figure 2, Figure E–G. Nearly 100% of progeny hemizygous for the Spr12F (white) allele were streptomycin- sensitive (Figure 2E). Nearly 100% of progeny hemizygous for the Spr11E (green) allele were streptomycin-resistant (Figure 2F). Approximately 60% of heterozygous Spr12F (white)/Spr11E (green) seedlings were streptomycin-sensitive (Figure 2G). Spr1E and Spr1A alleles gave similar results when crossed to Spr12F (white) alleles (data not shown). The results of these crosses were the same whether the Spr12F allele was transmitted from the male or the female parent (data not shown).

Streptomycin-resistant and streptomycin-sensitive Spr11E/Spr12F heterozygous plants (green seedlings and white seedlings, respectively, in Figure 2G) were grown to maturity and crossed to untransformed tobacco. The results were the same whether the Spr12F/Spr11E heterozygous parent was used as male or female. Testcross progeny from three streptomycin-sensitive plants (i.e., white seedlings in Figure 2G) are shown in Figure 2, Figure H–J. These progeny are predicted to segregate 50% Spr12F hemizygous and 50% Spr11E hemizygous because the two alleles are linked in repulsion. Southern blot analysis of twelve progeny was consistent with this prediction: seven individuals received the Spr12F allele and five received the Spr11E allele (data not shown). Nearly all of the seedlings observed were streptomycin-sensitive (Figure 2, H–J). This shows that Spr11E hemizygous seedlings inherited the streptomycin sensitivity phenotype after the Spr12F allele had segregated away. Streptomycin-sensitive plants hemizygous for the Spr11E allele were recovered and grown to maturity. Progeny from these plants were germinated on streptomycin-containing medium. The streptomycin sensitivity phenotype persisted in this generation, although the reversion to streptomycin resistance in these seedlings increased to ~5% (data not shown).

Three streptomycin-resistant Spr11E/Spr12F heterozygous plants (i.e., green seedlings in Figure 2G) were grown to maturity and crossed to untransformed tobacco. One plant gave rise to 100% streptomycin-resistant progeny (Figure 2K). Another produced 99% streptomycin-sensitive progeny (Figure 2M). The third produced 50% sensitive and 50% resistant progeny (Figure 2L). From this latter family, five resistant progeny and five sensitive progeny were grown and subjected to Southern blot analysis. This analysis showed that all five streptomycin-sensitive individuals carried the Spr12F allele and all five resistant individuals carried the Spr11E allele (data not shown). Thus, in this particular family, expression of the two alleles was unaffected after passage through the heterozygous condition.

Isolation of new SPT::Ac excision alleles:
We sought to address whether the high frequency loss of SPT gene function associated with the Spr12F allele was caused by the presence of closely linked, directly repeated 4.6 kb Ac sequences flanking the SPT gene (Figure 4). A series of new excision alleles from the 2853.6 locus was generated. A 2853.6 homozygous plant was crossed to untransformed tobacco, progeny were germinated on streptomycin-containing media, and 110 fully green seedlings were selected, as described in MATERIALS AND METHODS. These individuals were grown to maturity, self pollinated, and their progeny were germinated on streptomycin-containing media. Four individuals, Spr368, Spr379, Spr381 and Spr419 gave rise to progeny with a high frequency of white-sectored seedlings similar to the Spr12F allele. In all four of these families, about 40–50% of the green seedlings had white sectors (Table 1, Figure 2, N–Q). The percentage recombination between the trAc and the functional SPT gene was determined for each of the new unstable 2853.6 excision alleles. The results, shown in Table 1, indicated that in each of these alleles the trAc is very closely linked to SPT.

White-sectored plants from each of the new SPT::Ac excision lines were crossed to green Spr11E and Spr1A plants. When the heterozygous progeny from these crosses were germinated on streptomycin-containing media, a high frequency of white-sectored seedlings was observed, suggesting that the new alleles could interact with the Spr1A and Spr11E alleles in the same way as allele Spr12F (data not shown).

Molecular analysis of new SPT::Ac excision alleles:
The newly isolated SPT::Ac excision alleles, selected solely based on their phenotypic similarity to the Spr12F allele, were subjected to Southern blot analysis to test whether they also had similar DNA structures. Figure 3 (lanes 9–12) shows an EcoRI Southern blot hybridized with probe A. Like Spr12F, all four new alleles have the 16-kb band intact, suggesting that Ac₁₆ has not excised. Alleles Spr368 (lane 9) and Spr381 (lane 11) have lost the 10.5-kb band and they each have two new bands, suggesting that Ac_10.5 has transposed downstream of SPT into the region spanned by probe A homology. Allele Spr379 (lane 10) has the 11.5 kb band predicted if Ac_10.5 has excised. Allele Spr419 (lane 12) has a band of similar size to the Ac_10.5 resident band. This Southern blot suggested that Ac_10.5 had excised in each of the new SPT::Ac excision lines. In addition, trAc₃₆₈ and trAc₃₈₁ appeared to have inserted a few kilobases downstream of SPT, similar to trAc_12F .

Figure 7A shows a map of the 2853.6 locus, including XhoI and MluI restriction sites. If a transposition event occurs to within 13 kb of Ac_10.5 or greater than 23 kb of Ac₁₆, new probe A-hybridizing bands should be produced in a Southern blot of XhoI-digested DNA. If the same DNA samples are subjected to Southern blotting after digestion with XhoI plus MluI, the orientation of the trAc may be revealed. If the trAc was inserted in the same orientation as trAc_12F , the MluI site will be between the XhoI sites and the probe A-hybridizing fragment will be reduced in size by ~3 kb.

View larger version (49K): [in this window] [in a new window]   Figure 7. —Southern blot analysis of 2853.6 parent and new alleles. (A) Diagram of the 2853.6 locus with XhoI (X) and MluI (M) restriction sites indicated. The extent of homology to probe fragment A is indicated. (B) Sample 1, 2853.6; sample 2, Spr10D; sample 3, Spr12F; sample 4, Spr368; sample 5, Spr379; sample 6, Spr381; and sample 7, Spr419 were digested with XhoI or with XhoI plus MluI, blotted, and hybridized with probe A.

Figure 7B shows the results of such Southern blots. Sample 1 is the 2853.6 parent, which has a 13-kb band and a >23-kb smear with both digests. Allele Spr10D (sample 2) has had a transposition which disrupts the >23-kb XhoI fragment, resulting in a new 5.2-kb band. The trAc_10D is inserted so that the MluI site is not between the two XhoI sites, a prediction which was confirmed by the XhoI plus MluI Southern blot. Allele Spr12F (sample 3) has undergone a transposition of Ac_10.5 to a position 2.1 kb away from the donor site (Figure 4). This results in two new probe A-hybridizing fragments in the XhoI digest: one at 5.5 kb and the other at ~12 kb. There is also a faint band of 8 kb, which is not predicted. This band is probably because of an early somatic transposition event in the material from which this particular DNA preparation was made. The trAc_12F has inserted in an orientation so that the MluI site in Ac is between the XhoI sites that give rise to the 5.5 kb band. Thus, in the XhoI plus MluI blot, a 2.5 kb band is produced. The band at 5 kb suggests that the trAc which resulted from a somatic transposition event was in the same orientation.

Allele Spr368 (sample 4) has bands of 7 and 13 kb in the XhoI blot. The total size of these two bands is predicted to be ~17.5 kb (as in Spr 12F, 5.5-kb + 12-kb). A careful examination of the Spr368 sample in the EcoRI Southern blot shown in Figure 3 reveals that this digest also produced two bands whose total size was greater than predicted. Thus, these blots are consistent and suggest that allele Spr368 has undergone an additional rearrangement that inserted ~2.5 kb of DNA somewhere between the insertion site of trAc₃₆₈ and the XhoI site. In the XhoI plus MluI blot, the 13-kb band remains unchanged, while the 7-kb band is reduced to ~4 kb. This shows that trAc₃₆₈ transposed ~3.5 kb downstream of SPT and inserted in the same orientation as trAc_12F . Allele Spr379 (sample 5) has a 12-kb band in the XhoI blot. The XhoI plus MluI blot has a band of 9 kb, which shows that trAc₃₇₉ has inserted ~8 kb downstream in the same orientation as trAc_12F . Allele Spr381 (sample 6) has bands of 6.7 and 11 kb in the XhoI blot. The 6.7-kb band is reduced to 3.7 kb in the XhoI plus MluI blot, which shows that trAc₃₈₁ has inserted ~2.7 kb downstream in the same orientation as trAc_12F . Allele Spr419 (sample 7) has an 8-kb band in the XhoI blot, which is reduced to 5 kb in the XhoI plus MluI blot. This shows that trAc₄₁₉ has inserted ~4 kb downstream in the same orientation as trAc_12F . The positions and orientations of the trAc elements in the new SPT::Ac excision alleles deduced from these Southern blots have been confirmed by reprobing the EcoRI blot shown in Figure 3 with Ac 5' and Ac 3' probes (data not shown).

Alleles Spr1A, Spr6A, Spr6F, Spr10N, Spr11B, Spr11E, and Spr12D were analyzed on an XhoI Southern blot similar to the one shown in Figure 8B. Each of these alleles had the 13-kb band and the 23-kb smear intact (data not shown). This result suggested that the trAc had transposed to a position outside of the XhoI sites in each of these alleles.

View larger version (22K): [in this window] [in a new window]   Figure 8. —Structures of the 2853.6 locus in 2853.6 parent and new alleles. Orientation of Ac elements is indicated by an arrow which points in the direction of Ac transcription. XhoI (X) and MluI (M) restriction sites; LB, RB, T-DNA left and right borders, respectively; NPT, neomycin phosphotransferase ; SPT, streptomycin phosphotransferase are indicated.

Structures of new SPT::Ac excision alleles:
Schematic representations of the new SPT::Ac excision alleles deduced from Southern blot analysis are shown in Figure 8. The selection of these new alleles was based solely on their phenotypic similarity to allele Spr12F. Their DNA structures are also remarkably similar to that of allele Spr12F. The new alleles have all had transpositions of Ac10.5 to positions downstream of SPT so that they have two Ac elements in direct orientation flanking the functional SPT gene. TrAc381 moved the shortest distance to a position ~2.7 kb from the starting position. TrAc368 and trAc419 transposed ~3.5- and ~4 kb, respectively. TrAc379 transposed the farthest to a position ~8 kb from the starting position. These data provide a strong correlation between high frequency loss of SPT function and the presence of Ac elements in direct orientation flanking the SPT gene.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The work described here was initiated to characterize the loss of SPT gene function in tobacco plants carrying a series of SPT::Ac excision alleles. The first step was to characterize the structures of the different alleles. The allelic series resulted from 14 transposition events, four of which were to genetically unlinked positions and 11 of which were to very closely linked positions. Four of the closely linked transpositions were to positions less than 10 kb from the starting position (Spr1E, Spr2, Spr10D, and Spr12F) (Figure 4). Thus, Ac has the potential to transpose very short distances in tobacco. The ability of Ac and Ds elements to transpose very short distances has also been observed in maize (WEIL et al. 1992 ) and tomato (CARROLL et al. 1995 ).

The observation that Ac could transpose very short distances at significant frequencies suggested that loss of SPT function could be due to reinsertion of the trAc into SPT. While this appeared to be the case for one Spr1E and two Spr10D streptomycin-sensitive progeny examined (data not shown), the involvement of DNA structural rearrangements was ruled out for streptomycin-sensitive Spr12F homozygous plants examined (Figure 5; data not shown). Consistent with this finding was the observation that loss of SPT function occurred at a much higher frequency in Spr12F homozygous plants than in Spr12F hemizygous plants (Figure 2). There are other examples of gene silencing in which the effect is much stronger when the gene of interest is homozygous rather than heterozygous or hemizygous (DECARVALHO et al. 1992 ; HOLLICK et al. 1995 ; ELMAYAN and VAUCHERET 1996 ; KERMICLE 1996 ).

Southern blot analysis (Figure 3; data not shown) and DNA sequencing (data not shown) indicated that allele Spr12F carried a functional SPT gene flanked by two Ac elements in direct orientation. To address whether this particular structure was involved with loss of marker gene function, 110 new transpositions from line 2853.6 were generated. Four events gave rise to families that had similar phenotypes to Spr12F (Figure 2, N–Q and Table 1). Remarkably, all four new alleles also had Ac elements in direct orientation flanking the functional SPT gene (Figure 8). Thus, a strong correlation was established between this particular structure and high frequency loss of SPT marker gene function.

It is possible that Ac orientation after transposition from the 2853.6 locus may not be random. However, it seems more likely that the recovery of trAc elements all in the same orientation was due to the selection that was used in this experiment. In support of this idea, allele Spr1E, in which Ac inserted in the opposite orientation, does not exhibit a high frequency of white-sectored seedlings and therefore would not have been selected in this screen.

It is interesting that only the SPT gene is silenced. The other marker genes on the 2853.6 T-DNA, Ac, and NPT remain active in all the Spr12F (white) and Spr11E (white) progeny that have been examined (Figure 6; data not shown). This suggests that the effect is specific and that gene silencing does not spread outward from the directly repeated Ac elements. This interpretation is consistent with observations of the Spr2 and Spr10D alleles, which have Ac elements in direct orientation with the functional SPT gene ~1 kb away from one of the Ac elements (Figure 4). If marker genes adjacent to the directly repeated Ac elements were subject to silencing, a higher frequency of SPT loss would be expected in lines Spr2 and Spr10D.

Remarkably, the SPT gene silencing can be transferred from Spr12F to other 2853.6 alleles such as Spr1A, and furthermore, this silencing of Spr1A can be maintained in the absence of the Spr12F allele.

Repeated DNA sequences are associated with many examples of gene silencing in plants and other organisms. Unlinked repeats formed by an introduced T-DNA and an endogenous gene are associated with cosuppression in plants (NAPOLI et al. 1990 ; VAN DER KROL et al. 1990 ). Repeats present in different T-DNA insertions in sequentially transformed tobacco plants have also been shown to participate in gene silencing (MATZKE et al. 1989 ). If repeated sequences are present because of introduction of foreign DNA into the fungus Neurospora crassa, there is a rapid and efficient reaction by the host cell, which causes the sequence to be highly mutated, probably via a methyl-cytosine intermediate (SINGER and SELKER 1995 ). Repeated DNA sequences in the fungi Ascobolus immersus (ROSSIGNOL and FAUGERON 1995 ) and Coprinus cinereus (FREEDMAN and PUKKILA 1993 ) quickly become methylated and silenced. Complex T-DNA insertions, which carry repeated sequences are associated with poor expression of introduced genes ( JONES et al. 1987 ), gene inactivation (HOBBS et al. 1990 ), and a high frequency of cosuppression ( JORGENSEN et al. 1996 ; CLUSTER et al. 1996 ). Also, increasing numbers of r genes within the complex R-st allele of maize are correlated with increasing paramutagenic strength (EGGLESTON et al. 1995 ; KERMICLE et al. 1995 ). In all of the above examples, the repeated sequences that are associated with gene silencing include the promoter and/or coding sequence of the silenced gene(s). Curiously, in the case of the silenced 2853.6 alleles, the repeats that appear to induce silencing do not include the silenced transgene itself. In this example, we have separated the determinant of silencing from the gene whose expression is affected.

A recent review (MATZKE et al. 1996 ) argued that some cases of paramutation and transgene silencing may be due to the action of a genomic defense system that inactivates invasive DNA such as transposons and multicopy transgenes. The presence of doppia transposon sequences in the r gene repeats of the complex maize R-st allele supports this idea. The doppia sequences provide the only homology within the promoter regions of the paramutagenic components of the R-st allele and paramutable components of the R-r allele. Moreover, the P gene of the complex R-r allele lacks a doppia element and is relatively insensitive to paramutation (WALKER et al. 1995 ). However, after several generations of paramutation, P expression is heritably reduced, thus adding support to the argument that doppia elements are not required for heritable silencing (BRINK 1973 ).

Transposable elements have also been postulated to be involved with silencing interactions between nivea alleles in Antirrhinum majus. The niv-44 allele carries a Tam2 element within the nivea gene (UPADHYAYA et al. 1985 ). The niv-53 allele carries a Tam1 element in the promoter of nivea (BONAS et al. 1984 ). KREBBERS et al. 1987 proposed that an interaction between these transposons could be involved in the transfer of epigenetic information between alleles. However, a derivative of the niv-44 allele, niv-4432, was recovered that no longer had Tam2 at nivea, but that was still able to influence expression of niv-53 in trans. This result may indicate that transposon Tam2 is not important in this example of silencing. Alternatively, it may be that the initial process that gave rise to the trans silencing allele involved Tam2, but that the transposon was not required for its maintenance. For example, if the niv-44 allele had an altered chromatin structure due to the presence of Tam2, the altered chromatin structure might persist even after excision of Tam2.

The maize b locus has been studied extensively with regard to paramutation. The sequences required in cis for paramutation have been mapped within 0.1 cM (1–150 kb) upstream of the transcription start site in the paramutagenic allele B' (PATTERSON et al. 1995 ). Transposon sequences have been detected within this region in both paramutagenic and paramutable alleles, suggesting that transposons are not the determinant of paramutation in this case.

DORER and HENIKOFF 1994 proposed that silencing of mini-white transgenes in Drosophila was because of the formation of heterochromatin as in position-effect variegation (PEV). Repeated sequences are also involved in this example, and increasing numbers of repeats are inversely correlated with mini-white expression. In Drosophila, known modifiers of PEV exist that can be crossed in to the silencing stock to test their effect on silencing. These tests indicated that the silencing of mini-white transgenes was indeed because of heterochromatin formation at the transgene loci. The favored model is that the multiple, closely linked copies of the mini-white transgenes can pair somatically, and the resulting folded structures are recognized by heterochromatin-specific proteins (DORER and HENIKOFF 1994 ). Curiously, silencing of mini-white transgenes in Drosophila appears to be dependent on the orientation of the repeated sequences relative to each other and relative to the heterochromatin/euchromatin transitions (SABL and HENIKOFF 1996 ). It is striking that in our study no Spr12F-like derivatives were recovered in which Ac₁₆ had moved into direct orientation with Ac₁₀. This may indicate that the orientation of the Ac elements relative to the centromere, or other chromosomal features, is important.

Localized heterochromatin formation could explain the results reported here. This process might be facilitated if Ac transposase binding to its target sites in the Ac subterminal repeats (KUNZE and STARLINGER 1989 ) stabilized any folded structures that formed. It is known that Ac elements can interact over distances of >18 kb (i.e., greater than the distances between Ac elements in any of the unstable 2853.6 Spr alleles described here) leading to excision (RALSTON et al. 1989 ). It is also known that the choice of which element ends participate as a transposition substrate depends on their relative orientations (ENGLISH et al. 1993 ). This could explain the phenotypic differences between the unstable 2853.6 excision alleles and the stable allele Spr1E. Heterochromatin-specific proteins would recognize and bind to the folded structures as proposed for silencing of mini-white transgenes in Drosophila (DORER and HENIKOFF 1994 ). Transfer of the heterochromatic state from one allele to another, possibly by transfer of heterochromatin-specific proteins, would lead to silencing in trans.

If the silencing of SPT in the 2853.6 excision alleles is due to heterochromatin formation, it is curious that it does not spread to neighboring genes. There is no decrease in NPT mRNA accumulation in Spr12F (white) plants (Figure 6), and the kanamycin resistance phenotype is maintained for at least three generations of selfing after loss of SPT function (data not shown). These results would indicate that if heterochromatin formation is involved, it can be very localized.

Binding of Ac transposase to the subterminal repeats of Ac could potentially have more direct effects on SPT expression. Steric hindrance because of the binding of Ac transposase molecules near to the 2' promoter could prevent transcription of SPT. FRIDLENDER et al. 1996 showed that Ac transposase could repress expression from the Ac transposase gene promoter (which overlaps the 5' subterminal repeat region) or chimeric promoters containing part of the 5' subterminal repeat region. Alternatively, binding of Ac transposase molecules could produce topological alterations in the DNA which would affect transcription. For example, if DNA nicking associated with attempted Ac transposition released DNA supercoiling locally, transcription of intervening DNA might be affected. However, it is not clear why this "supercoiling release" mechanism would have a more pronounced effect between direct copies of Ac than between inverted copies.

Topological constraints could be particularly relevant in the case of Spr12F and the other unstable 2853.6 alleles. It is possible that the directly oriented Ac elements promote, and act as boundaries for, the formation of a small loop domain which would be stabilized by binding of Ac transposase. This could explain why only the SPT gene is affected because it would be the only gene contained in such a loop.

In summary, we have provided a strong correlation between a particular structure, comprised of two directly repeated Ac elements flanking a SPT marker gene and silencing a SPT marker gene. In this system, the directly repeated Ac elements appear to be responsible for silencing of SPT in cis and in trans. Thus, we have separated the determinant of gene silencing from the affected gene. This was made possible by the exploitation of a transposon-carrying T-DNA insertion to generate an allelic series. These results provide new insights into the related areas of gene silencing and paramutation.

	FOOTNOTES

¹ Present address: DNA Plant Technology, Inc., 6701 San Pablo Avenue, Oakland, CA 94608.

	ACKNOWLEDGMENTS

This work was supported by a grant from the Gatsby Charitable Foundation to the Sainsbury Laboratory. We also thank DNA Plant Technology, Inc., for making plant material produced by J.J. available prior to moving to the Sainsbury Laboratory.

Manuscript received April 9, 1997; Accepted for publication October 1, 1997.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

BOLLMAN, J., R. CARPENTER, and E. S. COEN, 1991  Allelic interactions at the nivea locus of Antirrhinum.. Plant Cell 3:1327-1336[Abstract].

BONAS, U., H. SOMMER, B. J. HARRISON, and H. SAEDLER, 1984  The transposable element Tam1 of Antirrhinum majus is 17 kb long. Mol. Gen. Genet. 194:138-143.

BRINK, R. A., 1973  Paramutation. Annu. Rev. Genet. 7:129-152[Medline].

CARROLL, B. J., V. I. KLIMYUK, C. M. THOMAS, G. J. BISHOP, and K. HARRISON et al., 1995  Germinal transpositions of the maize element Dissociation from T-DNA loci in tomato. Genetics 139:407-420[Abstract].

CLUSTER, P. D., M. O'DELL, M. METZLAFF, and R. B. FLAVELL, 1996  Details of T-DNA structural organization from a transgenic Petunia population exhibiting co-suppression. Plant Mol. Biol. 32:1197-1203[Medline].

COE, E. H., 1966  The properties, origins and mechanism of conversion-type inheritance at the b locus in maize. Genetics 53:1035-1063[Free Full Text].

COGONI, C., J. T. IRELAN, M. SCHUMACHER, T. J. SCHMIDHAUSER, and E. U. SELKER et al., 1996  Transgene silencing of the Al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO J. 15:3153-3163[Medline].

DECARVALHO, F., G. GHEYSEN, S. KUSHNIR, M. VAN MONTAGU, and D. INZÉ et al., 1992  Suppression of beta-1, 3-glucanase transgene expression in homozygous plants. EMBO J. 11:2595-2602[Medline].

DOONER, H. K. and A. BELACHEW, 1991  Chromosome breakage by pairs of closely linked transposable elements of the Ac-Ds family in maize. Genetics 129:855-862[Abstract].

DORER, D. R. and S. HENIKOFF, 1994  Expansions of transgene repeats cause heterochromatin formation and gene silencing in Drosophila.. Cell 77:993-1002[Medline].

EGGLESTON, W. B., M. ALLEMAN, and J. L. KERMICLE, 1995  Molec-ular organization and germinal instability of R-stippled maize. Genetics 141:347-360[Abstract].

ELMAYAN, T. and H. VAUCHERET, 1996  Expression of single copies of a strongly expressed 35S transgene can be silenced post-transcriptionally. Plant J. 9:787-797.

ENGLISH, J. J., E. MUELLER, and D. C. BAULCOMBE, 1996  Suppression of virus accumulation in transgenic plants exhibiting silencing of nuclear genes. Plant Cell 8:179-188[Abstract].

ENGLISH, J. J., K. A. HARRISON, and J. D. G. JONES, 1993  A genetic analysis of DNA sequence requirements for Dissociation State I activity in tobacco. Plant Cell 5:501-514[Abstract].

FEINBERG, A. P. and B. VOGELSTEIN, 1983  A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13[Medline].

FLAVELL, R. B., 1994  Inactivation of gene expression in plants as a consequence of specific sequence duplication. Proc. Natl. Acad. Sci. USA 91:3490-3496[Abstract/Free Full Text].

FREEDMAN, T. and P. J. PUKKILA, 1993  De novo methylation of repeated sequences in Coprinus cinereus.. Genetics 135:357-366[Abstract].

FRIDLENDER, M., K. HARRISON, J. D. G. JONES, and A. A. LEVY, 1996  Repression of the Ac-transposase gene promoter by Ac transposase. Plant J. 9:911-917.

HAGEMANN, R., 1969  Somatic conversion (paramutation) at the sulfurea locus of Lycopersicon esculentum.. Can. J. Genet. Cytol. 11:346-358.

HOBBS, S. L. A., P. KPODAR, and C. M. O. DELONG, 1990  The effect of T-DNA copy number, position, and methylation on reporter gene expression in tobacco transformants. Plant Mol. Biol. 15:851-864[Medline].

HOLLICK, J. B., G. I. PATTERSON, E. H. COE, K. C. CONE, and V. L. CHANDLER, 1995  Allelic interactions heritably alter the activity of a metastable maize pl gene. Genetics 141:709-719[Abstract].

JONES, J. D. G., F. C. CARLAND, E. LIM, E. RALSTON, and H. K. DOONER, 1990  Preferential transposition of the maize element Activator to linked chromosomal locations in tobacco. Plant Cell 2:701-707[Abstract].

JONES, J. D. G., F. M. CARLAND, P. MALIGA, and H. K. DOONER, 1989  Visual detection of transposition of the maize element Activator (Ac) in tobacco seedlings. Science (Wash.) 244:204-207[Abstract/Free Full Text].

JONES, J. D. G., D. GILBERT, K. GRADY, and R. JORGENSEN, 1987  T-DNA structure and gene expression in petunia plants transformed by Agrobacterium C58 derivatives. Mol. Gen. Genet. 207:478-485.

JORGENSEN, R. A., 1992  Silencing of plant genes by homologous transgenes. AgBiotech News and Info. 4:265-273.

JORGENSEN, R. A., P. D. CLUSTER, J. J. ENGLISH, Q. QUE, and C. A. NAPOLI, 1996  Chalcone synthase co-suppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and single copy vs. complex T-DNA sequences. Plant Mol. Biol. 31:957-973[Medline].

KERMICLE, J. L., 1996 Epigenetic silencing and activation of a maize r gene, pp. 267-285 in Epigenetic Mechanisms of Gene Regulation, edited by V. E. A. RUSSO, R. A. MARTIENSSEN, and A. D. RIGGS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

KERMICLE, J. L., W. B. EGGLESTON, and M. ALLEMAN, 1995  Organi-zation of paramutagenicity in R-stippled maize. Genetics 141:361-372[Abstract].

KREBBERS, E., R. HEHL, R. PIOTROWIAK, W.-E. LONNIG, and H. SOMMER et al., 1987  Molecular analysis of paramutant plants of Antirrhinum majus and the involvement of transposable elements. Mol. Gen. Genet. 209:499-507.

KUNZE, R. and P. STARLINGER, 1989  The putative transposase of transposable element Ac from Zea mays L interacts with subterminal sequences of Ac.. EMBO J. 8:3177-3185[Medline].

MARTIENSSEN, R. A. and E. J. RICHARDS, 1995  DNA methylation in eukaryotes. Curr. Opin. Genet. Dev. 5:234-242[Medline].

MATZKE, M. A., A. J. M. MATZKE, and W. B. EGGLESTON, 1996  Para-mutation and transgene silencing: a common response to invasive DNA? Trends in Plant Sci. 1:382-388.

MATZKE, A. J. M. and M. A. MATZKE, 1995a  Trans-inactivation of homologous sequences in Nicotiana tabacum.. Curr. Topics Microbiol. and Immunol. 197:1-14.

MATZKE, M. A. and A. J. M. MATZKE, 1995b  How and why do plants inactivate homologous (trans)genes? Plant Physiol. 107:6679-685.

MATZKE, M. A., M. PRIMIG, J. TRNOVSKY, and A. J. M. MATZKE, 1989  Reversible methylation and inactivation of marker genes in sequentially transformed tobacco plants. EMBO J. 8:643-649[Medline].

MUELLER, E., J. E. GILBERT, G. DAVENPORT, G. BRIGNETI, and D. C. BAULCOMBE, 1995  Homology-dependent resistance: transgenic virus resistance in plants related to homology-dependent gene silencing. Plant J. 7:1001-1013.

NAPOLI, C., C. LEMIEUX, and R. A. JORGENSEN, 1990  Introduction of a chimeric chalcone synthase gene into Petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2:279-289[Abstract].

OCHMAN, H., A. S. GERBER, and D. L. HARTL, 1988  Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623[Abstract].

PARK, Y.-D., I. PAPP, E. A. MOSCONE, V. A. IGLESIAS, and H. VAUCHERET et al., 1996  Gene silencing mediated by promoter homology occurs at the level of transcription and results in meiotically heritable alterations in methylation and gene activity. Plant J. 9:183-194[Medline].

PATTERSON, G. I., and V. L. CHANDLER, 1995 Paramutation in maize and related allelic interactions, pp. 121–141 in Current Topics in Microbiology and Immunology, Gene Silencing in Higher Plants and Related Phenomena in Other Eukaryotes, Vol. 197, edited by P. MEYER. Springer-Verlag, Berlin.

PATTERSON, G. I., K. M. KUBO, T. SHROYER, and V. L. CHANDLER, 1995  Sequences required for paramutation of the maize b gene map to a region containing the promoter and upstream sequences. Genetics 140:1389-1406[Abstract].

PATTERSON, G. I., C. J. THORPE, and V. L. CHANDLER, 1993  Paramu-tation, an allelic interaction, is associated with a stable and heritable reduction of transcription of the maize b regulatory gene. Genetics 135:881-894[Abstract].

POHLMAN, R. F., N. V. FEDOROFF, and J. MESSING, 1984  The nucleotide sequence of the maize controlling element Activator.. Cell 37:635-643[Medline].

PRÖLS, F. and P. MEYER, 1992  The methylation patterns of chromosomal integration regions influence gene activity of transferred DNA in Petunia hybrida.. Plant J. 2:465-475[Medline].

RALSTON, E., J. ENGLISH, and H. K. DOONER, 1989  Chromosome-breaking structure in maize involving a fractured Ac element. Proc. Natl. Acad. Sci. USA 86:945-9455.

ROSSIGNOL, J. L., and G. FAUGERON, 1995 MIP: an epigenetic gene silencing process in Ascobolus immersus, pp. 179–191 in Current Topics in Microbiology and Immunology, Gene Silencing in Higher Plants and Related Phenomena in Other Eukaryotes , Vol. 197, edited by P. MEYER. Springer-Verlag, Berlin.

SABL, J. F. and S. HENIKOFF, 1996  Copy number and orientation determine the susceptibility of a gene to silencing by nearby heterochromatin in Drosophila.. Genetics 142:447-458[Abstract].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SINGER, M. J., and E. U. SELKER, 1995 Genetic and epigenetic inactivation of repetitive sequences in Neurospora crassa: RIP, DNA methylation, and quelling, pp. 165–177 in Current Topics in Microbiology and Immunology, Gene Silencing in Higher Plants and Related Phenomena in Other Eukaryotes, Vol. 197, edited by P. MEYER. Springer-Verlag, Berlin.

THOMAS, C. M., D. A. JONES, J. J. ENGLISH, B. J. CARROLL, and J. L. BENNETZEN et al., 1994  Analysis of the chromosomal distribution of transposon-carrying T-DNAs in tomato using the inverse polymerase chain reaction. Mol. Gen. Genet. 242:573-585[Medline].

UPADHYAYA, K. C., H. SOMMER, E. KREBBERS, and H. SAEDLER, 1985  The paramutagenic line niv-44 has a 5 kb insert, Tam2, in the chalcone synthase gene of Antirrhinum majus.. Mol. Gen. Genet. 199:201-207.

VAN DER KROL, A. R., L. A. MUR, M. BELD, J. N. M. MOL, and A. R. STUITJI, 1990  Flavonoid genes in petunia: addition of a limited number of gene copies may lead to a suppression of gene expression. Plant Cell 2:291-299[Abstract].

WALKER, E. L., T. P. ROBBINS, T. E. BUREAU, J. KERMICLE, and S. L. DELLAPORTA, 1995  Transposon-mediated chromosomal rearrangements and gene duplications in the formation of the maize R-r complex. EMBO J. 14:2350-2263[Medline].

WEIL, C. F., S. MARILLONNET, B. BURR, and S. R. WESSLER, 1992  Changes in state of the wx-m5 allele of maize are due to intragenic transposition of Ds.. Genetics 130:175-185[Abstract].

This article has been cited by other articles:

				M. Stam Paramutation: A Heritable Change in Gene Expression by Allelic Interactions In Trans Mol Plant, April 8, 2009; (2009) ssp020v1. [Abstract] [Full Text] [PDF]

				F. Zhang and T. Peterson Comparisons of Maize pericarp color1 Alleles Reveal Paralogous Gene Recombination and an Organ-Specific Enhancer Region PLANT CELL, March 1, 2005; 17(3): 903 - 914. [Abstract] [Full Text] [PDF]