Genetics, Vol. 148, 267-276, January 1998, Copyright © 1998, Genetics Society of America

A Genetically Marked I Element in Drosophila melanogaster Can Be Mobilized When ORF2 Is Provided in trans

Isabelle Busseaua, Sophie Malinskya, Maria Balakireva1,a, Marie-Christine Chaboissiera, Danielle Teningesa, and Alain Buchetona
a Centre de Génétique Moléculaire, CNRS, 91198 Gif-sur-Yvette, France

Corresponding author: Isabelle Busseau, Centre de Génétique Moléculaire, 91198 Gif-sur-Y vette cedex, France, busseau{at}cgm.cnrs-gif.fr (E-mail).

Communicating editor: M. J. SIMMONS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

I factors in Drosophila melanogaster are non-LTR retrotransposons similar to mammalian LINEs. They transpose at very high frequencies in the germ line of SF females resulting from crosses between reactive females, devoid of active I factors, and inducer males, containing active I factors. The vermilion marked IviP2 element was designed to allow easy phenotypical screening for retrotransposition events. It is deleted in ORF2 and therefore cannot produce reverse transcriptase. IviP2 can be mobilized at very low frequencies by actively transposing I factors in the germ line of SF females. This paper shows that IviP2 can be mobilized more efficiently in the germ line of strongly reactive females in the absence of active I factors, when it is trans-complemented by the product of ORF2 synthesized from the hsp70 heat-shock promoter. This represents a promising step toward the use of marked I elements to study retrotransposition and as tools for mutagenesis.


NON-LTR retrotransposons or LINEs are widespread in eukaryotes (EICKBUSH 1992 Down). In general, most of these elements are in a quiescent state within their host genome, but transposition events occur occasionally. For example, in humans some cases of genetic diseases and cancers were shown to be the result of L1 element insertions into genes (see SASSAMAN et al. 1997 Down, and references herein).

The I factor in Drosophila melanogaster is a non-LTR retrotransposon of particular interest because conditions that allow its transposition at high frequencies are provided by I-R (Inducer-Reactive) hybrid dysgenesis (PICARD et al. 1978 Down; BREGLIANO and KIDWELL 1983 Down; for reviews, see BUCHETON et al. 1992 Down; BUSSEAU et al. 1994 Down). Several potentially active I factors are present in the genome of inducer strains, where they remain stable (BUCHETON et al. 1984 Down), whereas reactive strains are devoid of active I factors. Transposition of I factors occurs at high frequencies in the germ line of hybrid females, called SF females, produced by crosses involving females from a reactive strain and males from an inducer strain (PICARD 1976 Down). Transposition is accompanied by a characteristic syndrome of sterility: a proportion of the eggs laid by SF females dies early in development (PICARD and L'HERITIER 1971 Down; LAVIGE 1986 Down). The degree of sterility correlates with the frequency of transposition and depends mainly upon the reactivity level of the females used in the cross (BUCHETON et al. 1976 Down): females from a strongly reactive stock produce highly sterile SF females (hatching percentage close to zero) with high level of I factor transposition (up to more than one event/gamete), whereas females from a weakly reactive stock produce less sterile to normally fertile SF females with a lower level of transposition. The reactivity level is controlled by chromosomal determinants but, in the short run (i.e., in the passage from one generation to the next), is essentially maternally transmitted (BUCHETON and PICARD 1978 Down; BUCHETON and BREGLIANO 1982 Down).

The I factor possesses all features typical of non-LTR retrotransposons. It transposes by reverse transcription of an RNA intermediate (PELISSON et al. 1991 Down; JENSEN and HEIDMANN 1991 Down). Transcription is initiated from an internal promoter lying within the first 186 bp (MCLEAN et al. 1993 Down) to produce a full-length 5.4 kb RNA that is believed to function both as an intermediate for retrotransposition and a bicistronic messenger for the synthesis of the products of the two open reading frames, ORF1 and ORF2 (CHABOISSIER et al. 1990 Down; BOUHIDEL et al. 1994 Down). ORF1 encodes a nucleic acid binding protein containing a central cysteine-rich motif (DAWSON et al. 1997 Down). ORF2 has the capacity of encoding a polypeptide with reverse transcriptase, RNase H, and endonuclease domains (FAWCETT et al. 1986 Down; ABAD et al. 1989 Down; MARTIN et al. 1995 Down; FENG et al. 1996 Down). The 3' end of I factors is typically made of several (three to eight) repeats of a TAA triplet instead of the usual poly(A) tail found in most other LINEs. All aspects of I factor retrotransposition regulation and tissue specificity are mainly effective at the level of transcription and/or RNA stability (CHABOISSIER et al. 1990 Down; LACHAUME et al. 1992 Down; MCLEAN et al. 1993 Down; UDOMKIT et al. 1996 Down).

HEIDMANN et al. 1988 Down have designed a powerful system using a marker gene interrupted by an intron to indicate retrotransposition. This system has been used successfully in the study of various non-LTR retrotransposons (TCHENIO et al. 1993 Down; MAESTRE et al. 1995 Down; MORAN et al. 1996 Down) including the I factor (JENSEN and HEIDMANN 1991 Down; JENSEN et al. 1994 Down; CHABOISSIER et al. 1995 Down). However, in the case of the I factor, none of the marked elements could be mobilized at high frequency. The IviP2 element, in which most of the sequences from ORF2 are replaced by the vermilion gene disrupted by the second intron of the P element, can be complemented in trans by actively transposing I factors in the germ-line of SF females (CHABOISSIER et al. 1995 Down). Under these conditions, transposition occurs at a very low frequency (3 x 10-4), rendering this system inefficient for the study of retrotransposition. The data presented in this paper indicate that the efficiency of transposition of the IviP2 element can be improved by complementing it in trans with a construct in which synthesis of the product of ORF2 is controlled by the heat-inducible hsp70 promoter.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Fly stocks:
All strains used in the experiments are M in the PM system of hybrid dysgenesis (see ENGELS 1989 Down). The genetic nomenclature follows LINDSLEY and ZIMM 1992 Down. w1118 is an inducer strain. The strong reactive wK strain was obtained from LUNING 1981 Down. Strong reactive strains JA, carrying y and w mutations, yv, carrying y and v mutations, and misy , carrying v and ry506 mutations, are from our laboratory. v; Cy/Bl; ry506 has a balancer second chromosome marked with Cy .

7.51R is a transgenic line, homozygous for an X chromosome containing the IviP2 element, that derives from the weak reactive O/O strain carrying v and ry506 mutations (CHABOISSIER et al. 1995 Down). Establishment of the strong reactive 7.51RF#6 subline was done by several successive backcrosses of 7.51R to the strong reactive misy strain as follows: females obtained by crossing misy females with 7.51R males were mated to misy males to produce males carrying the transgene [scored by the (ry+) phenotype] that were backcrossed to misy females. This scheme was repeated three times in succession, after which single matings were performed to establish sublines. The reactivity level of these sublines was determined by dysgenic crosses using the w1118 inducer strain. Females from the 7.51RF#6 subline, when crossed to w1118 males, constantly produced highly sterile S F females (no hatched eggs) over more than 22 generations.

Plasmid constructions and transgenic lines:
All cloned sequences from the I factor derive from pI407 (BUCHETON et al. 1984 Down) which contains a fully active I factor (PELISSON 1981 Down; PRITCHARD et al. 1988 Down). Site positions are given according to the sequence published by FAWCETT et al. 1986 Down. Construction of pIviP2 (Figure 1) was previously described (CHABOISSIER et al. 1995 Down). phsORF2HR (Figure 1) was obtained in two steps. First, a KpnI-XbaI fragment (positions 4849–5108) and a XbaI-RsaI fragment (positions 5108–5213) from pI407 were ligated together to the KpnI-SmaI-cut pBluescript KS+ vector, producing clone pIK2. Then, a BamHI-KpnI fragment from pIK2 and a HpaI-KpnI fragment from pI407 (positions 1489–4849) were ligated together to the Bgl II/HpaI-cut pCaSpeR-hs vector (THUMMEL and PIROTTA 1991 Down). phsORF2HN (Figure 1) was obtained by ligation of the HpaI-NruI fragment from pI407 (positions 1489–5572), that contains all ORF2 as well as the 3' end of the I factor flanked by 200 bp of white gene DNA, into the HpaI site of the pCaSpeR-hs vector.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. —Constructs and transgenic lines. For clarity the vectors are not drawn, but the positions of the transformation markers white and rosy are indicated. Triangles at the extremities symbolize the P element ends. Black boxes represent sequences from the I factor with the positions of open reading frames indicated as lines below the boxes. The position of the TAA repeats at the 3' end of I is shown. White boxes represent sequences from the white gene flanking the complete I factor cloned in pI407. The vermilion gene is shown as a shaded box and the position of the intron from the P element is indicated by a triangle with an arrow on top showing its orientation. Sequences from the hsp70 gene are shown as striped boxes with the positions of the TATA box (TATAA) and the polyadenylation signal (AATAAA) indicated. Directions of transcription from the I and vermilion promoters are indicated by bent arrows at the start sites.

P element based transformations were essentially as described by SPRADLING and RUBIN 1982 Down except that puchs{pi}{Delta}2–3 (Flybase ID: FBmc0002087) was co-injected as the source of transposase. Transformation recipient strains were wK for phsORF2HN and JA for phsORF2HR. Three independent homozygous transgenic lines were established for each construct (Figure 1) by selecting dark orange-eyed flies, and chromosome localizations of the transgenes were determined using balancer stocks. The v ; Cy/Bl; ry 506 balancer stock was used to introduce hsORF2HR and hsORF2HN from transgenic lines HR136 and HN27, respectively, into a v; ry 506 background.

Crosses:
All crosses were performed on standard fly medium (GANS et al. 1975 Down) at 23° unless otherwise stated. Typically, several samples of 10–13 virgin females were mated to 8–10 males in vials. They were transferred on fresh medium when necessary, until the age of 8–10 days when they were discarded. Heat-shock treatments were applied by placing the vials at 37° for one hour once a day, from the embryonic stage to egg-laying adults.

Inverse PCR and sequencing:
Inverse PCR on Nde II-cut DNA extracted from single flies was performed as described by GLOOR et al. 1993 Down and GLOOR and ENGELS 1995 Down. Positions of primers within the IviP2 sequences are shown in Figure 4. The first round of amplification was with primers RI270 (5'CAACCCTCTAGACCTTCTTAGC3') and v996 (5'TTGATAATTCCCAGCCTATCTGGC3'). Following 35 amplification cycles (94° for 45 seconds, 60° for 45 seconds, 72° for 45 seconds), an aliquot of the PCR product was subjected to a second round of 30 amplification cycles under the same conditions with primers RI160 (5'GTACATAACAAGCCAGCAATAG3') and v1003 (5'ATCTGGCAGTGCCCATCGCC3'). PCR products were purified on MicroSpin(TM) S-400 HR Columns (Pharmacia, Piscataway, NJ) and sequenced with the OmniBase(TM) DNA Cycle Sequencing System (Promega, Madison, WI) using primer RI80 (5'GTAAGCCCCGTAGCTAATGCTATAC3').



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. —Schemes to detect complementation of IviP2 by hsORF2HR and hsORF2HN. (A) Using the 7.51R weakly reactive transgenic line. (B) Using the 7.51RF#6 strongly reactive transgenic line. (See text for details.)



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. —Positions of primers used in inverse PCR and sequencing experiments. Legend is the same as in Figure 1. The position of the Nde II site relevant to this work is shown. Arrowheads indicate the orientations of the primers: RI270, RI160 and RI80 are from the sense strand with respect to I factor transcription, v1003 and v996 are from the antisense strand.



View larger version (88K):
[in this window]
[in a new window]
 
Figure 4. —Sequences at the 3' ends of some transposed copies of IviP2. Sequences from the 3' end of the I factor are indicated in bold, including all TAA repeats. Transposed copies are named as "E-Xn" where E represents the name of the experiment (see Table 1 and Table 2), X represents the sample of parents from which they were recovered and n (a or b) is the order of recovery when more than one copy were found in the progeny of the same parents.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The low frequency of transposition of the IviP2 element observed in the germline of SF females (CHABOISSIER et al. 1995 Down) might be due in part to competition for the use of the reverse transcriptase between the IviP2 transcript and RNA transposition intermediates synthesized from the actively transposing I factors. If this is true, the IviP2 element might be mobilized more efficiently when the reverse trancriptase is supplied in trans in the absence of active I factors. In order to address this question, the I factor ORF2 was placed under the control of the heat-inducible hsp70 promoter in constructs phsORF2HR and phsORF2HN (Figure 1). These two constructs differ in that phsORF2HR contains the termination signal from the hsp70 gene, whereas phsORF2HN contains the native 3' end of the I factor followed by the termination signal from the hsp70 gene.

To exclude position effects, three independent transgenic lines were established for each construct (Figure 1) and used in the experiments described below. Only one line transgenic for IviP2 was used because previous work showed that, in SF females, mobilization of the IviP2 element from different independent transgenic lines occurred at similar rates (CHABOISSIER et al. 1995 Down; I. BUSSEAU, unpublished results).

Genetic screens were done in a v;ry mutant background. Therefore, flies carrying the IviP2 donor element are [v; ry+], because this element is associated with the wild-type rosy gene that was used as the transformation marker and with an inactive vermilion gene, disrupted by the P intron (Figure 1). Flies carrying a transposed copy of IviP2, in which the intron was spliced out, are [v+; ry+] if they contain also the donor IviP2 element, and [v+ry] if they do not.

IviP2 can be complemented by the product of ORF2 under heat-shock control:
The general scheme of crosses is depicted in Figure 2A. Females from the 7.51R stock, homozygous for IviP2 on the X chromosome, were crossed with males from HR or HN stocks, homozygous for hsORF2HR or hsORF2HN, respectively, on autosomes. In G1, [v] males carrying both IviP2 and hsORF2 transgenes were recovered. In the standard experiments, these males were crossed with females from the strongly reactive [v;ry] misy strain, and the resulting G2 females were submitted to heat-shock treatments and mated with their brothers. Trans-complementation of IviP2 might occur in the germ line of half of these females, which receive both the IviP2 and hsORF2 transgenes. Retrotransposition events should result in the occurrence of [v+] progeny in G3.

The results are shown in Table 1. In the first set of experiments (P1, S1–2, T3, M1–2), three independent HR lines were used. In all cases [v+] flies were recovered at low frequencies, ranging from 0.6 to 1.8 x 10-3. In experiment T1, in which the heat shock treatments were omitted, no [v+] fly was found among more than 9000 flies observed, suggesting that trans-complementation of IviP2 observed in the other experiments requires heat induction of the synthesis of the product of ORF2. Experiments M3–5 were done using three independent HN lines. [v+] flies were again recovered at low frequencies ranging from 1.8 to 2.8 x 10-3. Interestingly, these frequencies seem to be constantly somewhat higher (roughly twofold) than those obtained when using HR (compare M3–5 with M1–2). However, sample sizes are too small to allow statistical analysis. Experiments S3 and S4 were done using G1 females from another strongly reactive strain, y v, instead of misy. In this case the frequency of transposition of IviP2 was found to be around 0.5 x 10-3, which is about two- to threefold lower than when the misy strain was used (compare S3 with S1, S4 with S2). No obvious correlation can be made with the reactivity level which was roughly the same in both strains y v and misy.


 
View this table:
[in this window]
[in a new window]
 
Table 1. Results of the experiments described in Figure 2A

Altogether, these results show that transposition of IviP2 can occur in the absence of transposing I factors when the product of ORF2 is available for trans-complementation, and, in these conditions (after heat-shock induction), is more efficient than in SF females where the frequency of transposition of IviP2 was around 3 x 10-4 (CHABOISSIER et al. 1995 Down). However, this system still remains inefficient to be useful in the study of I factor transposition; additionally, it is laborious as it requires three generations of flies.

Toward an efficient system of transposition of the marked IviP2 element:
To improve the efficiency of transposition of IviP2, the two-generation scheme of crosses shown in Figure 2B was designed. In this scheme, females homozygous for IviP2 are mated with males from HR or HN stocks, homozygous for an autosomal insertion of hsORF2 in a v;ry background. Transposition is expected to occur in the germ-line of G1 females, which contain both IviP2 and hsORF2. These females are submitted to heat-shock treatments and mated with their brothers. In this case, the frequency of transposition is equal to the frequency of [v+] flies recovered in the next generation (G2).

This scheme of crosses requires that strongly reactive females are used in G0 to ensure efficient transcription of IviP2 in the germ line of G1 females. The 7.51R transgenic line containing the IviP2 element was derived from the weakly reactive O/O strain (CHABOISSIER et al. 1995 Down) and is therefore weakly reactive. The strongly reactive subline 7.51RF#6 was thus established, following several backcrosses of line 7.51R to the strongly reactive misy strain (see MATERIALS AND METHODS). The experiments described in Figure 2B were done using females from this subline in G0.

The results are shown in Table 2. A transposition frequency of 1.9 x 10-3 was found in experiment M7 using HR136. Sample sizes are too small to allow statistical analysis, but this result does not seem significantly different from that obtained in experiment P1 (1.8 x 10-3, Table 1). Results were better when HN27 was used: transposition frequencies obtained in experiments M62 and M63 were found to be 6.7 x 10-3 and 5.0 x 10-3, respectively. Some transposition events occurred, at a tenfold lower level, in experiment M64 in which heat-shock treatments were omitted, reflecting a low level of basal activity of the hsp70 promoter.


 
View this table:
[in this window]
[in a new window]
 
Table 2. Results of the experiments described in Figure 2B.

The efficiency of transposition of IviP2 is affected by the reactivity level:
As mentioned earlier, the frequency of I factor transposition in the germ line of SF females is modulated by the reactivity level (PICARD 1976 Down; PICARD 1978 Down), which influences the efficiency of transcription from the internal promoter of the I factor (MCLEAN et al. 1993 Down; LACHAUME and PINON 1993 Down). The reactivity level is affected by nongenetic factors such as aging and temperature of development (BUCHETON 1978 Down; BUCHETON 1979A Down, BUCHETON 1979B Down). Indeed, we noticed during the course of this work that, in most cases, [v+] flies were recovered more frequently in the progeny of young females than in the progeny of older females. Moreover, in experiment T2, G2 females developed at 29° from embryonic to late pupal stages. This treatment is known to increase the reactivity level. Heat-shock treatments were performed as usual. The frequency of transposition of IviP2 was 2.0 x 10-3 in this experiment, whereas it was 1.1 x 10-3 in experiment T3, which was performed in parallel following standard conditions. These various observations, although not statistically significant, suggest that the reactivity level might influence the frequency of mobilization of IviP2.

Experiment N1 was designed to definitively address the issue of whether the reactivity level influences the frequency of transposition of IviP2. This experiment was done in the same way as experiment M7, except that it was started from the reciprocal cross in G0: females from the v; HR133; ry stock were mated to males from the 7.51RF#6 subline. The reactivity level of the v; HR133; ry stock was rather weak because the hatchability of eggs laid by SF females produced by crossing females from this stock by males from the w1118 inducer strain was 32%. Thus, G1 females obtained in both experiments M7 and N1 differ only by their maternally inherited components: they have exactly the same genotype and, therefore, produce the same amount of reverse transcriptase for trans-complementation. 10457 G2 flies were observed in experiment N1, among which only one was [v+]: this represents a frequency of transposition of 0.1 x 10-3, which is 20-fold lower than the frequency observed in experiment M7. Therefore, as expected, IviP2 is mobilized more efficiently in a strongly reactive background than in a weakly reactive background.

Analysis of transposition events:
A total of 102 [v+] flies were recovered in these experiments, 10 of which died before any further analysis. To detect at the molecular level the presence of a spliced copy of IviP2, about half of these flies were submitted to PCR analysis as described previously (CHABOISSIER et al. 1995 Down). In all cases, the presence of a spliced copy could be detected, indicating that the observation of a [v+] phenotype is likely to be the result of a retrotransposition event of IviP2.

Some of the recovered flies were [v+; ry] and therefore did not contain the parental IviP2 donor element: this excludes the possibility that splicing of the intron would be an artifact that occurred at the DNA level on the parental IviP2 element. The flies that were [v+; ry+] were backcrossed to flies from the misy strain in order to check that [v+; ry] flies could be recovered in the next generation, indicating that the spliced copy can be separated from the parental IviP2 donor element. In only two cases was it impossible to separate the [v+] and [ry+] phenotypes, both determinants being localized on the X chromosome: in these two cases, the transposed copy of IviP2 probably inserted very close to the parental IviP2 element, but the possibility that the [v+] phenotype could be the result of an event other than retrotransposition cannot be excluded.

Most of the [v+] flies recovered in this work were found independently, but some of them appeared in clusters of two or three in the progeny of the same parents. The experiments described below were conducted to study the 3' ends and 3' flanking sequences of the transposed copies of IviP2, and to determine whether the ones that appeared in clusters result from a single retrotransposition event or not. Inverse PCR experiments were performed on ligated NdeII-cut DNA from 72 single [v+] flies using pairs of backward-oriented primers within the vermilion and the I factor sequences as shown in Figure 3. Amplification reactions were designed with an elongation time of 45 seconds, therefore, limiting the size of amplified fragments to around 1–1.5 kb. A single fragment of variable size (from 200 bp to 1.5 kb, depending on the couple of primers used) was amplified in 61 out of 72 cases. No amplification was detected in the 11 remaining cases, probably due to distance of the nearest NdeII site flanking the element. Sequences at the 3' ends of some of the transposed copies of IviP2 are shown in Figure 4. As expected, transposed copies terminate at their 3' ends by a variable number of TAA repeats: the same number (five) as the donor element, or either less (four) or more (six to eight). Flanking sequences at the 3' ends of the TAA repeats are all different from one another as well as from sequences that lie at the 3' end of the donor IviP2 element. This means that all transposed copies for which sequence information was available have inserted independently, even though some of them (for example, M3-12a and b, M4-10a and b, M7-7a and b) were recovered from the same parents. This corroborates previous observations suggesting that transposition of I elements is not a premeiotic event (PICARD et al. 1978 Down). Each of the sequences localized 3' to the transposed copies was used to search in databases. None of them corresponds to any known sequences except those flanking T2-6a that are identical to sequences present in the vicinity of the gene phyllopod (CHANG et al. 1995 Down).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Use of the hsp70 promoter to drive ORF2 expression:
The IviP2 element is likely to behave as an active I factor regarding RNA synthesis from the internal promoter of the I factor and production of the protein encoded by ORF1, but it cannot produce the protein normally encoded by ORF2. Therefore, this protein has to be provided in trans at the right place and the right time to allow retrotransposition of the IviP2 element to occur. In the experiments described here, the hsp70 promoter was used to drive ORF2 expression. This promoter is heat-inducible in nurse cells from early stages to stage 9 of oogenesis (ZIMMERMAN et al. 1983 Down; LIS et al. 1983 Down; BONNER et al. 1984 Down), which overlaps with the pattern of I factor expression (LACHAUME et al. 1992 Down; UDOMKIT et al. 1996 Down; M. C. SELEME and D. TENINGES, unpublished data). As shown by experiment M64, trans-complementation of IviP2 can occur, at low frequency, in the absence of heat shock, indicating that some product of ORF2 is synthesized probably because of a weak basal activity of the hsp70 promoter at 23° in ovaries (ZIMMERMAN et al. 1983 Down; KURTZ et al. 1986 Down), but is tenfold more efficient upon heat induction. This order of magnitude agrees with values obtained in other studies of reporter sequences whose transcription is driven by the hsp70 promoter (KLEMENZ et al. 1985 Down; HUNT et al. 1992 Down). Therefore, the rate of transposition of IviP2 in the experiments described here depends upon the quantity of reverse transcriptase (the product of ORF2) available for trans-complementation, and also depends upon the quantity of the transposition intermediary, i.e., the RNA synthesized from the I factor promoter in the IviP2 element: this is indicated by the observation that mobilization of IviP2 is more efficient in a strongly reactive background, allowing high activity of the I factor promoter (LACHAUME and PINON 1993 Down), than in a weakly reactive background.

Trans-complementation of IviP2 is more efficient with hsORF2HN than it is with hsORF2HR. This might appear surprising if one assumes that the reverse transcriptase recognizes some specific sequences at the 3' end of the I factor RNA: then one would expect that the 3' end of I present in hsORF2HN RNAs would compete with the 3' end of I present in IviP2 RNAs. However, such cis-required sequences have not been identified so far. Possibly, the difference between hsORF2HN and hsORF2HR could be a result of RNA stability. hsp70 termination sequences are known to activate rapid RNA degradation after heat-shock (PETERSEN and LINDQUIST 1988 Down, PETERSEN and LINDQUIST 1989 Down): RNAs synthesized from hsORF2HR, terminating with these sequences, might be less stable than RNAs synthesized from hsORF2HN that presumably terminate at the 3' end of I, but this has to be checked.

Use of marked I elements to study retrotransposition:
The use of marked I elements is crucial to study most aspects of the retrotransposition process. Several marked elements have been described in the past (PELISSON et al. 1991 Down; JENSEN and HEIDMANN 1991 Down; JENSEN et al. 1994 Down; CHABOISSIER et al. 1995 Down), but none could be mobilized at frequencies high enough to be useful for this purpose. Transposition of the IviP2 element is up to 20 times more efficient when the product of ORF2 is provided in trans by a construct in which this ORF is transcribed from the hsp70 promoter, after heat-shock induction, than when it is supplied by transposing I factors in the germline of SF females. The vermilion retrotransposition indicator provides a powerful and easy way to screen for retrotransposition events simply by observing flies. Transposed copies can easily be analyzed at the molecular level, with the use of probes homologous to sequences of the vermilion gene, or more rapidly by inverse PCR as illustrated in the present work. This will allow one to obtain unbiased information on insertion sites generally used by the I factor; most insertion sites identified so far were selected on the basis of mutant phenotypes and were therefore in genes, which may not represent preferential targets of I factors (BUCHETON 1990 Down).

Even in the best experimental conditions presented here, transposition of IviP2 still occurs at low frequencies compared to transposition of autonomous wild- type I factors. This is consistent with the cis-mechanism of LINE retrotransposition recently proposed by BOEKE 1997 Down, suggesting that the reverse transcriptase would preferentially mobilize the RNA molecule that encoded it. It is possible, however, that other marked I elements with the vermilion or another reporter gene inserted at different locations (within ORF1 or outside any ORF) would transpose more efficiently. However, retrotransposition of a complete I factor into which a reporter gene was inserted within the 3' UTR, outside from any coding sequences, was found to be inefficient (JENSEN and HEIDMANN 1991 Down).

Use of marked I elements for mutagenesis:
The use of transposable elements as mutagens is useful because it provides an easy way to clone the mutated gene. In Drosophila melanogaster, P element mutagenesis has become a routine technique of invaluable help in developmental studies. A limitation of the use of P elements is that presumably one third of Drosophila genes cannot be mutated this way (ENGELS 1989 Down). The use of transposable elements other than P offers the hope that they might have other target site preferences. Recently, DIMITRI et al. 1997 Down have shown that high mutation rates of genes located in heterochromatin are produced during I-R hybrid dysgenesis, suggesting that I factors transpose frequently in these regions. A mutagenesis system based on marked I elements could be particularly useful to clone these genes. The work presented here is a promising first step toward this goal. The rate of transposition of IviP2 in the best conditions is still ten times less than the rate of transposition of defective marked P elements mobilized in trans by the transposase under the control of the hsp70 promoter, which is usually around 1–5% (ENGELS 1989 Down). Other marked I elements might be more efficient in transposition and provide powerful new tools for Drosophila mutagenesis.


*  FOOTNOTES

1 Present address: Neurobiologie de l'Apprentissage et de la Mémoire, Université Paris XI, 91405 Orsay, France Back


*  ACKNOWLEDGMENTS

We thank ALAINLISSON for sharing his good ideas with us throughout this work and for critical reading of the manuscript, STÉPHANE OBERLANDER for invaluable help in experiments S1–4, and ERIC PETROCHILO for advice in PCR sequencing. This work was supported by grants from the Centre National de la Recherche Scientifique (UPR A9061), the Association pour la Recherche sur le Cancer (ARC contract 1132) and the Action Coordonnées Concertées des Sciences du Vivant (ACC–SV1).

Manuscript received July 6, 1997; Accepted for publication September 19, 1997.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ABAD, P., C. VAURY, A. PÉLISSON, M. C. CHABOISSIER, and I. BUSSEAU et al., 1989  A long interspersed repetitive element—the I factor of Drosophila teissieri—is able to transpose in different Drosophila species. Proc. Natl. Acad. Sci. USA 86:8887-8891[Abstract/Free Full Text].

BOEKE, J. D., 1997  LINEs and Alus-the polyA connection. Nature 16:6-7.

BONNER, J. J., C. PARKS, T. J. PARKER, M. A. MORTIN, and H. R. PELHAM, 1984  The use of promoter fusions in Drosophila genetics: isolation of mutations affecting the heat shock response. Cell 37:979-991[Medline].

BOUHIDEL, K., C. TERZIAN, and H. PINON, 1994  The full-length transcript of the I factor, a LINE element of Drosophila melanogaster, is a potential bicistronic RNA messenger. Nucleic Acids Res. 22:2370-2374[Abstract/Free Full Text].

BREGLIANO, J.-C., and M. G. KIDWELL, 1983 Hybrid dysgenesis determinants, pp. 363–410 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, DC.

BUCHETON, A., 1978  Non-mendelian female sterility in Drosophila melanogaster : influence of aging and thermic treatments: I. Evidence for a partly inheritable effect of these two factors. Heredity 41:357-369[Medline].

BUCHETON, A., 1979a  Non-mendelian female sterility in Drosophila melanogaster : influence of aging and thermic treatments: II. Action of thermic treatments on the sterility of SF females and on the reactivity of reactive females. Biol. Cell 34:43-50.

BUCHETON, A., 1979b  Non-mendelian female sterility in Drosophila melanogaster : influence of aging and thermic treatments: III. Cumulative effects induced by these factors. Genetics 93:131-142[Abstract].

BUCHETON, A., 1990  I transposable elements and I-R hybrid dysgenesis in Drosophila. Trends Genet. 6:16-21[Medline].

BUCHETON, A. and J.-C. BREGLIANO, 1982  The I-R system of hybrid dysgenesis in Drosophila melanogaster : heredity of the reactive condition. Biol. Cell 46:123-132.

BUCHETON, A. and G. PICARD, 1978  Non-mendelian female sterility in Drosophila melanogaster : hereditary transmission of reactivity levels. Heredity 40:207-223.

BUCHETON, A., J.-M. LAVIGE, G. PICARD, and P. L'HERITIER, 1976  Non-mendelian female sterility in Drosophila melanogaster : quantitative variations in the efficiency of inducer and reactive strains. Heredity 36:305-314[Medline].

BUCHETON, A., R. PARO, H. M. SANG, A. PELISSON, and D. J. FINNEGAN, 1984  The molecular basis of I-R hybrid dysgenesis in Drosophila melanogaster : identification, cloning, and properties of the I factor. Cell 38:153-163[Medline].

BUCHETON, A., C. VAURY, M. C. CHABOISSIER, P. ABAD, and A. PELISSON et al., 1992  I elements and the Drosophila genome. Genetica 86:175-190[Medline].

BUSSEAU, I., M. C. CHABOISSIER, A. PÉLISSON, and A. BUCHETON, 1994  I factors in Drosophila melanogaster : transposition under control. Genetica 93:101-116[Medline].

CHABOISSIER, M. C., I. BUSSEAU, J. PROSSER, D. J. FINNEGAN, and A. BUCHETON, 1990  Identification of a potential RNA intermediate for transposition of the LINE-like element I factor in Drosophila melanogaster. EMBO J. 9:3557-3563[Medline].

CHABOISSIER, M. C., C. BORNECQUE, I. BUSSEAU, and A. BUCHETON, 1995  A genetically tagged, defective I element can be complemented by actively transposing I factors in the germline of I-R dysgenic females in Drosophila melanogaster.. Mol. Gen. & Genet. 248:434-438[Medline].

CHANG, H. C., N. M. SOLOMON, D. A. WASSARMAN, F. D. KARIM, and M. THERRIEN et al., 1995  phyllopod functions in the fate determination of a subset of photoreceptors in Drosophila. Cell 80:463-472[Medline].

DAWSON, A., E. HARTSWOOD, T. PATERSON, and D. J. FINNEGAN, 1997  A LINE-like transposable element in Drosophila, the I factor, encodes a protein with properties similar to those of retroviral nucleocapsids. EMBO J. in press.

DIMITRI, P., B. ARCA, L. BERGHELLA, and E. MEI, 1997  High genetic instability of heterochromatin following transposition of the LINE-like I factor in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 94:8052-8057[Abstract/Free Full Text].

EICKBUSH, T. H., 1992  Transposing without ends: the non-LTR retrotransposable elements. New Biol. 4:430-440[Medline].

ENGELS, W. R., 1989 P elements in Drosophila, pp. 437–484 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, DC.

FAWCETT, D. H., C. K. LISTER, E. KELLETT, and D. J. FINNEGAN, 1986  Transposable elements controlling I-R hybrid dysgenesis in D. melanogaster are similar to mammalian LINEs. Cell 47:1007-1015[Medline].

FENG, Q., J. V. MORAN, H. J. KAZAZIAN, and J. D. BOEKE, 1996  Hu-man L1 retrotransposon encodes a conserved endonuclease required for retrotransposition. Cell 87:905-916[Medline].

GANS, M., C. AUDIT, and M. MASSON, 1975  Isolation and characterization of sex-linked female-sterile mutants in Drosophila melanogaster. Genetics 81:683-704[Abstract].

GLOOR., G., C. R. PRESTON, D. M. JOHNSON-SCHLITZ, N. A. NASSIF, and R. W. PHILLIS et al., 1993  Type I repressors of P element mobility. Genetics 135:81-95[Abstract].

GLOOR, G. and W. R. ENGELS, 1995  Single fly DNA prep for PCR. Drosophila Inform. Serv. 71:148-149.

HEIDMANN, T., O. HEIDMANN, and J. F. NICOLAS, 1988  An indicator gene to demonstrate intracellular transposition of defective retroviruses. Proc. Natl. Acad. Sci. USA 85:2219-2223[Abstract/Free Full Text].

HUNT, S. M., M. R. WILKINS, H. W. STOKES, G. E. DAGGARD, and R. FRANKHAM, 1992  Induced expression of a Drosophila hsp70 promoter-fusion transgene is reduced after repeated heat shocks. Genet. Res. 59:183-188[Medline].

JENSEN, S. and T. HEIDMANN, 1991  An indicator gene for detection of germline retrotransposition in transgenic Drosophila demonstrates RNA-mediated transposition of the LINE I element. EMBO J. 10:1927-1937[Medline].

JENSEN, S., L. CAVAREC, O. DHELLIN, and T. HEIDMANN, 1994  Re- rotransposition of a marked Drosophila line-like I element in cells in culture. Nucleic Acids Res. 22:1484-1488[Abstract/Free Full Text].

KLEMENZ, R., D. HULTMARK, and W. J. GEHRING, 1985  Selective translation of heat shock mRNAs in Drosophila melanogaster depends on sequence information in the leader. EMBO J. 4:2053-2060[Medline].

KURTZ, S., J. ROSSI, L. PETKO, and S. LINDQUIST, 1986  An ancient developmental induction: heat-shock proteins induced in sporulation and oogenesis. Science 231:1154-1157[Abstract/Free Full Text].

LACHAUME, P., K. BOUHIDEL, M. MESURE, and H. PINON, 1992  Spa-tial and temporal expression of the I factor during oogenesis in Drosophila melanogaster. Development 115:729-735[Abstract].

LACHAUME, P. and H. PINON, 1993  Germ-line expression of the I factor, a functional LINE from the fruit fly Drosophila melanogaster, is positively regulated by reactivity, a peculiar cellular state. Mol. & Gen. Genet. 240:277-285[Medline].

LAVIGE, J.-M., 1986  I-R system of hybrid dysgenesis in Drosophila melanogaster : further data on the arrest of development of the embryos from SF females. Biol. Cell. 56:207-216.

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, New York.

LIS, J. T., J. A. SIMON, and C. A. SUTTON, 1983  New heat shock puffs and ß-galactosidase activity resulting from transformation of Drosophila with an hsp70-lacZ hybrid gene. Cell 35:403-410[Medline].

NING, K. G., 1981  Genetics of inbred Drosophila melanogaster : I. Induction of marker genes and preliminary recombination tests. Hereditas 95:181-188.

MAESTRE, J., T. TCHENIO, O. DHELLIN, and T. HEIDMANN, 1995  RNA retroposition in human cells: processed pseudogene formation. EMBO J. 14:6333-6338[Medline].

MARTIN, F., C. MARANON, M. OLIVARES, C. ALONSO, and M. C. LOPEZ, 1995  Characterization of a non-long terminal repeat retrotransposon cDNA (L1Tc) from Trypanosoma cruzi: homology of the first ORF with the APE family of DNA repair enzymes. J. Mol. Biol. 247:49-59[Medline].

MCLEAN, C., A. BUCHETON, and D. J. FINNEGAN, 1993  The 5' untranslated region of the I factor, a long interspersed nuclear element-like retrotransposon of Drosophila melanogaster, contains an internal promoter and sequences that regulate expression. Mol. Cell. Biol. 13:1042-1050[Abstract/Free Full Text].

MORAN, J. V., S. E. HOLMES, T. P. NAAS, R. J. DEBERARDINIS, and J. D. BOEKE et al., 1996  High frequency retrotransposition in cultured mammalian cells. Cell 87:917-927[Medline].

LISSON, A., 1981  The I-R system of hybrid dysgenesis in Drosophila melanogaster : are I factor insertions responsible for the mutator effect of the I-R interaction? Mol. & Gen. Genet. 183:123-129[Medline].

LISSON, A., D. J. FINNEGAN, and A. BUCHETON, 1991  Evidence for retrotransposition of the I factor, a LINE element of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 88:4907-4910[Abstract/Free Full Text].

PETERSEN, R. and S. LINDQUIST, 1988  The Drosophila hsp70 message is rapidly degraded at normal temperatures and stabilized by heat shock. Gene 72:161-168[Medline].

PETERSEN, R. B. and S. LINDQUIST, 1989  Regulation of hsp70 synthesis by messenger RNA degradation. Cell Regul. 1:135-149[Medline].

PICARD, G., 1976  Non-mendelian female sterility in Drosophila mela-nogaster : hereditary transmission of the I factor. Genetics 83:107-123[Abstract].

PICARD, G., 1978  Non-mendelian female sterility in Drosophila mela-nogaster : further data on chromosomal contamination. Mol. Gen. & Genet. 164:235-247.

PICARD, G. and P. L'HÉRITIER, 1971  A maternally inherited factor inducing sterility in Drosophila melanogaster. Drosophila Inform. Serv. 46:54.

PICARD, G., J.-C. BREGLIANO, A. BUCHETON, J.-M. LAVIGE, A. PELISSON, and M. G. KIDWELL, 1978  Non-mendelian female sterility and hybrid dysgenesis in Drosophila melanogaster. Genet. Res. 32:275-287[Medline].

PRITCHARD, M. A., J.-M. DURA, A. PÉLISSON, A. BUCHETON, and D. J. FINNEGAN, 1988  A cloned I factor is fully functional in Drosophila melanogaster. Mol. & Gen. Genet. 214:533-540[Medline].

SASSAMAN, D. M., B. A. DOMBROSKI, J. M. MORAN, M. L. KIMBERLAND, and T. P. NAAS et al., 1997  Many human L1 elements are capable of retrotransposition. Nature 16:37-43.

SPRADLING, A. C. and G. M. RUBIN, 1982  Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353[Abstract/Free Full Text].

TCHENIO, T., B. E. SEGAL, and T. HEIDMANN, 1993  Generation of processed pseudogenes in murine cells. EMBO J. 12:1487-1497[Medline].

THUMMEL, C. S., and V. PIROTTA, 1991 New pCaSpeR P element vectors. Drosophila Information Newsletter 2.

UDOMKIT, A., S. FORBES, I. ARKHIPOVA, C. MCLEAN, and D. J. FINNEGAN, 1996  Control of expression of the I factor, a LINE-like transposable element in Drosophila melanogaster. EMBO J. 15:3174-3181[Medline].

ZIMMERMAN, J. L., W. PETRI, and M. MESELSON, 1983  Accumulation of a specific subset of D. melanogaster heat shock mRNAs in normal development without heat shock. Cell 32:1161-1170[Medline].




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. d. C. Seleme, O. Disson, S.ép. Robin, C. Brun, D. Teninges, and A. Bucheton
In vivo RNA localization of I factor, a non-LTR retrotransposon, requires a cis-acting signal in ORF2 and ORF1 protein
Nucleic Acids Res., February 1, 2005; 33(2): 776 - 785.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Robin, S. Chambeyron, A. Bucheton, and I. Busseau
Gene Silencing Triggered by Non-LTR Retrotransposons in the Female Germline of Drosophila melanogaster
Genetics, June 1, 2003; 164(2): 521 - 531.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Chambeyron, A. Bucheton, and I. Busseau
Tandem UAA Repeats at the 3'-End of the Transcript Are Essential for the Precise Initiation of Reverse Transcription of the I Factor in Drosophila melanogaster
J. Biol. Chem., May 10, 2002; 277(20): 17877 - 17882.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. Gauthier, C. Tatout, and H. Pinon
Artificial and Epigenetic Regulation of the I Factor, a Nonviral Retrotransposon of Drosophila melanogaster
Genetics, December 1, 2000; 156(4): 1867 - 1878.
[Abstract] [Full Text]


Home page
GeneticsHome page
S. Malinsky, A. Bucheton, and I. Busseau
New Insights on Homology-Dependent Silencing of I Factor Activity by Transgenes Containing ORF1 in Drosophila melanogaster
Genetics, November 1, 2000; 156(3): 1147 - 1155.
[Abstract] [Full Text]


Home page
GeneticsHome page
M.-d.-C. Seleme, I. Busseau, S. Malinsky, A. Bucheton, and D. Teninges
High-Frequency Retrotransposition of a Marked I Factor in Drosophila melanogaster Correlates With a Dynamic Expression Pattern of the ORF1 Protein in the Cytoplasm of Oocytes
Genetics, February 1, 1999; 151(2): 761 - 771.
[Abstract] [Full Text]